T-distributed Stochastic Neighbor Network for unsupervised representation learning.

Unsupervised representation learning (URL) is still lack of a reasonable operator (e.g. convolution kernel) for exploring meaningful structural information from generic data including vector, image and tabular data. In this paper, we propose a simple end-to-end T-distributed Stochastic Neighbor Network (TsNet) for URL with clustering downstream task. Concretely, our TsNet model has three major components: (1) an adaptive connectivity distribution learning module is presented to construct a pairwise graph for preserving the local structure of generic data; (2) a T-distributed stochastic neighbor embedding based loss function is designed to learn a transformation between embeddings and original data, which improves the discrimination of representations; (3) a nonlinear parametric mapping is learned via our TsNet on an unsupervised generalized manner, which can address the "out-of-sample" issue. By combining these components, our method is able to considerably outperform previous related unsupervised learning approaches on visualization and clustering of generic data. A simple deep neural network equipped on our model respectively achieves 74.90%, 76.56% ACC and NMI, which is 8% relative improvement over previous state-of-the-art on real single-cell RNA-sequencing (scRNA-seq) datasets clustering.

The Epidemic Characteristics of Stroke Death from 2012 to 2021 in Chongqing, China.

INTRODUCTION: Stroke has become a major disease that threatens the global population's health and is a major public health problem that needs to be solved in China. Therefore, it is essential to analyze the trend of the mortality of stroke and its epidemic characteristic of stroke death. METHODS: Death cases of stroke were reported to the national death registry system by the medical staff of all medical institutions, and the population data every year were obtained from District or County's Statistic Bureau in Chongqing. They were analyzed to calculate the mortality, age-standardized mortality rate by Chinese standardization population (ASMRC), age-specific mortality, proportion, and annual percent of change (APC) according to the ICD-10 code. ASMRC was based on the standard population of the 6th census in China, 2010. The stroke mortality of each subgroup was compared using the χ2 test. Trend analysis was presented by APC. RESULTS: The crude mortality of stroke increased from 96.29 per 100,000 in 2012 to 115.93 per 100,000 significantly, with the APC of 2.02% (t = 2.82, p = 0.022) in Chongqing. ASMRC of stroke was 56.47 per 100,000 in 2012 and 54.70 per 100,000 in 2021, and its trend change was stable (APC = -0.01, t = 0.07, p = 0.947). The crude mortality of stroke in males was higher than that in females every year (p < 0.05). The death proportion of intracerebral hemorrhage dwindled from 60.53% in 2012 to 49.88% in 2021, whereas the death proportion of ischemic stroke increased from 20.92% in 2012 to 39.96% in 2021. The average age of stroke death was delayed from 73.43 years old in 2012 to 76.52 years old in 2021 significantly (t = 18.12, p < 0.001). The percentage of stroke death at home increased from 75.23% in 2012 to 79.23% in 2021, while the percentage of stroke death at hospitals decreased from 17.89% in 2012 to 15.89% in 2021. CONCLUSION: The crude mortality of stroke surged, and intracerebral hemorrhage was the main death cause of all subtypes. The mortality of stroke in males and rural residents was higher than that in females and urban residents. Most stroke deaths occurred at home. Male and rural residents were crucial populations for stroke prevention and control. There should be improved medical resources in rural areas and enhanced capability of stroke diagnosis and treatment.

Novel algorithm for diagnosis of Arrhythmogenic cardiomyopathy and dilated cardiomyopathy: Key gene expression profiling using machine learning.

