What drives soil degradation after gravel mulching for 6 years in northwest China?

Gravel mulch is an agricultural water conservation practice that has been widely used in the semi-arid region of northwest China, but its effectiveness is now lessening due to soil degradation caused by long-term gravel mulching. In this study, we report on a 6-year-long gravel mulch experiment conducted in the northwestern Loess Plateau to evaluate the impact of gravel mulch on soil physicochemical properties and microbial communities, with the objective of clarifying the causes of long-term gravel mulching-induced land degradation. After 6 years mulching, we found that gravel mulched soil contained significantly higher concentrations of total carbon and total organic carbon than non-mulched soil (control). Long-term gravel mulching significantly changed the soil microbial diversity and abundance distribution of bacterial and fungal communities. Notably, the relative abundance of Acidobacteria was significantly higher under gravel mulching than the control (no mulching), being significantly greater in the AG treatment (small-sized gravel, 2-5 mm) than all other treatments. Conversely, the relative abundance of Actinobacteria was significantly lower under gravel mulching than the control, being the lowest in the BG treatment (large-sized gravel, 40-60 mm). At the same time, the relative abundance of Bacteroidetes was significantly lower in AG yet higher in BG vis-à-vis the other treatments. Of the various factors examined, on a 6-year scale, the capture of dust by gravel mulch and altered carbon and nitrogen components in soil play major contributing roles in the compositional change of soil microorganisms. These results suggest that modified soil material input from gravel mulching may be the key factor leading to soil degradation. More long-term experimental studies at different sites are now needed to elucidate the mechanisms responsible for soil degradation under gravel mulching.

Genetic diversity analysis of lychnis mottle virus and first identification of Angelica sinensis infection.

Gansu Province is a district renowned for the cultivation of Angelica sinensis (Oliv.) Diels, accounting for greater than 90% of China's total annual production. However, virus infection has caused a reduction in A. sinensis yield. Here, we collected suspected virus-infected A. sinensis leaf samples from Gansu Province's A. sinensis cultivation area. For the first time, using small RNA deep sequencing and RT-PCR, lychnis mottle virus (LycMoV) was found to naturally infect A. sinensis. The coat protein (cp) gene of the Gansu A. sinensis LycMoV isolate was obtained through cloning, where its nucleotide and amino acid identity was highest while having the closest affinity to the China Pearl (i.e., Prunus persica) isolate. Recombination analysis indicated that genetic recombination had only a limited influencing effect on the molecular evolution of LycMoV. Moreover, results from genetic diversity analysis indicated that the host, geographic isolation, and genetic drift may be the main factors that contributed to the formation of genetic diversity and differentiation in LycMoV. Furthermore, the LycMoV population trend was expansionary. Selection pressure may also be the main driver for the evolution of the entire LycMoV population, while the driving effect of genetic recombination is limited. This study marks a new LycMoV host (i.e., A. sinensis) for the first time and provides scientific support for the identification, prevention, and control of LycMoV.

Development of Colloidal Gold Immunochromatography and Reverse-Transcription Loop-Mediated Isothermal Amplification Assays to Detect Lychnis Mottle Virus.

Lychnis mottle virus (LycMoV; genus Unassigned, family Secoviridae) infection of Angelica sinensis produces mottle and mosaic symptoms, damaging the host. Early detection of relevant pathogens is the most critical step in preventing the potential transmission of infectious disease. Polyclonal antibodies with high potency and high specificity were prepared using the recombinant LycMoV capsid protein as an antigen. Here, we developed and optimized a rapid colloidal gold immunochromatography assay (GICA) detection system for LycMoV using this antibody. Under optimum conditions, GICA specifically detected (up to 10,000-fold) positive LycMoV samples. A real-time reverse-transcription loop-mediated isothermal amplification (RT-LAMP) system was also established by selecting the primers with high sensitivity and specificity to LycMoV. The RT-LAMP detection threshold was 1.42 fg/µl (291 copies/µl). A GICA-RT-LAMP assay system was further established and optimized. The minimum GICA detection line was calculated at 1.52 × 10-2 ng/µl. Although GICA did not detect positive samples after capturing virus at 2.53 × 10-3 ng/µl, GICA-LAMP and GICA-RT-PCR did, whose sensitivity was comparatively greater than sixfold. This is the first report showing that GICA-RT-LAMP is a cost-effective approach for use in detecting LycMoV without extracting nucleic acids. These sensitive assays will help improve virus disease management in A. sinensis crops.

