Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 12 de 12
Filtrar
1.
Vet World ; 16(5): 1061-1070, 2023 May.
Artículo en Inglés | MEDLINE | ID: mdl-37576752

RESUMEN

Background and Aim: Infectious bursal disease (IBD) is an infectious immunosuppressive disease that affects young chickens. Instead of strict biosecurity practices, vaccination is used to control IBD. However, the disease has not been effectively managed. Variations in the observed clinical symptoms lead to confounding diagnoses. The study aimed to obtain pathological lesion data from chickens suspected of IBD virus (IBDV) infection by gross pathology, confirm IBDV infection through molecular diagnostics, and genotype the VP1 gene fragments of circulating IBDV in the field. Materials and Methods: The bursa of Fabricius, thymus, spleen, proventricular-ventricular junction, thigh muscles, and kidneys samples were collected from chickens suspected of IBDV infection from four commercial broiler farms in Central Java and The Yogyakarta Special Region Province between 2021 and 2022. The collected samples were examined histopathologically. Infectious bursal disease virus RNA was extracted from the bursa of Fabricius and VP1 gene was identified by reverse-transcriptase polimerase chain reaction (RT-PCR). The RT-PCR positive sample were sequenced and analyzed in Mega X for homology search and phylogenetic tree analysis. Results: Macroscopic pathological lesions in the bursa of Fabricius were demonstrated by enlarged edema and thickened plica, presence of gelatinous exudate, hemorrhage, atrophy, and caseous exudate in the lumen. Moreover, the thymus had atrophy and small gray foci were observed in the spleen. Petechiae or hemorrhage was detected on the thigh muscle, and the kidney was dull and pale. Hemorrhage in the proventricular-ventricular junction was distinct. The histopathological examination of the bursa of Fabricius showed follicular vacuolization, edema, heterophilic infiltration, follicular atrophy, congestion, and hemorrhage. The thymus and spleen showed the presence of multifocal necrosis. Hemorrhage was observed in thigh muscle and mucosal part of proventricular-ventricular junction. Vacuolization was seen in renal tubules (nephrosis). Reverse transcriptase-PCR of 26 bursa of Fabricius samples from chickens suspected of IBDV infection showed four negative and 22 positive samples. Phylogenetic analysis of the VP1 gene fragment has indicated very virulent IBD (vvIBD) and belonged to B2 genotype. Conclusion: Infectious bursal diseases virus infection in broiler chicken generated macroscopic and microscopic primary lesions in the bursa of Fabricius and thigh muscle. Other organs such as the spleen, thymus, proventricular-ventricular junction, and kidney, were also involved. Molecular analysis of the VP1 gene confirmed the causative agent and grouped the virus into vvIBD and B2 genotype. All samples were collected from vaccinated birds therefore, the efficacy of available vaccine is required for urgent evaluation. Since most studies only focused on VP1, further exploration on VP2 gene is suggested notably for new-generation vaccines. Monitoring clinical signs' transformation over time could assist field diagnostics.

2.
Vet World ; 15(6): 1467-1480, 2022 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-35993083

RESUMEN

Background and Aim: Newcastle disease (ND) is a viral infectious disease that affects commercial and native chickens, resulting in economic losses to the poultry industry. This study aimed to examine the viral strains circulating in commercial and native chickens by genetic characterization and observe the distribution of Newcastle disease virus (NDV) in chicken embryonic tissue. Materials and Methods: ND was detected using a quantitative reverse transcription-polymerase chain reaction. Genetic characterization of the fusion (F) and hemagglutinin-neuraminidase (HN) genes from the eight NDVs was performed using specific primers. The sequence was compared with that of other NDVs from GenBank and analyzed using the MEGA-X software. The distribution of NDV in chicken embryos was analyzed based on lesions and the immunopositivity in immunohistochemistry staining. Results: Based on F gene characterization, velogenic NDV strains circulating in commercial and native chickens that showed varying clinical symptoms belonged to genotype VII.2. Lentogenic strains found in chickens without clinical symptoms were grouped into genotype II (unvaccinated native chickens) and genotype I (vaccinated commercial chickens). Amino acid variations in the HN gene, namely, the neutralization epitope and antigenic sites at positions 263 and 494, respectively, occurred in lentogenic strains. The NDV reaches the digestive and respiratory organs, but in lentogenic NDV does not cause significant damage, and hence embryo death does not occur. Conclusion: This study showed that velogenic and lentogenic NDV strains circulated in both commercial and native chickens with varying genotypes. The virus was distributed in almost all organs, especially digestive and respiratory. Organ damage in lentogenic infection is not as severe as in velogenic NDV. Further research is needed to observe the distribution of NDV with varying pathogenicity in chickens.

