RESUMEN
OBJECTIVE: Compare clinical outcomes between advanced practice clinician-based comanagement and usual orthopedic care. BACKGROUND: Comanagement of orthopedic surgery patients by internal medicine hospitalists is associated with improvements in clinical outcomes including complications, length of stay, and cost. Clinical outcomes of orthopedic comanagement performed solely by internal medicine advanced practice clinicians have not been reported. METHODS: Retrospective cohort study in patients 18 years or older, hospitalized for orthopedic joint or spine surgery between May 1, 2014, and January 1, 2022. Outcomes assessed were length of stay, ICU transfer, return to operating room, inhospital and 30-day mortality, 30-day readmission, and total direct cost excluding surgical implants. Generalized boosted regression and propensity score weighting was used to compare clinical outcomes and healthcare cost between usual care and advanced practice clinician comanagement. RESULTS: Advanced practice clinician comanagement was associated with a 5% reduction in mean length of stay (RR=0.95, p=0.009), decreased odds of returning to the operating room (OR= 0.51, p=0.002), and a significant reduction in 30-day mortality (OR= 0.32, p=0.037) compared to usual orthopedic care in a weighted analysis. Need for ICU transfer was higher with advanced practice clinician comanagement (OR= 1.54, p=0.009), without significant differences in 30-day readmission or inhospital mortality. CONCLUSIONS: We observed reductions in length of stay, healthcare costs, return to the operating room, and 30-day mortality with advanced practice clinician comanagement compared to usual orthopedic care. Our findings suggest advanced practice clinician-based comanagement may represent a safe and cost-effective model for orthopedic comanagement.
RESUMEN
[This corrects the article DOI: 10.1371/journal.pone.0278550.].
RESUMEN
BACKGROUND: There is need for interventions that can assist with long-term maintenance of healthy body weight and be sustainably integrated into existing primary care teams. The goal of MAINTAIN PRIME (Promoting Real (World) IMplEmentation) is to evaluate whether a successful electronic health record (EHR)-based weight maintenance intervention can be adapted to a new clinical setting with primary care staff serving as coaches. METHODS: EHR tools include tracking tools, standardized surveys, and standardized "SmartPhrases" for coaching. Inclusion criteria were age 18-75 years, voluntary 5% weight loss in the past 2 years with prior BMI ≥ 25 kg/m2, and no bariatric procedures in past 2 years. Participants were randomized 1:1 to tailored online coaching with EHR tracking tools (coaching) or EHR tracking tools alone (tracking). RESULTS: We screened 405 individuals between September 2021 and April 2023; 269 participants enrolled (134 coaching; 135 tracking). The most common reason for not enrolling was ineligibility (55%). At baseline, participants were 50.3 (SD 15.02) years old, 66.4% female, and 84% White; 83.7% reported moderate physical activity. Average weight and BMI at baseline were 205.0 (SD 48.9) lbs. and 33.2 (6.8) kg/m2, respectively. Participants lost an average of 10.7% (SD 5.2) of their body weight before enrolling. We recruited 39 primary care coaches over the same period. Conclusion The study successfully identified and recruited primary care patients with recent intentional weight loss for participation in a weight maintenance program that uses EHR-based tools. We also successfully recruited and trained primary care staff as coaches.