BACKGROUND: It is difficult to distinguish between arrhythmogenic cardiomyopathy (ACM) and dilated cardiomyopathy (DCM) because of their similar clinical manifestations. This study aimed to develop a novel diagnostic algorithm for distinguishing ACM from DCM. METHODS: Two public datasets containing human ACM and DCM myocardial samples were used. Consensus clustering, non-negative matrix factorization and principal component analysis were applied. Weighted gene co-expression network analysis and machine learning methods, including random forest and the least absolute shrinkage and selection operator, were used to identify candidate genes. Receiver operating characteristic curves and nomograms were performed to estimate diagnostic efficacy, and Spearman's correlation analysis was used to assess the correlation between candidate genes and cardiac function indices. RESULTS: Both ACM and DCM showed highly similar gene expression patterns in the clustering analyses. Hub gene modules associated with cardiomyopathy were obtained using weighted gene co-expression network analysis. Thirteen candidate genes were selected using machine learning algorithms, and their combination showed a high diagnostic value (area under the ROC curve = 0.86) for distinguishing ACM from DCM. In addition, TATA-box binding protein associated factor 15 showed a negative correlation with cardiac index (R = -0.54, p = 0.0054) and left ventricular ejection fraction (R = -0.48, p = 0.0015). CONCLUSIONS: Our study revealed an effective diagnostic model with key gene signatures, which indicates a potential tool to differentiate between ACM and DCM in clinical practice. In addition, we identified several genes that are highly related to cardiac function, which may contribute to our understanding of ACM and DCM.

Impaired heart rate variability in patients with arrhythmogenic cardiomyopathy: A multicenter retrospective study in China.

Background: Cardiac sympathetic nerve system (SNS) might play an important role in arrhythmogenesis of arrhythmogenic cardiomyopathy (ACM). This study aims to assess the activity of cardiac SNS in ACM patients by heart rate variability (HRV), and to investigate its predictive value for sustained ventricular tachycardia (sVT). Methods: A total of 88 ACM patients and 65 sex- and age- matched healthy participants were enrolled. The time domain measures were used to evaluate the activity of cardiac SNS. An independent cohort with 48 ACM patients was as the validation cohort. Results: ACM patients had lower levels of standard deviation of all NN intervals (SDNN) [118.0 (90.3, 136.8) vs. 152.0 (132.5, 174.5) ms, p < 0.001] compared with healthy participants. Further analysis showed ACM patients with sVT had lower levels of SDNN than those without sVT (105.0 ± 28.1 vs. 131.8 ± 33.1 ms, p < 0.001). Multivariate logistic regression analysis showed SDNN was independently associated with sVT in ACM patients [odds ratio (OR) 0.59, 95% confidence interval (CI) (0.45-0.78), p < 0.001]. Receiver operating characteristics curve demonstrated SDNN had clinical values in predicting sVT in ACM patients [area under the curve (AUC) = 0.73, 95% CI (0.63-0.84), p < 0.001], which was verified in the validation cohort. Conclusion: The present study suggests that HRV is impaired in patients with ACM, and the SDNN level has a moderate value in risk stratification for sVT in ACM patients. In addition, the finding might provide new target for the further management of ACM with integrated traditional Chinese and western medicine.

Better Bioactivity, Cerebral Metabolism and Pharmacokinetics of Natural Medicine and Its Advanced Version.

Currently, many people are afflicted by cerebral diseases that cause dysfunction in the brain and perturb normal daily life of people. Cerebral diseases are greatly affected by cerebral metabolism, including the anabolism and catabolism of neurotransmitters, hormones, neurotrophic molecules and other brain-specific chemicals. Natural medicines (NMs) have the advantages of low cost and low toxicity. NMs are potential treatments for cerebral diseases due to their ability to regulate cerebral metabolism. However, most NMs have low bioavailability due to their low solubility/permeability. The study is to summarize the better bioactivity, cerebral metabolism and pharmacokinetics of NMs and its advanced version. This study sums up research articles on the NMs to treat brain diseases. NMs affect cerebral metabolism and the related mechanisms are revealed. Nanotechnologies are applied to deliver NMs. Appropriate delivery systems (exosomes, nanoparticles, liposomes, lipid polymer hybrid nanoparticles, nanoemulsions, protein conjugation and nanosuspensions, etc.) provide better pharmacological and pharmacokinetic characteristics of NMs. The structure-based metabolic reactions and enzyme-modulated catalytic reactions related to advanced versions of NMs alter the pharmacological activities of NMs.