3.
Vet World ; 13(11): 2493-2501, 2020 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-33363346

RESUMEN

BACKGROUND AND AIM: Newcastle disease (ND) and avian influenza (AI) are two devastating diseases of poultry, which cause great economic losses to the poultry industry and disrupt food security in our country. The use of ND-AI inactive bivalent vaccine is very effective and economical to prevent and control ND and AI disease. Bivalent ND LaSota-AI H9N2 vaccine is not yet available in Indonesia. The inactivated vaccines used in poultry industry often require oil adjuvant to elicit a sufficient immune response. This study aimed to develop the bivalent inactive vaccines containing ND LaSota and AI H9N2 Sidrap isolate which are local isolates as poultry vaccine candidates, and formulated with two different commercial adjuvants, then compared. MATERIALS AND METHODS: Two vaccines bivalent were prepared by emulsifying inactivated Newcastle disease virus (LaSota strain) and AI H9N2 Sidrap isolate viruses with Marcol white mineral oil and Montanide ISA70 adjuvants. Both of bivalent vaccines were tested for safety (physical and histopathological at the injection site) and efficacy in specific-pathogen-free chickens. Parameters used for the evaluation of the efficacy were immunogenicity by hemagglutination inhibition and protection percentage. RESULTS: Both bivalent vaccines are safe to use. Post-vaccination (PV) immune response was observed using a hemagglutination inhibition test at 2, 3, 4, 5, 6, 7, and 8 weeks of PV. The bivalent vaccine B gives a better immune response to ND at 2, 3, and 4 weeks of PV (p<0.05) compared to the bivalent vaccine A, but in 5, 6, 7, and 8 weeks, the PV does not show differences in the immune response. The immune response to AI H9N2 showed differences at weeks 2 and 3 PV (p<0.05) with the bivalent vaccine B indicated higher immunity. A single immunization with both bivalent vaccines induces 100% protection in chickens that have been vaccinated against the deadly challenge with the virulent ND virus. CONCLUSION: Both of bivalent vaccines are safe to use and provide good efficacy against virulent ND viruses, but bivalent vaccine B (with Montanide ISA70 adjuvant) shows better immune response than bivalent vaccine A (Marcol white mineral oil adjuvant).

4.
Avian Pathol ; 49(2): 161-170, 2020 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-31738584

RESUMEN

The H5N1 subtype of highly pathogenic avian influenza virus has been circulating in poultry in Indonesia since 2003 and vaccination has been used as a strategy to eradicate the disease. However, monitoring of vaccinated poultry flocks for H5N1 infection by serological means has been difficult, as vaccine antibodies are not readily distinguishable from those induced by field viruses. Therefore, a test that differentiates infected and vaccinated animals (DIVA) would be essential. Currently, no simple and specific DIVA test is available for screening of a large number of vaccinated chickens. Several epitopes on E29 domain of the haemagglutinin H5N1 subunit 2 (HA2) have recently been examined for their antigenicity and potential as possible markers for DIVA in chicken. In this study, the potential of E29 as an antigen for DIVA was evaluated in detail. Three different forms of full-length E29 peptide, a truncated E29 peptide (E15), and a recombinant E29 were compared for their ability to detect anti-E29 antibodies. Preliminary ELISA experiments using mono-specific chicken and rabbit E29 sera, and a mouse monoclonal antibody revealed that the linear E29 peptide was the most antigenic. Further examination of the E29 antigenicity in ELISA, using several sera from experimentally infected or vaccinated chickens, revealed that the full-length E29 peptide had the greatest discrimination power between infected and vaccinated chicken sera while providing the least non-specific reaction. This study demonstrates the usefulness of the HPAI H5N1 HA2 E29 epitope as a DIVA antigen in HPAI H5N1-vaccinated and -infected chickens.RESEARCH HIGHLIGHTS E29 (HA2 positions 488-516) epitope is antigenic in chickens.Antibodies to E29 are elicited following live H5N1 virus infection in chickens.E29 epitope is a potential DIVA antigen for use in ELISA.


