Meridian study on the response current affected by acupuncture needling direction.

Acupuncture manipulation with needling direction is important for the therapeutic effect based on traditional Chinese medicine theory. However, there is controversy over directional manipulation and therapeutic effect, despite some research showing that acupuncture manipulations may have something to do with therapeutic effect. Moreover, research usually focuses on the therapeutic effects on the acupoints and acupuncture time rather than exploring the manipulation method. This study applies a semiconductor analyzer to investigate the effects of acupuncture manipulation. 10 healthy participants were recruited for the study. We used a cross-over design to compare the effect of different manipulation on individuals. This study employed an Agilent B1500A semiconductor analyzer to investigate the electric characteristics of meridians under directional supplementation and draining manipulation. We measured the electric current of meridians under different manipulation, and compared the difference between supplementation and draining manipulation in healthy individuals. The electric current was significantly larger in supplementation manipulation compared to draining manipulation in the meridians (P < .001). The measured electric current in the same manipulation methods did not show a statistical difference between meridians (P = .094). The different directional manipulation result in different electric currents in humans. Our finding implies that the supplementation and draining manipulation may result in different therapeutic effects clinically as the description of traditional Chinese medicine theory. Therefore, directional manipulation may need to be taken into consideration in future acupuncture studies and clinical management.

Analysis of Meridian Flow Direction by Electrical Stimulation Method.

Meridians constitute the theoretical foundation of acupuncture in traditional Chinese medicine (TCM), and they have been described for 2000 years. Classical TCM advocates for the directionality of meridians. Finding an accurate method to verify this directionality is an important goal of TCM doctors and researchers. In this study, we objectively explored the physical properties of meridians, such as response current from electrical stimulation, to explore their directionality. The Agilent B1500A semiconductor measurement analyzer was utilized to input the alternating current waveforms and detect the response current on the meridians. The results showed that the direction of the meridians influences the intensity of the response current. Therefore, the mechanisms behind the directions of ion transportation and the meridians were investigated using the response time and the intensity of the response current. Thereafter, we propose a model to explain this mechanism. Afterward, a comparison between the direction of the meridian in this experiment and ancient Chinese medicine classics was performed.

G-quadruplex formation by single-base mutation or deletion of mitochondrial DNA sequences.

BACKGROUND: Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro. METHODS: The combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants. RESULTS: This study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20 mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA. CONCLUSIONS: Single-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro. GENERAL SIGNIFICANCE: We illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation.

An expert fitness diagnosis system based on elastic cloud computing.

This paper presents an expert diagnosis system based on cloud computing. It classifies a user's fitness level based on supervised machine learning techniques. This system is able to learn and make customized diagnoses according to the user's physiological data, such as age, gender, and body mass index (BMI). In addition, an elastic algorithm based on Poisson distribution is presented to allocate computation resources dynamically. It predicts the required resources in the future according to the exponential moving average of past observations. The experimental results show that Naïve Bayes is the best classifier with the highest accuracy (90.8%) and that the elastic algorithm is able to capture tightly the trend of requests generated from the Internet and thus assign corresponding computation resources to ensure the quality of service.

Nanonized black soybean enhances immune response in senescence-accelerated mice.

Soy isoflavones may have applications in cancer prevention and anti-inflammation, therefore this study was conducted to investigate the effect of dietary supplementation with black soybean on the immune response in the senescence-accelerated-prone mice (SAMP8) and -resistant mice (SAMPR1, as controls). The mechanism of isoflavones was also investigated. Six-month-old male SAMP8 and SAMR1 mice were divided into the control groups and experimental groups supplemented with nanonized (Nano-soy) or microparticled (Micro-soy) black soybeans (n = 8/group), respectively for 12 weeks. Human peripheral blood mononuclear cells (PBMC) and murine splenocytes were stimulated with mitogens and cytokines were determined by reverse transcriptase-polymerase chain reaction and/or ELISA. The results showed that body weight, food intake, and relative weights of organs did not differ among the SAMP8 control and experimental groups. Isoflavone (daidzin and genistin) intake was higher in the Nano-soy group than the Micro-soy group. The lymphoproliferation and production of interleukin-2 (IL-2) and interferon-gamma (IFN-gamma) in the Nano-soy group had a significantly higher (P < 0.05) than those in the control and Micro-soy groups. The Nano-soy supplemented mice reached these cytokine levels similar to SAMR1 mice. This result was consistent with the in vitro data that daidzein (a metabolite of daidzin), at a concentration of 10 muM, increased IL-2, IL-4, and IFN-gamma production from phytohemagglutinin-stimulated PBMC (P < 0.05). However at higher concentrations (> 50 microM), daidzein only reduced IL-10 and IFN-gamma levels, whereas genistein reduced levels of the IL-2, IL-4, IL-10, IFN-gamma mRNA and protein and these results suggest that the Nano-soy supplementation improved immune response in SAMP8 mice which may be attributable to higher daidzin content in the black soybean preparation.

Augmentation of regulatory T cells in allergic individuals by recombinant Der f 2 peptide with fungal immunomodulatory peptide fve.