Mulberry (Morus alba) is a new natural host of Citrus leaf blotch virus in China.

Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches' broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses_NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4-90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5' and 3' termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV.

Molecular characterization of a novel cytorhabdovirus associated with paper mulberry mosaic disease.

A novel cytorhabdovirus, tentatively named "paper mulberry mosaic-associated virus" (PMuMaV), was discovered and identified by transcriptome sequencing (RNA-seq), small RNA sequencing (sRNA-seq), and RT-PCR amplification. The whole-genome sequence of PMuMaV is 13,736 nucleotides (nt) in length and contains six open reading frames (ORFs) encoding a nucleocapsid protein (N), a phosphoprotein (P), a putative movement protein (P3), a matrix protein (M), a glycoprotein (G), and an RNA-dependent RNA polymerase (L). The coding sequences are flanked by a 194-nt leader and a 370-nt trailer sequence at the 3' terminus and 5' terminus, respectively. Pairwise sequence comparisons showed that PMuMaV is related to northern cereal mosaic virus (NCMV, 38.97%), barley yellow striate mosaic virus (BYSMV, 38.86%), and maize yellow striate virus (MYSV, 38.76%), and phylogenetic analysis also placed these viruses together into the same branch, thus suggesting that PMuMaV is a member of a new species in the genus Cytorhabdovirus.

Biomimetic Membrane-Structured Nanovesicles Carrying a Supramolecular Enzyme to Cure Lung Cancer.

Platforms for enzyme delivery must simultaneously have plasma stability, high catalytic activity, and low/no immunogenicity of the enzyme. Here, we designed a novel biomimetic membrane-structured nanovesicle (BNV) to efficiently carry supramolecular enzymes to meet the above requirements. We complexed l-asparaginase (Aase) with hydroxypropyl-ß-cyclodextrin (HPCD) to form a supramolecular amphiphile (AS) by self-assembly via noncovalent reversible interactions. We then used the first synthesized polyethylene glycol (PEG 2 kDa)-decorated hyaluronan (12 kDa) and HPCD to self-assemble a semipermeable biomimetic membrane-structured nanovesicle (BNV) together with AS loading. As compared to native Aase, AS@BNV exhibited superior catalytic activity preservation, improved catalytic activity, better pharmacokinetics in rats, enhanced cytotoxic effects, increased antitumor efficacy, and decreased side effects. The underlying mechanisms, such as the autophagy inhibition action against tumor cells, protein-protein docking of the interaction between Aase-serum albumin, and decreased hepatic enzymatic activity, were investigated. This approach paves the way for new types of powerful biomimetic-, supramolecular-, and nanocarrier-based enzymatic therapies.

Phospholipid/hydroxypropyl-ß-cyclodextrin supramolecular complexes are promising candidates for efficient oral delivery of curcuminoids.

Curcumin (Cur) and demethoxycurcumin (Dcur) are two natural analogues of phenol extracted from turmeric, possessing various pharmacological properties. However, their therapeutic potentials are substantially limited by their rather poor aqueous solubility and bioavailability. Herein, novel soluble supramolecular complexes of the two curcuminoids were firstly prepared by integrating phospholipid (PC) compound technology and a hydroxypropyl-ß-cyclodextrin (HPßCD) inclusion technique to enhance the bioavailability of the curcuminoids. The PC-HPßCD supramolecular complexes were demonstrated to show improved solubility, augmented drug release, enhanced in situ gastrointestinal absorption, and increased oral bioavailability. The significantly increased bioavailability might be attribute to the appropriate particle sizes (<200 nm), the near-neutral suface charges as well as the additional effects of PC and HPßCD. Overall, the PC-HPßCD supramolecular complexes may be considered as promising candidates for the efficient oral delivery of the curcuminoids; moreover, they are inexpensive, simple to prepare, and have good market prospects. Interestingly, the two natural analogues were found to be different in their in vivo bioavailability with or without supramolecular complexing, probably owing to the difference in the phenylmethoxy group. Therefore, Dcur may have a broader prospect in the pharmaceutical industry, based on its remarkable improvement in bioavailability and reported physiological activity.