Asunto(s)
Anticuerpos Antivirales/sangre , Epítopos/inmunología , Hemaglutininas Virales/inmunología , Subtipo H5N1 del Virus de la Influenza A/inmunología , Vacunas contra la Influenza/inmunología , Gripe Aviar/prevención & control , Animales , Anticuerpos Antivirales/inmunología , Antígenos Virales , Pollos , Hemaglutininas Virales/química , Gripe Aviar/diagnóstico , Gripe Aviar/virología , Subunidades de Proteína , Vacunación
5.
Avian Dis ; 63(4): 619-624, 2019 12.
Artículo en Inglés | MEDLINE | ID: mdl-31865676

RESUMEN

Fowl adenovirus (FAdV) infection is an emerging problem in the world poultry industry, especially in broilers, as the causal agent of inclusion body hepatitis or hepatitis-hydropericardium syndrome. From December 2017 to January 2019, we recorded 116 cases of suspected hepatitis-hydropericardium syndrome in chicken farms throughout Indonesia. Necropsy was done on each farm site with three to five freshly dead birds per farm. Tissue samples were collected in virus transport medium and frozen at -20 C. The virus was cultivated in 9-day-old fertilized specific-pathogenic-free chicken eggs. FAdV was detected using polymerase chain reaction with a published primer set. The polymerase chain reaction products were sequenced and subjected to a BLAST search. The phylogeny was inferred using the neighbor-joining method and tested using the bootstrap test. FadV-D and -E are present in Indonesia and confirmed in 40 of 116 suspected cases. The affected chicken ages were 27.27 ± 8.94 days. Most affected farms were raising broiler chickens. The only typical clinical sign was unusual daily mortality of >1%, while the three most frequent pathologic lesions were swelling and hemorrhage of kidney and liver, as well as hydropericardium. To reduce economic loss, a vaccine should be developed immediately.


Epizootiología, signos clínicos y análisis filogenético del adenovirus de pollos en granjas avícolas en Indonesia entre los años 2018 a 2019. La infección por adenovirus de aves (FAdV) es un problema emergente en la industria avícola mundial, especialmente en pollos de engorde, como agente causal de la hepatitis por cuerpos de inclusión y del síndrome de hepatitis-hidropericardio. Desde diciembre del año 2017 hasta enero de 2019, se registraron 116 casos sospechosos de síndrome de hepatitis-hidropericardio en granjas avícolas en toda Indonesia. Se realizaron necropsias en los sitios de las granjas con tres a cinco aves recién muertas por granja. Se recogieron muestras de tejido en medio de transporte viral y se congelaron a -20 C. El virus se cultivó en huevos embrionados de aves libres de patógenos específicos de 9 días de edad. Se detectaron adenovirus del pollo usando una reacción en cadena de la polimerasa con un conjunto de iniciadores previamente publicados. Los productos de reacción en cadena de la polimerasa se secuenciaron y se sometieron a una búsqueda mediante la herramienta básica de búsqueda de alineación local (BLAST). La filogenia se infirió usando el método Neighbor-Joining y se evaluó mediante la prueba bootstrap. Se determinó la presencia de adenovirus del pollo D y E en Indonesia y se confirmó su presencia en 40 de 116 casos sospechosos. Las edades de los pollos afectados fueron de 27.27 ± 8.94 días. Las granjas más afectadas fueron de pollos de engorde. El único signo clínico típico fue una mortalidad diaria inusual mayor al 1%, mientras que las tres lesiones patológicas más frecuentes fueron inflamación y hemorragia de riñón e hígado, así como hidropericardio. Para reducir la pérdida económica, se debe desarrollar una vacuna de inmediato.