Asunto(s)
Registros Electrónicos de Salud , Atención Primaria de Salud , Humanos , Atención Primaria de Salud/organización & administración , Femenino , Persona de Mediana Edad , Masculino , Registros Electrónicos de Salud/organización & administración , Adulto , Mantenimiento del Peso Corporal , Tutoría/métodos , Tutoría/organización & administración , Anciano , Índice de Masa Corporal , Pérdida de Peso , Adolescente , Programas de Reducción de Peso/métodos , Programas de Reducción de Peso/organización & administraciónRESUMEN
BACKGROUND: Medical hospitalizations are relatively common among individuals who have substance use disorders (SUDs) and represent opportunities for patient engagement and treatment. Posthospitalization transitions of care are an important element of providing full-spectrum inpatient SUD care; however, little is known about clinicians' experiences with postdischarge care transitions. METHODS: We conducted a cross-sectional study surveying hospital-based medical clinicians (ie, "hospitalists") across 2 large health systems in the state of Utah to assess current practices, barriers, facilitators, and perceptions toward posthospitalization care transitions for patients with SUDs. We used Wilcoxon signed-rank tests to identify the most impactful barriers and facilitators among all respondents. We used logistic regression models to explore the influence of hospitalists' attitudes toward providing SUD care on perceived barriers and facilitators. RESULTS: The survey was distributed to 429 individuals across 15 hospitals. Eighty-two hospitalists responded to the survey (response rate, 21.4%). Most respondents frequently cared for hospitalized patients with SUDs (n = 63, 77%) and prescribed medications for SUDs (n = 44, 56%). Four respondents (5%) felt that patients received adequate support during care transitions. Lack of social support (P < 0.001) and social factors such as lack of transportation (P < 0.001) were perceived as the largest barriers to successful care transitions. Conversely, a partnering outpatient clinic/clinician (P < 0.001) and outpatient-based care coordination (P < 0.001) were perceived as the strongest facilitators. Respondents' attitudes toward people with SUDs had a modest effect on perceived barriers and facilitators. CONCLUSIONS: Hospitalists perceived increased outpatient SUD treatment infrastructure and transitional care supports as most important in facilitating posthospitalization care transitions for patients with SUDs.
RESUMEN
It is a common understanding that the 2019 coronavirus pandemic (COVID-19) significantly harmed mental health. However, findings on changes in overall life satisfaction have been mixed and inconclusive. To address this puzzling phenomenon, we draw upon the domain-specific perspective of well-being and research on catastrophe compassion and propose that the pandemic can have opposing effects on mental health and communal satisfaction, which then differently relate to people's overall life satisfaction. Longitudinal analyses of the Household, Income and Labour Dynamics (HILDA) Survey of Australia (N = 12,093) showed that while there was a greater decrease in mental health in the first COVID-19 pandemic year (2019-2020) than in the previous years (2017-2019), an increase in communal satisfaction also occurred, demonstrating a potential silver lining effect of the pandemic on people's satisfaction with family, community, and neighborhood. Moreover, consistent with socioemotional selectivity theory, changes in mental health, communal satisfaction, and life satisfaction were related to age, such that older adults generally reported less harmful and more beneficial psychological changes. We further found that age was associated with stronger associations of mental health and communal satisfaction with life satisfaction during the pandemic year. Overall, our findings speak to the importance of communal life in life satisfaction during the pandemic and age-related differences in the process, shedding light on the need to devise customized support to address inequalities in pandemic effects on public well-being. (PsycInfo Database Record (c) 2024 APA, all rights reserved).
Asunto(s)
COVID-19 , Humanos , Anciano , Pandemias , Emociones , Satisfacción Personal , Australia/epidemiologíaAsunto(s)
Dermatología , Humanos , Utah , Wyoming , Estudios Retrospectivos , Accesibilidad a los Servicios de SaludRESUMEN
Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67â³ N; 108°40'43.24â³ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 µm, stylet lengths = 15.1 ± 0.9 µm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 µm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 µm, stylet lengths = 14.7 ± 0.5 µm, DGO = 3.5 ± 0.4 µm, tail lengths averaged = 43.6 ± 9.7 µm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ËC. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.