Toward a better understanding of metabolic and pharmacokinetic characteristics of low-solubility, low-permeability natural medicines.

Today, it is very challenging to develop new active pharmaceutical ingredients. Developing good preparations of well-recognized natural medicines is certainly a practical and economic strategy. Low-solubility, low-permeability natural medicines (LLNMs) possess valuable advantages such as effectiveness, relative low cost and low toxicity, which is shown by the presence of popular products on the market. Understanding the in vivo metabolic and pharmacokinetic characteristics of LLNMs contributes to overcoming their associated problems, such as low absorption and low bioavailability. In this review, the structure-based metabolic reactions of LLNMs and related enzymatic systems, cellular and bodily pharmacological effects and metabolic influences, drug-drug interactions involved in metabolism and microenvironmental changes, and pharmacokinetics and dose-dependent/linear pharmacokinetic models are comprehensively evaluated. This review suggests that better pharmacological activity and pharmacokinetic behaviors may be achieved by modifying the metabolism through using nanotechnology and nanosystem in combination with the suitable administration route and dosage. It is noteworthy that novel nanosystems, such as triggered-release liposomes, nucleic acid polymer nanosystems and PEGylated dendrimers, in addition to prodrug and intestinal penetration enhancer, demonstrate encouraging performance. Insights into the metabolic and pharmacokinetic characteristics of LLNMs may help pharmacists to identify new LLNM formulations with high bioavailability and amazing efficacy and help physicians carry out LLNM-based precision medicine and individualized therapies.

Ethnobotanical survey of plant species for herbal tea in a Yao autonomous county (Jianghua, China): results of a 2-year study of traditional medicinal markets on the Dragon Boat Festival.

BACKGROUND: Herbal tea is widely consumed in Jianghua, a Yao autonomous county in Hunan Province, China, to prevent and treat diseases. The materials in herbal tea at the traditional medicinal markets at the Dragon Boat Festival remain unknown. The aims of the paper were (1) to specifically investigate the materials of herbal tea used by Yao nationalities in Hunan Province, (2) to record the most common and the culturally important medicinal plant species in the markets, and (3) to compare the medical plant tradition both used for herbal tea between the Jianghua and Lingnan regions. METHODS: During 2016-2017, 215 vendors were interviewed at traditional medicinal markets at the Dragon Boat Festival in Jianghua to record plants used for herbal tea and to document traditional knowledge of their medicinal function, habitat, and conservation status. Bunches of medicinal plants were purchased to identify the species and to prepare voucher specimens. Cognitive salience (CS) based on free-lists and use value (UV) were calculated to analyze the cultural importance of medical plants; other quantitative methods (coefficient of similarity and chi-square analysis) were applied for comparison of herbal tea tradition between the Jianghua and Lingnan regions. RESULTS: A total of 169 species belonging to 66 families and 142 genera were recorded in herbal tea to treat health conditions in the study area. There were 30 health conditions that were recorded, with heat-clearing and detoxifying being the most common medicinal function, followed by treating rheumatism and promoting blood circulation. Of the 169 species, 97 were herbs. The whole plant was the most commonly used plant part in the preparation of herbal tea. According to the national evaluation criteria, three of these species are listed on "China's red list" and registered as vulnerable (VU). By comparing the coefficient of similarity of herbal tea plants and the number of mentions for part(s) used in Jianghua and Lingnan, the medicinal plant tradition is different in two areas. CONCLUSIONS: Herbal tea in Jianghua reflects the cultural diversity of the Yao people and the plant diversity of the region. Future research on the safety, efficacy, and the adulterants of herbal tea are needed for sustainable utilization.