Asunto(s)
Infecciones por Adenoviridae/veterinaria , Pollos , Epidemias/veterinaria , Adenovirus A Aviar/fisiología , Enfermedades de las Aves de Corral , Infecciones por Adenoviridae/epidemiología , Infecciones por Adenoviridae/patología , Animales , Adenovirus A Aviar/clasificación , Indonesia/epidemiología , Filogenia , Enfermedades de las Aves de Corral/epidemiología , Enfermedades de las Aves de Corral/patología , Organismos Libres de Patógenos Específicos
6.
Emerg Infect Dis ; 25(3): 465-472, 2019 03.
Artículo en Inglés | MEDLINE | ID: mdl-30789142

RESUMEN

Highly pathogenic avian influenza (HPAI) A(H5N1) viruses have been circulating since 2003 in Indonesia, with major impacts on poultry health, severe economic losses, and 168 fatal laboratory-confirmed human cases. We performed phylogenetic analysis on 39 full-genome H5N1 virus samples collected during outbreaks among poultry in 2015-2016 in West Java and compared them with recently published sequences from Indonesia. Phylogenetic analysis revealed that the hemagglutinin gene of all samples belonged to 2 genetic groups in clade 2.3.2.1c. We also observed these groups for the neuraminidase, nucleoprotein, polymerase, and polymerase basic 1 genes. Matrix, nonstructural protein, and polymerase basic 2 genes of some HPAI were most closely related to clade 2.1.3 instead of clade 2.3.2.1c, and a polymerase basic 2 gene was most closely related to Eurasian low pathogenicity avian influenza. Our results detected a total of 13 reassortment types among HPAI in Indonesia, mostly in backyard chickens in Indramayu.


Asunto(s)
Subtipo H5N1 del Virus de la Influenza A/genética , Gripe Aviar/epidemiología , Gripe Aviar/virología , Enfermedades de las Aves de Corral/epidemiología , Enfermedades de las Aves de Corral/virología , Virus Reordenados/genética , Secuencia de Aminoácidos , Animales , Brotes de Enfermedades , Genotipo , Glicoproteínas Hemaglutininas del Virus de la Influenza/genética , Humanos , Indonesia/epidemiología , Subtipo H5N1 del Virus de la Influenza A/clasificación , Filogenia , Aves de Corral , Vigilancia en Salud Pública , Virus Reordenados/clasificación , Análisis de Secuencia de ADN
7.
Vet World ; 11(9): 1255-1261, 2018 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-30410230

RESUMEN

AIM: Previous research has shown that bovine herpesvirus-1 (BHV-1) in Indonesia was closely related to subtype-1 based on glycoprotein D genes. This study aimed to analyze the genetic variability of the BHV-1 isolated from the recent case in Indonesia not only based on gD but also other genes such as gB and gM and to study the homology and similarity of the sample to other BHV-1 isolated in other countries or regions. MATERIALS AND METHODS: Samples were drawn from the tracheal organ in recent field case and prepared for DNA extraction. The gB, gD, and gM were amplified using nested polymerase chain reaction (nPCR) with our specifically designed primer pair and based on the specified bands of 350 bp gB, 325 bp gD, and 734 bp gM confirmed as BHV-1. The PCR product was ligated into pGEM-T and transformed into competent Escherichia coli. The purified plasmid was subsequently sequenced. RESULTS: The virus sample isolated from the recent field case of infectious bovine rhinotracheitis (IBR) from Indonesia showed variability based on the gB, gD, and gM sequences. However, all of the genes had high similarity (98-100%) to BHV-1.2. CONCLUSION: The recent field case of IBR in Indonesia was similar to BHV-1.2.

8.
Vet World ; 11(5): 657-666, 2018 May.
Artículo en Inglés | MEDLINE | ID: mdl-29915505

RESUMEN

BACKGROUND AND AIM: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains. MATERIALS AND METHODS: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program. RESULT: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%. CONCLUSION: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