BACKGROUND: The suppressive function of regulatory T (Treg) cells is compromised in allergic individuals, and the augmentation of Treg cells has been demonstrated after successful allergen immunotherapy. OBJECTIVE: To evaluate the effect of Dermatophagoides farinae fragments (Der f 2 N-peptides) that do not bind specific IgE in conjunction with the fungal immunomodulatory peptide fve (FIP-fve) on Treg cells derived from individuals with allergic rhinitis. METHODS: CD4+CD25+ T cells were isolated from peripheral blood mononuclear cells of 11 patients with allergic rhinitis and 7 nonallergic individuals using immunomagnetic beads. Cells were cultured with medium, Der f 2, FIP-fve, FIP-fve plus Der f 2, and FIP-fve plus Der f 2 N-peptides for 6 days in the presence of antigen-presenting cells. The percentages and function of Foxp3+CD4+CD25+ Treg cells, interleukin (IL) 10+, and transforming growth factor beta (TGF-beta)+ Treg cells were measured. RESULTS: The percentage of Foxp3+ Treg cells in CD4+CD25+ T cells was significantly increased in D farinae allergic patients by Der f 2 N-peptides in conjunction with FIP-fve. Both IL-10+ and TGF-beta+ Treg cells were significantly increased in the presence of Der f 2 N-peptides and FIP-fve compared with other groups. The function of Treg cells induced by Der f 2 N-peptides and FIP-fve could be demonstrated by the inhibition of bromodeoxyuridine uptake by peripheral blood mononuclear cells. CONCLUSION: The percentage of IL-10+ and TGF-beta+ cells in Foxp3+CD4+CD25+ T cells can be up-regulated by Der f 2 N-peptides in conjunction with FIP-fve only in D farinae allergic individuals. These results indicate that non-IgE-mediated fragments of allergen in conjunction with FIP-fve might have therapeutic effects on Treg cells derived from allergic individuals.

Bromelain inhibits lipopolysaccharide-induced cytokine production in human THP-1 monocytes via the removal of CD14.

Bromelain has been reported to have anti-inflammatory and immunomodulatory effects. However, the anti-inflammatory mechanism of bromelain is unclear. Therefore, we investigated the effect of bromelain on cytokine production from lipopolysaccharide (LPS)-stimulated human peripheral blood mononuclear cells (PBMC) and monocytic leukemia THP-1 cells. The result showed that bromelain (50-100 microg/ml) significantly and reversibly reduced tumor necrosis factor (TNF)-alpha interleukin- (IL)-1beta and IL-6 from LPS-induced PBMC and THP-1 cells. This effect was correlated with reduced LPS-induced TNF-alpha mRNA and NF-kappaB activity in THP-1 cells. In addition, bromelain dose-dependently inhibited LPS-induced prostaglandin E(2), thromboxane B(2) and COX-2 mRNA but not COX-1 mRNA. Importantly, bromelain degraded TNF-alpha and IL-1beta molecules, reduced the expression of surface marker CD14 but not Toll-like receptor 4 from THP-1 cells. Taken together, the results suggest that the suppression of signaling pathways by bromelain's proteolytic activity may contribute to the anti-inflammatory activity of bromelain.

Oxidative toxicity in BV-2 microglia cells: sesamolin neuroprotection of H2O2 injury involving activation of p38 mitogen-activated protein kinase.

Reactive oxygen species (ROS) has been proposed to play a pathogenic role in neuronal injury. Sesame antioxidants that inhibit lipid peroxidation and regulate cytokine production may suppress ROS generation. In this study, we focused on the effect of sesamolin on H2O2-induced neurotoxicity and ROS production in the murine microglial cell line BV-2. Results indicate that the H2O2 elicited BV-2 cell death in a concentration- and time-dependent manner. ROS generation in BV-2 cells was time-dependently increased by the H2O2 treatment. Sesamolin reduced ROS generation in BV-2 cells. p38 mitogen-activated protein kinase (MAPK) and caspase-3 were also activated in BV-2 cells under H2O2 stress. Sesamolin was able to inhibit H2O2-induced p38 MAPK and caspase-3 activation and cell death. In addition, sesamolin preserved superoxide dismutase and catalase activities in BV-2 cells under H2O2 stress. In conclusion, sesamolin protects microglia against H2O2-induced cell injury and this protective effect was accompanied by its inhibition of p38 MAPK and caspase-3 activation and ROS production.

Protective effects of sesamin and sesamolin on murine BV-2 microglia cell line under hypoxia.

Sesamin and sesamolin were tested for their ability to protect BV-2 microglia from hypoxia-induced cell death. These antioxidants dose-dependently reduced hypoxia-induced lactate dehydrogenase (LDH) release and dichlorofluorescein (DCF)-sensitive reactive oxygen species (ROS) production. Their effects on signaling pathway mitogen-activated protein kinases (MAPKs) and caspase-3 in hypoxia-induced cell death were further examined. Extracellular signal-regulated protein kinases (ERK1/2), c-jun NH(2)-terminal kinase (JNK), and p38 MAPKs were activated during hypoxia. The sesamin or sesamolin reduced caspase-3 and MAPK activation correlated well with diminished LDH release in BV-2 cells under hypoxia. Furthermore, they preserved superoxide dismutase (SOD) and catalase activities in BV-2 cells under hypoxia. Taken together, these results indicate that the mechanism of sesame antioxidants involves inhibition of MAPK pathways and apoptosis through scavenging of ROS in hypoxia-stressed BV-2 cells.