First report of apple latent spherical virus infecting Angelica sinensis.

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

[Influence of Precipitation Change on Soil Respiration in Desert Grassland].

Global climate change has significantly changed precipitation patterns. Soil respiration (SR), as an important pathway through which CO2 is released from the soil carbon pool into the atmosphere, may affect the carbon cycle process of terrestrial ecosystems and have a feedback effect on global climate change in response to precipitation change. However, at present there is limited understanding of how SR is affected by precipitation change. Field precipitation control experiments were conducted (with -40%, -20%, natural, 20%, and 40% precipitation) on desert grassland in the west of the Loess Plateau, to investigate the influence of precipitation change on SR dynamics and its relationship with soil water content, soil temperature, aboveground biomass, soil organic carbon, microbial biomass carbon, carbon-nitrogen ratio, and other factors. The results show that the diurnal variations of SR under different precipitation treatments were consistent in unimodal and bimodal models over three years. SR showed an increasing trend with added precipitation, relative to the control, and significant differences were observed between the second year (wetter) and the third year (drier) of the precipitation-manipulation experiment, indicating that precipitation changes had a legacy effect on SR. At the same time, SR was lowest under the -40% treatment and highest under the 40% treatment during the wetter year. The negative response of SR to precipitation exclusion treatments was stronger than the positive response to precipitation addition treatments. SR in drier years was significantly higher under precipitation addition treatments than the control, and the positive response of SR to increased precipitation treatment was significantly stronger than that under decreased precipitation treatment. In addition, soil water content, aboveground biomass, soil organic carbon, and carbon-nitrogen ratio were the environmental factors that obviously affected SR and increased with additional precipitation. SR increased with increases in soil water content, aboveground biomass, soil organic carbon, and carbon-nitrogen ratio, but decreased with increases in microbial biomass carbon. Among these factors, soil water content had the highest interpretation rate for SR, indicating that soil water content was the main environmental factor controlling SR in desert grassland. In both wetter and drier years, the amplitude of plant biomass input was lower than the amplitude of SR output under precipitation change, indicating that precipitation change may be unfavorable to soil carbon sequestration, especially in drier years, when precipitation change has a stronger influence on carbon pool output. Therefore, precipitation changes on SR in desert grassland in various dry and wet years may have different influences on the carbon cycle process of ecosystems, thus providing a reference for regional carbon budget assessment.

[Effects of Precipitation Changes on Plant Community Diversity and Soil C:N:P Ecological Stoichiometric Characteristics in a Desert Steppe of China].

Studying the influence of precipitation patterns on plant community diversity, soil C:N:P ecological stoichiometric characteristics, and the relationships between key soil factors and plant community diversity is of great significance for the protection of plant community diversity in desert grasslands. This paper was studied in the desert steppe of the west of Loess Plateau using a three-year precipitation manipulation experiment (40% reduction in precipitation, 20% reduction in precipitation, natural precipitation, 20% increase in precipitation, and 40% increase in precipitation), explored the influence of changes in precipitation in dry and wet years on the diversity of plant community and soil C:N:P ecological stoichiometric characteristics. And we also explored the relationship between soil C:N:P ecological stoichiometric characteristics and the key soil factors and the diversity of plant community under changes in precipitation. The results showed that in a normal year and the drier year (2013 and 2015), Patrick richness and Shannon-Wiener diversity index were significantly low under the 20% reduction treatment compared with the control and 40% increase treatments, respectively. During the wetter year, Patrick richness and Shannon-Wiener diversity index were no different between any of the precipitation treatments. In the normal year and the drier year, the soil organic carbon (SOC), total nitrogen (TN), and total phosphorus (TP) contents and the carbon-nitrogen ratio (C:N), carbon-phosphorus ratio (C:P), and nitrogen-phosphorus ratio (N:P) all decreased with an increase in precipitation (the decrease in the C:N ratio was statistically significant). During the wetter year, SOC, TN, C:P, and N:P increased with an increase in precipitation. During the normal year, precipitation treatments had no significant influence on soil water content, having a limited influence on the plant community. TN, N:P, SOC, C:N, and microbial biomass nitrogen (MBN) had a more prominent influence on plant community diversity. In the wetter year, precipitation was abundant leading to a rise in soil nutrients. Water was not the most important factor limiting to plant growth whereas soil water content, soil nutrients, and ecological stoichiometric characteristics jointly regulate plant community diversity. In the drier years, precipitation treatments had a significant impact on soil water content, whereby an increase in precipitation led to high losses of soil nutrients. Therefore, soil water content was the most important factor affecting plant community diversity during drier years. These observations indicate that under dry and wet years, plant community diversity and soil C:N:P ecological stoichiometric characteristics have variable responses to precipitation and soil C:N:P effect on plant community were also different. These results provide a theoretical basis for the protection and management of desert steppe systems under future projected changes in precipitation.