9.
PLoS One ; 13(1): e0190947, 2018.
Artículo en Inglés | MEDLINE | ID: mdl-29320563

RESUMEN

Although vaccination of poultry for control of highly pathogenic avian influenza virus (HPAIV) H5N1 has been practiced during the last decade in several countries, its effectiveness under field conditions remains largely unquantified. Effective HPAI vaccination is however essential in preventing incursions, silent infections and generation of new H5N1 antigenic variants. The objective of this study was to asses the level and duration of vaccine induced immunity in commercial layers in Indonesia. Titres of H5N1 haemagglutination inhibition (HI) antibodies were followed in individual birds from sixteen flocks, age 18-68 week old (wo). The study revealed that H5N1 vaccination had highly variable outcome, including vaccination failures, and was largely ineffective in providing long lasting protective immunity. Flocks were vaccinated with seven different vaccines, administer at various times that could be grouped into three regimes: In regime A, flocks (n = 8) were vaccinated two or three times before 19 wo; in regime B (n = 2), two times before and once after 19 wo; and in regime C (n = 6) three to four times before and two to three times after 19 wo. HI titres in regime C birds were significantly higher during the entire observation period in comparison to titres of regime A or B birds, which also differed significantly from each other. The HI titres of individual birds in each flock differed significantly from birds in other flocks, indicating that the effectiveness of field vaccination was highly variable and farm related. Protective HI titres of >4log2, were present in the majority of flocks at 18 wo, declined thereafter at variable rate and only two regime C flocks had protective HI titres at 68 wo. Laboratory challenge with HPAIV H5N1 of birds from regime A and C flocks confirmed that protective immunity differed significantly between flocks vaccinated by these two regimes. The study revealed that effectiveness of the currently applied H5N1 vaccination could be improved and measures to achieve this are discussed.


Asunto(s)
Pollos , Subtipo H5N1 del Virus de la Influenza A/inmunología , Vacunas contra la Influenza , Gripe Aviar/prevención & control , Enfermedades de las Aves de Corral/prevención & control , Crianza de Animales Domésticos , Animales , Anticuerpos Antivirales/sangre , Pollos/inmunología , Pollos/virología , Pruebas de Inhibición de Hemaglutinación , Indonesia , Vacunas contra la Influenza/administración & dosificación , Gripe Aviar/inmunología , Gripe Aviar/virología , Estudios Longitudinales , Enfermedades de las Aves de Corral/inmunología , Enfermedades de las Aves de Corral/virología , Estudios Prospectivos , Insuficiencia del Tratamiento
10.
J Virol Methods ; 249: 181-188, 2017 11.
Artículo en Inglés | MEDLINE | ID: mdl-28843786

RESUMEN

In countries where highly pathogenic avian influenza virus (HPAIV) H5N1 is endemic and controlled by vaccination, post-vaccination serological monitoring is essential to differentiate vaccinated poultry from those that are infected. The objectives of this study were to validate two experimental ELISAs that detect antibodies raised against the M2e protein of avian influenza virus that can be used for DIVA purposes. Results from the sM2e and tM2e ELISAs were compared with other conventional tests for the detection of H5N1influenza virus (virus isolation and RT-PCR) using samples collected from 16 commercial flocks in Indonesia. These comprised vaccinated layers aged between 18 and 68 weeks old that were sampled at ten-weekly intervals. A small number of sera were positive in sM2e and tM2e ELISA, 14 (0.6%) and 17 (0.7%) respectively, with low OD420 (0.1-0.3), but only 4 sera were positive in both tests. At the flock level, the incidence of M2e positive sera was low (4%), well below previously established minimum of 40% for an HPAIV H5N1-infected flock. Conventional M and H5 gene RT-PCRs indicated that none of 16 flocks were infected at any time during the study. No virus was isolated from any of the 480 pooled swab samples, except from one, for which the combined data analysis suggest to be the result of a laboratory cross-contamination. Clinical disease, mortalities or reduction in production performance, indicative of field H5N1 challenge, were not observed either in any of the flocks. Birds from two surveyed flocks, challenged in the laboratory with an Indonesian HPAIV H5N1 developed M2e antibodies in 50% and 55% of surviving birds with OD420 in the range of 0.35-1.47 in tM2e ELISA, confirming the validity of the criteria established for use of M2e ELISA for DIVA purposes. Overall these results showed that the tM2e ELISA could be a useful monitoring tool to ascertain freedom from H5N1 infections in vaccinated commercial poultry.


Asunto(s)
Anticuerpos Antivirales/sangre , Ensayo de Inmunoadsorción Enzimática/métodos , Vigilancia Inmunológica , Subtipo H5N1 del Virus de la Influenza A/inmunología , Vacunas contra la Influenza/inmunología , Gripe Aviar/inmunología , Animales , Indonesia/epidemiología , Subtipo H5N1 del Virus de la Influenza A/genética , Subtipo H5N1 del Virus de la Influenza A/patogenicidad , Vacunas contra la Influenza/administración & dosificación , Gripe Aviar/epidemiología , Gripe Aviar/prevención & control , Aves de Corral/inmunología , Aves de Corral/virología , Enfermedades de las Aves de Corral/inmunología , Enfermedades de las Aves de Corral/virología , Vacunación/veterinaria
11.
Acta Trop ; 172: 223-228, 2017 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-28506793