RESUMEN
INTRODUCTION: Few pediatric urologists believe patients require a majority of the doses of opioids prescribed to them postoperatively. Seeking a better understanding of postoperative pain and analgesia in pediatric urology patients may help reduce opioid over prescription while still adequately managing postoperative pain. OBJECTIVE: We sought to better understand: 1) the postoperative pain levels experienced by pediatric urology patients, 2) the factors that correlate with postoperative pain and number of opioids consumed following pediatric urologic procedures, and 3) the patients who do not require opioids after surgery. STUDY DESIGN: Pediatric patients undergoing circumcision, inguinal hernia repair, orchidopexy, or hypospadias repair were eligible to participate. Patients were enrolled in the prospective cohort on the day of the procedure. For each of the first 7 postoperative days, patients' parents completed a text message-based questionnaire, quantifying their child's pain level and the doses of pain medication the child consumed. RESULTS: 165 participants were enrolled. 57 patients underwent circumcision, 54 underwent orchiopexy, 32 underwent hypospadias repair, and 22 underwent inguinal hernia repair. For all procedure types, pain scores (p < 0.01) and doses of oxycodone consumed were highest on postoperative day one and steadily declined thereafter. Overall, average 7-day pain score (2.02; 0.86-5.14) and doses of narcotics consumed (3.50; 0-5) were low. Patients in each surgical subgroup were prescribed narcotics in excess of what was consumed. There was an average excess of 10.9 doses (0-39.0) for hypospadias repair, 8.6 (1.0-30.0) for circumcision, 9.0 (3.0-21.0) for inguinal hernia repair, and 6.1 (0-22.0) for orchiopexy. DISCUSSION: Overall, reported pain scores and number of narcotics consumed were low regardless of surgery type. Opioids were overprescribed regardless of surgery type. CONCLUSIONS: Our findings indicate that level of pain and opioid use varies by procedure type, but that number of narcotics prescribed greatly exceeds number needed.
Asunto(s)
Hernia Inguinal , Hipospadias , Urología , Masculino , Humanos , Niño , Analgésicos Opioides/uso terapéutico , Estudios Prospectivos , Narcóticos/uso terapéutico , Hernia Inguinal/cirugía , Hipospadias/tratamiento farmacológico , Dolor Postoperatorio/tratamiento farmacológico , Hábitos , Pautas de la Práctica en MedicinaRESUMEN
BACKGROUND: Filter clotting is a major issue in continuous kidney replacement therapy (CKRT) that interrupts treatment, reduces delivered effluent dose, and increases cost of care. While a number of variables are involved in filter life, treatment modality is an understudied factor. We hypothesized that filters in pre-filter continuous venovenous hemofiltration (CVVH) would have shorter lifespans than in continuous venovenous hemodialysis (CVVHD). METHODS: This was a single center, pragmatic, unblinded, quasi-randomized cluster trial conducted in critically ill adult patients with severe acute kidney injury (AKI) at the University of Iowa Hospitals and Clinics (UIHC) between March 2020 and December 2020. Patients were quasi-randomized by time block to receive pre-filter CVVH (convection) or CVVHD (diffusion). The primary outcome was filter life, and secondary outcomes were number of filters used, number of filters reaching 72 hours, and in-hospital mortality. RESULTS: In the intention-to-treat analysis, filter life in pre-filter CVVH was 79% of that observed in CVVHD (mean ratio 0.79, 95% CI 0.65-0.97, p = 0.02). Median filter life (with interquartile range) in pre-filter CVVH was 21.8 (11.4-45.3) and was 26.6 (13.0-63.5) for CVVHD. In addition, 11.8% of filters in pre-filter CVVH were active for >72 hours, versus 21.2% in the CVVHD group. Finally, filter clotting accounted for the loss of 26.7% of filters in the CVVH group compared to 17.5% in the CVVHD group. There were no differences in overall numbers of filters used or mortality between groups. CONCLUSIONS: Among critically patients with severe AKI requiring CKRT, use of pre-filter CVVH resulted in significantly shorter filter life compared to CVVHD. TRIAL REGISTRATION: ClinicalTrials.gov, NCT04762524. Registered 02/21/21-Retroactively registered, https://clinicaltrials.gov/ct2/show/NCT04762524?cond=The+Impact+of+CRRT+Modality+on+Filter+Life&draw=2&rank=1.