Greater Biofilm Formation and Increased Biodegradation of Polyethylene Film by a Microbial Consortium of Arthrobacter sp. and Streptomyces sp.

The widespread use of polyethylene (PE) mulch films has led to a significant accumulation of plastic waste in agricultural soils. The biodegradation of plastic waste by microorganisms promises to provide a cost-effective and environmentally-friendly alternative for mitigating soil plastic pollution. A large number of microorganisms capable of degrading PE have been reported, but degradation may be further enhanced by the cooperative activity of multiple microbial species. Here, two novel strains of Arthrobacter sp. and Streptomyces sp. were isolated from agricultural soils and shown to grow with PE film as a sole carbon source. Arthrobacter sp. mainly grew in the suspension phase of the culture, and Streptomyces sp. formed substantial biofilms on the surface of the PE film, indicating that these strains were of different metabolic types and occupied different microenvironments with contrasting nutritional access. Individual strains were able to degrade the PE film to some extent in a 90-day inoculation experiment, as indicated by decreased hydrophobicity, increased carbonyl index and CO2 evolution, and the formation of biofilms on the film surface. However, a consortium of both strains had a much greater effect on these degradation properties. Together, these results provide new insights into the mechanisms of PE biodegradation by a microbial consortium composed of different types of microbes with possible metabolic complementarities.

Induction of Salt Tolerance in Arabidopsis thaliana by Volatiles From Bacillus amyloliquefaciens FZB42 via the Jasmonic Acid Signaling Pathway.

Previously, we showed that Bacillus amyloliquefaciens FZB42 can confer salt tolerance in plants by root inoculation under salt stress condition, and the FZB42 volatile organic compounds (VOCs) promoted plant growth and development under non-salt stress condition. In the present study, we investigated the mechanism that allows FZB42 VOCs to confer salt tolerance in Arabidopsis without colonization of plant roots. We found that FZB42 VOCs significantly increased the biomass of Arabidopsis and also maintained the leaf chlorophyll content under salt stress condition. Physiological tests showed that the plant anti-oxidation system was activated by FZB42 VOCs, where higher peroxidase (POD), catalase (CAT), and superoxide dismutase (SOD) activities were detected in plants exposed to FZB42 VOCs compared with non-exposed plants. In addition, FZB42 VOCs increased the leaf total soluble sugars (TSS) content but decreased the proline content compared with the non-exposed plants. Moreover, FZB42 VOCs significantly decreased the Na+ contents of the whole plants and induced the expression of genes (NHX1; Na+/H+ exchanger 1 and HKT1; high-affinity K+ transporter 1) that function to alleviate Na+ toxicity. Furthermore, analysis of mutants with defects in specific hormone pathways showed that FZB42 VOCs induced salt tolerance in plants by modulating jasmonic acid (JA) signaling, which was confirmed by the up-regulation of JA synthesis, defense-related genes, and JA biosynthesis inhibitor tests. The results of this study provide new insights into the molecular mechanism related to the interactions between plant growth-promoting rhizobacteria and plants under salt stress condition.

Structural characterization of Lanzhou lily (Lilium davidii var. unicolor) polysaccharides and determination of their associated antioxidant activity.

BACKGROUD: The Lanzhou lily (Lilium davidii var. unicolor) is the only Lilium species that is used for both culinary and medicinal purposes in China. Its bulbs contain various bioactive substances, such as polysaccharides, saponins and colchicine. Lanzhou lily polysaccharides are known to have anti-immunity, anti-tumor and anti-oxidation functions. RESULTS: The present study used a Box-Behnken design to optimize the ultrasound-assisted extraction of Lanzhou lily polysaccharides. Compared to other enzymes, trypsin significantly increased the polysaccharide yields, whereas the protein content of polysaccharides extracted with trypsin was the lowest. Monosaccharide mainly includes glucose (> 50%) and mannose (> 10%). 1,1-Diphenyl-2-picrylhydrazyl radical scavenging activity, chelating activity, total antioxidant capacity and hydroxyl radical scavenging activity of Lanzhou lily polysaccharides extracted with trypsin were stronger than those extracted without enzymes (control). Structural characteristics of Lanzhou lily polysaccharides extracted with trypsin and extracted without enzymes were characterized by scanning electron microscopy and nuclear magnetic resonance spectroscopy. When water extracted polysaccharide and trypsin extracted polysaccharide concentrations were 200 µg mL-1 , Raw264.7 proliferation rates were 101.69% and 159.41%, respectively. CONCLUSION: The Lanzhou lily polysaccharide was identified as α-(1 → 6)-d-glucan. Consequently, the effects of both potential antioxidant and proliferative activity of trypsin are significant. © 2020 Society of Chemical Industry.