RESUMEN

Cattle are known as the main reservoir of zoonotic agents verocytotoxin-producing Escherichia coli. These bacteria are usually isolated from calves with diarrhea and/or mucus and blood. Tolerance of these agents to the environmental conditions will strengthen of their transmission among livestock. A total of 238 cattle fecal samples from four sub-districts in Badung, Bali were used in this study. Epidemiological data observed include cattle age, sex, cattle rearing system, the source of drinking water, weather, altitude, and type of cage floor, the cleanliness of cage floor, the slope of cage floor, and the level of cattle cleanliness. The study was initiated by culturing of samples onto eosin methylene blue agar, then Gram stained, and tested for indole, methyl-red, voges proskauer, and citrate, Potential E.coli isolates were then cultured onto sorbitol MacConkey agar, and further tested using O157 latex agglutination test and H7 antisera. Molecular identification was performed by analysis of the 16S rRNA gene, and epidemiological data was analyzed using STATA 12.0 software. The results showed, the prevalence of E. coli O157:H7 in cattle at Badung regency was 6.30% (15/238) covering four sub districts i.e. Petang, Abiansemal, Mengwi, and Kuta which their prevalence was 8.62%(5/58), 10%(6/60), 3.33%(2/60), and 3.33(2/60)%, respectively. The analysis of 16S rRNA gene confirmed of isolates as an E. coli O157:H7 strain with 99% similarities. Furthermore, the risk factors analysis showed that the slope of the cage floor has a highly significant effect (P<0.05) to the distribution of infection. Consequently, implementing this factor must be concerned in order to decrease of infection.


Asunto(s)
Enfermedades de los Bovinos/microbiología , Infecciones por Escherichia coli/veterinaria , Escherichia coli O157 , Animales , Bovinos , Enfermedades de los Bovinos/epidemiología , Infecciones por Escherichia coli/epidemiología , Infecciones por Escherichia coli/microbiología , Heces/microbiología , Humanos , Indonesia/epidemiología , Prevalencia , ARN Bacteriano/genética , ARN Ribosómico 16S/genética , Factores de Riesgo
12.
Avian Dis ; 60(1 Suppl): 183-90, 2016 05.
Artículo en Inglés | MEDLINE | ID: mdl-27309054

RESUMEN

To help guide surveillance and control of highly pathogenic avian influenza subtype H5N1 (H5N1-HPAI), the Food and Agriculture Organization of the United Nations in 2004 devised a poultry farm classification system based on a combination of production and biosecurity practices. Four "Sectors" were defined, and this scheme has been widely adopted within Indonesia to guide national surveillance and control strategies. Nevertheless, little detailed research into the robustness of this classification system has been conducted, particularly as it relates to independent, small to medium-sized commercial poultry farms (Sector 3). Through an analysis of questionnaire data collected as part of a survey of layer farms in western and central Java, all of which were classified as Sector 3 by local veterinarians, we provide benchmark data on what defines this sector. A multivariate analysis of the dataset, using hierarchical cluster analysis, identified three groupings of the farms, which were defined by a combination of production-and biosecurity-related variables, particularly those related to farm size and (the lack of) washing and disinfection practices. Nevertheless, the relationship between production-related variables and positive biosecurity practices was poor, and larger farms did not have an overall higher total biosecurity score than small or medium-sized ones. Further research is required to define the properties of poultry farms in Indonesia that are most closely related to effective biosecurity and the prevention of H5N1-HPAI.


Asunto(s)
Subtipo H5N1 del Virus de la Influenza A/aislamiento & purificación , Gripe Aviar/epidemiología , Enfermedades de las Aves de Corral/epidemiología , Crianza de Animales Domésticos , Animales , Pollos/crecimiento & desarrollo , Pollos/virología , Brotes de Enfermedades , Granjas , Indonesia/epidemiología , Subtipo H5N1 del Virus de la Influenza A/genética , Subtipo H5N1 del Virus de la Influenza A/fisiología , Gripe Aviar/transmisión , Gripe Aviar/virología , Aves de Corral , Enfermedades de las Aves de Corral/transmisión , Enfermedades de las Aves de Corral/virología
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA
...