Asunto(s)
Lesión Renal Aguda , Terapia de Reemplazo Renal Continuo , Hemodiafiltración , Hemofiltración , Adulto , Humanos , Hemofiltración/métodos , Hemodiafiltración/métodos , Diálisis Renal , Lesión Renal Aguda/terapiaRESUMEN
OBJECTIVE: To assess association of pharmacist gender with acceptance of antibiotic stewardship recommendations. DESIGN: A retrospective evaluation of the Reducing Overuse of Antibiotics at Discharge (ROAD) Home intervention. SETTING: The study was conducted from May to October 2019 in a single academic medical center. PARTICIPANTS: The study included patients receiving antibiotics on a hospitalist service who were nearing discharge. METHODS: During the intervention, clinical pharmacists (none who had specialist postgraduate infectious disease residency training) reviewed patients on antibiotics and led an antibiotic timeout (ie, structured conversation) prior to discharge to improve discharge antibiotic prescribing. We assessed the association of pharmacist gender with acceptance of timeout recommendations by hospitalists using logistic regression controlling for patient characteristics. RESULTS: Over 6 months, pharmacists conducted 295 timeouts: 158 timeouts (53.6%) were conducted by 12 women, 137 (46.4%) were conducted by 8 men. Pharmacists recommended an antibiotic change in 82 timeouts (27.8%), of which 51 (62.2%) were accepted. Compared to male pharmacists, female pharmacists were less likely to recommend a discharge antibiotic change: 30 (19.0%) of 158 versus 52 (38.0%) of 137 (P < .001). Female pharmacists were also less likely to have a recommendation accepted: 10 (33.3%) of 30 versus 41 (8.8%) of 52 (P < .001). Thus, timeouts conducted by female versus male pharmacists were less likely to result in an antibiotic change: 10 (6.3%) of 158 versus 41 (29.9%) of 137 (P < .001). After adjustments, pharmacist gender remained significantly associated with whether recommended changes were accepted (adjusted odds ratio [aOR], 0.10; 95%confidence interval [CI], 0.03-0.36 for female versus male pharmacists). CONCLUSIONS: Antibiotic stewardship recommendations made by female clinical pharmacists were less likely to be accepted by hospitalists. Gender bias may play a role in the acceptance of clinical pharmacist recommendations, which could affect patient care and outcomes.
Asunto(s)
Programas de Optimización del Uso de los Antimicrobianos , Médicos Hospitalarios , Humanos , Masculino , Femenino , Farmacéuticos , Antibacterianos/uso terapéutico , Alta del Paciente , Estudios Retrospectivos , SexismoRESUMEN
BACKGROUND: The use of cognitive-enhancing medications and supplements among healthy adults continues to rise. Limited data exists on their use among resident physicians. Given their highly competitive and stressful lifestyle, we sought to evaluate the prevalence, motivations, and side effects of using cognitive-enhancing supplements and medications among resident physicians at a large United States academic institution. METHODS: An anonymous web-based survey was circulated to resident physicians inquiring about using cognitive-enhancing supplements and medications, as well as personal characteristics such as gender, marital and parental status, medical diagnoses, and medical specialty. Before circulation, we performed a pilot study. Weighted logistic regression analyses estimated the impact of personal characteristics on the probability of using both supplements and medications. RESULTS: Survey response rate was 46.4%. Of respondents, 48.6% were female, 45.9% were married, 70.9% were without children, and 67.2% were in a non-surgical medical specialty. Few respondents had a related medical diagnosis, with attention deficit hyperactivity disorder being the most common (7.1%). Male, non-married, surgical residents were more likely to take supplements (odds ratio (OR) = 1.06, 1.05, and 1.05). Males, without children, and those who felt pressure to perform well, were afraid of being left behind, felt pressure because colleagues take them, or felt they could not reach their current level of training without medications were more likely to take medications (OR = 1.11, 1.04, 1.05, and 1.08). Adverse effects with medications were common. CONCLUSION: Supplement and medication use for cognitive enhancement was high among resident physicians at a single institution despite few having a related medical diagnosis. This study raises awareness of the growing pressure in competitive residency environments to use cognitive enhancement regardless of the potential side effects.