[Responses of plant growth of different life-forms to precipitation changes in desert steppe]. / è’æ¼ è‰åŽŸåŒºä¸åŒç”Ÿæ´»åž‹æ¤ç‰©ç”Ÿé•¿å¯¹é™æ°´å˜åŒ–çš„å“åº”.

Under the background of global climate change, precipitation changes will have profound impacts on plant community dynamics. Through field experiment with precipitation manipulation in a desert steppe of western Loess Plateau, we examined the responses of species richness, density, coverage, height and aboveground biomass of different plant life-forms to precipitation changes. The results showed significant effects of precipitation on richness, density and coverage of annual herbs in the third year of manipulation experiment (2015), with lowest values in the decreased precipitation treatments. The height of annual herbs was more sensitive to precipitation changes, and was lowest in the -40% precipitation treatment during three years. The magnitudes of negative response of growth and aboveground biomass of annual herbs to decreased precipitation were larger than that to increased precipitation. Richness, density and coverage of perennial herbs in the decreased precipitation were significantly lower than those in the +40% precipitation in the 3rd year, but were insignificantly different from the control. The height of perennial herbs was lowest in the -40% precipitation treatment during three years. The magnitudes of negative response of richness, coverage and height of perennial herbs to decreased precipitation were larger than positive response to increased precipitation, while the positive response of aboveground biomass to the +40% precipitation treatment was stronger. The positive responses of richness, density, coverage and aboveground biomass of shrub to ±20% precipitation treatments were most obvious, which might be related to the relatively concentrated distribution of shrub in these treatments. The precipitation reduction inhibited the growth of herbaceous plants, particularly on the annual herbs, whereas increasing precipitation promoted perennial herbaceous growth and biomass accumulation to some extent. The annual herbaceous growth and biomass fluctuated with interannual variation of precipitation. Shrubs were relatively less affected by precipitation changes. Precipitation changes would have significant effects on plant community composition and function of desert steppe in western Loess Plateau.

Rapid Detection of Lily mottle virus and Arabis mosaic virus Infecting Lily (Lilium spp.) Using Reverse Transcription Loop-Mediated Isothermal Amplification.

The Lily mottle virus (LMoV) impedes the growth and quality of lily crops in Lanzhou, China. Recently Arabis mosaic virus (ArMV) has been detected in LMoV-infected plants in this region, causing plant stunting as well as severe foliar symptoms, and likely posing a threat to lily production. Consequently, there is a need to develop simple, sensitive, and reliable detection methods for these two viruses to prevent them from spreading. Reverse transcription (RT) loop-mediated isothermal amplification (LAMP) assays have been developed to detect LMoV and ArMV using two primer pairs that match six conserved sequences of LMoV and ArMV coat proteins, respectively. RT-LAMP assay results were visually assessed in reaction tubes using green fluorescence and gel electrophoresis. Our assays successfully detected both LMoV and ArMV in lily plants without the occurrence of viral cross-reactivity from other lily viruses. Optimal conditions for LAMP reactions were 65°C and 60°C for 60 min for LMoV and ArMV, respectively. Detection sensitivity for both RT-LAMP assays was a hundredfold greater than that of our comparative RT-polymerase chain reaction assays. We have also found this relatively rapid, target specific and sensitive method can also be used for samples collected in the field and may be especially useful in regions with limited or no laboratory facilities.

Rapid and Sensitive Detection of Lettuce Necrotic Yellows Virus and Cucumber Mosaic Virus Infecting Lettuce (Lactuca sativa L.) by Reverse Transcription Loop-Mediated Isothermal Amplification.