Asunto(s)
Internado y Residencia , Médicos , Adulto , Niño , Masculino , Estados Unidos , Humanos , Femenino , Proyectos Piloto , Encuestas y Cuestionarios , Médicos/psicología , CogniciónRESUMEN
Background: Aneurysm wall enhancement has been identified as a potential biomarker for aneurysm instability. Enhancement has been determined by different approaches on 2D multiplanar views. This study describes a new method to quantify enhancement through 3D heatmaps and histograms. Methods: A custom algorithm was developed using orthogonal probes extending from the aneurysm lumen into the wall to create 3D heatmaps and histograms of wall enhancement on 7T-MRI. Three quantitative metrics for general, specific, and focal wall enhancement were generated from the histograms. Results: Thirty-two aneurysms were analyzed and classified based on 3D heatmaps and histograms. Larger aneurysms were more enhancing (Spearman's r=0.472, p=0.006), and had more heterogeneous enhancement (Spearman's r=0.557, p<0.001) than smaller aneurysms. Patterns of enhancement differed between saccular, fusiform, and thrombosed aneurysms. Fusiform aneurysms were larger (p=0.015) and had more heterogenous enhancement compared to saccular aneurysms. Fusiform aneurysms had more areas of focal enhancement (p<0.001) and right skewed histograms (p=0.003). Conclusions: The 3D analysis of aneurysm wall enhancement provides topographic data of the entire aneurysm wall. New metrics developed based on this method showed that large and fusiform aneurysms have heterogenous enhancement.
RESUMEN
Xanthine oxidase (XO) contributes to oxidative stress and vascular disease. Hyperuricemia and gout are common in patients with chronic kidney disease (CKD), a population at increased risk of vascular disease. We evaluated effects of allopurinol on serum XO activity and metabolome of CKD patients who had participated in a randomized double-blind clinical trial of allopurinol vs. placebo. XO activity was measured in participants' serum. XO expression in venous endothelial cells was evaluated via immunofluorescence. Gas chromatography mass spectrometry (GC/MS) was utilized for metabolomics analysis. We found that in patients with stage 3 CKD and hyperuricemia, allopurinol lowered serum urate while increasing serum xanthine levels. Allopurinol, however, did not significantly suppress measured serum XO activity. Of note, baseline serum XO activity was low. Additionally, neither baseline serum XO activity nor XO protein expression were associated with measures of vascular dysfunction or with systemic or endothelial biomarkers of oxidative stress. Allopurinol affected several pathways, including pentose phosphate, pyrimidine, and tyrosine metabolism. Our findings suggest that circulating XO does not contribute to vascular disease in CKD patients. In addition to inhibition of XO activity, allopurinol was observed to impact other pathways; the implications of which require further study.
RESUMEN
OBJECTIVE: The aim of this study was to examine the relationship between maternal obesity and fetal umbilical arterial pH in a cohort of parturients that received a prophylactic phenylephrine infusion for management of spinal anesthesia induced hypotension during cesarean delivery. METHODS: This was a retrospective cohort study of cesarean deliveries at a single academic tertiary care institution between January 2012 and March 2019. All scheduled nonlaboring cesarean deliveries of singleton live neonate performed under spinal anesthesia between 37 and 41 weeks gestational age were included. The primary outcome was umbilical arterial pH. Multiple regression models were used to test the relationship between umbilical arterial pH, and maternal body mass index (BMI), race, dose of phenylephrine, baseline systolic blood pressure, maximum decrease in systolic blood pressure, induction of anesthesia to delivery time and uterine incision to delivery time. RESULTS: Seven hundred and sixty-one mother neonate pairs were included in the study. The univariate analysis showed a decrease in mean umbilical arterial pH with increasing maternal BMI (p = <.01). A multivariate regression model indicated that maximum decrease in systolic blood pressure, induction of anesthesia to delivery time, and uterine incision to delivery time accounted for 11% of the variance in the outcome, R2 = 0.11. BMI was not a significant predictor of low umbilical arterial pH (p = .36). The significant predictors of low umbilical arterial pH in the model were maximum decrease in systolic blood pressure (p < .001), induction of anesthesia to delivery time (p = .04), and uterine incision to delivery time (p < .001). CONCLUSIONS: Maternal BMI is not associated with lower umbilical arterial pH in women having scheduled cesarean delivery under spinal anesthesia. Severity of spinal anesthesia induced hypotension is greater with increasing BMI and may be responsible for the observed decrease in umbilical arterial pH.
Asunto(s)
Anestesia Obstétrica , Anestesia Raquidea , Hipotensión , Obesidad Materna , Anestesia Obstétrica/efectos adversos , Anestesia Raquidea/efectos adversos , Femenino , Humanos , Concentración de Iones de Hidrógeno , Recién Nacido , Fenilefrina , Embarazo , Estudios Retrospectivos , VasoconstrictoresAsunto(s)
Acné Vulgar , Dispositivos Intrauterinos , Alopecia , Andrógenos , Femenino , Hirsutismo , Humanos , Estudios Retrospectivos , PielRESUMEN
PURPOSE: Emergency department (ED) crowding is increasing and is associated with adverse patient outcomes. The objective of this study was to measure the relative impact of ED boarding on timeliness of early ED care for new patient arrivals, with a focus on the differential impact in low-volume rural hospitals. METHODS: A retrospective cohort of all patients presenting to a Veterans Health Administration (VHA) ED between 2011 and 2014. The primary exposure was the number of patients in the ED at the time of ED registration, stratified by disposition (admit, discharge, or transfer) and mental health diagnosis. The primary outcome was time-to-provider evaluation, and secondary outcomes included time-to-EKG, time-to-laboratory testing, time-to-radiography, and total ED length-of-stay. Rurality was measured using the Rural-Urban Commuting Areas. FINDINGS: A total of 5,912,368 patients were included from all 123 VHA EDs. Adjusting for acuity, new patients had longer time-to-provider when more patients were in the ED, and patients awaiting transfer for nonmental health conditions impacted time-to-provider for new patients (16.6 min delays, 95% CI: 12.3-20.7 min) more than other patient types. Rural patients saw a greater impact of crowding on care timeliness than nonrural patients (additional 5.3 min in time-to-provider per additional patient in ED, 95% CI: 4.3-6.4), and the impact of additional patients in all categories was most pronounced in the lowest-volume EDs. CONCLUSIONS: Patients seen in EDs with more crowding have small, but additive, delays in early elements of ED care, and transferring patients with nonmental health diagnoses from rural facilities were associated with the greatest impact.
Asunto(s)
Aglomeración , Servicio de Urgencia en Hospital , Estudios de Cohortes , Humanos , Tiempo de Internación , Estudios RetrospectivosRESUMEN
Contrast sensitivity is reduced in older adults and is often measured at an overall perceptual level. Recent human psychophysical studies have provided paradigms to measure contrast sensitivity independently in the magnocellular (MC) and parvocellular (PC) visual pathways and have reported desensitization in the MC pathway after flicker adaptation. The current study investigates the influence of aging on contrast sensitivity and on the desensitization effect in the two visual pathways. The steady- and pulsed-pedestal paradigms were used to measure contrast sensitivity under two adaptation conditions in 45 observers. In the non-flicker adaptation condition, observers adapted to a pedestal array of four 1°×1° squares presented with a steady luminance; in the flicker adaptation condition, observers adapted to a square-wave modulated luminance flicker of 7.5 Hz and 50% contrast. Results showed significant age-related contrast sensitivity reductions in the MC and PC pathways, with a significantly larger decrease of contrast sensitivity for individuals older than 50 years of age in the MC pathway but not in the PC pathway. These results are consistent with the hypothesis that sensitivity reduction observed at the overall perceptual level likely comes from both the MC and PC visual pathways, with a more dramatic reduction resulting from the MC pathway for adults >50 years of age. In addition, a similar desensitization effect from flicker adaptation was observed in the MC pathway for all ages, which suggests that aging may not affect the process of visual adaptation to rapid luminance flicker.