Cucumber mosaic virus (CMV) is damaging to the growth and quality of lettuce crops in Lanzhou, China. Recently, however, for the first time an isolate of lettuce necrotic yellows virus (LNYV) has been detected in lettuce crops in China, and there is concern that this virus may also pose a threat to lettuce production in China. Consequently, there is a need to develop a rapid and efficient detection method to accurately identify LNYV and CMV infections and help limit their spread. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) assays were developed to detect the nucleoprotein (N) and coat protein (CP) genes of LNYV and CMV, respectively. RT-LAMP amplification products were visually assessed in reaction tubes separately using green fluorescence and gel electrophoresis. The assays successfully detected both viruses in infected plants without cross reactivity recorded from either CMV or LNYV or four other related plant viruses. Optimum LAMP reactions were conducted in betaine-free media with 6 mM Mg2+ at 65°C for LNYV and 60°C for 60 min for CMV, respectively. The detection limit was 3.5 pg/ml and 20 fg/ml using RT-LAMP for LNYV and CMV plasmids, respectively. Detection sensitivity for both RT-LAMP assays was greater by a factor of 100 compared to the conventional reverse transcription polymerase chain reaction assays. This rapid, specific, and sensitive technique should be more widely applied due to its low cost and minimal equipment requirements.

Effect of air temperature on growth performance, apparent digestibilities, rumen fermentation and serum metabolites in Altay and Hu lambs.

Fat-tailed Altay sheep are indigenous to the Altay prefecture and well adapted to severe cold and sparse pasture of poor quality. Hu sheep were introduced to this region in the 1970s and are raised mainly in feedlots. We hypothesized that the dietary energy utilization would differ between breeds and predicted that Altay sheep would be more efficient than Hu sheep, in particular at a low air temperature. To test this prediction, we examined growth performance, apparent digestibilities, rumen fermentation and serum metabolites in Altay (32 ± 2.6 kg) and Hu sheep (31 ± 2.7 kg) at air temperatures of -5 and 20°C. Average daily gain (ADG), feed and metabolizable energy intakes were greater in Altay than in Hu sheep (p < .01), and all were greater at -5°C than 20°C (p < .01). Body mass gain-to-feed intake ratio was higher in Altay than in Hu sheep (p < .001), but was not affected by air temperature (p > .10). Rumen total volatile fatty acid (VFA) concentration was greater in Hu than in Altay sheep (p < .05) and was greater at 20°C than at -5°C (p < .05), while rumen microbial protein concentration was greater in Altay than in Hu sheep (p < .05). Rectal temperature was higher at -5°C than 20°C (p < .05) and was similar between breeds (p > .05). Serum glucose, non-esterified fatty acid (NEFA) and urea-N concentrations were higher in Hu than in Altay sheep (p < .05). It was concluded that Altay sheep are better able to cope with poor quality diets as they had higher digestibility of nutrients, ADG and body mass gain-to-feed intake ratio than Hu sheep.

Epsc Involved in the Encoding of Exopolysaccharides Produced by Bacillus amyloliquefaciens FZB42 Act to Boost the Drought Tolerance of Arabidopsis thaliana.

Bacillus amyloliquefaciens FZB42 is a plant growth-promoting rhizobacteria that stimulates plant growth, and enhances resistance to pathogens and tolerance of salt stress. Instead, the mechanistic basis of drought tolerance in Arabidopsis thaliana induced by FZB42 remains unexplored. Here, we constructed an exopolysaccharide-deficient mutant epsC and determined the role of epsC in FZB42-induced drought tolerance in A. thaliana. Results showed that FZB42 significantly enhanced growth and drought tolerance of Arabidopsis by increasing the survival rate, fresh and dry shoot weights, primary root length, root dry weight, lateral root number, and total lateral root length. Coordinated changes were also observed in cellular defense responses, including elevated concentrations of proline and activities of superoxide dismutase and peroxidase, decreased concentrations of malondialdehyde, and accumulation of hydrogen peroxide in plants treated with FZB42. The relative expression levels of drought defense-related marker genes, such as RD29A, RD17, ERD1, and LEA14, were also increased in the leaves of FZB42-treated plants. In addition, FZB42 induced the drought tolerance in Arabidopsis by the action of both ethylene and jasmonate, but not abscisic acid. However, plants inoculated with mutant strain epsC were less able to resist drought stress with respect to each of these parameters, indicating that epsC are required for the full benefit of FZB42 inoculation to be gained. Moreover, the mutant strain was less capable of supporting the formation of a biofilm and of colonizing the A. thaliana root. Therefore, epsC is an important factor that allows FZB42 to colonize the roots and induce systemic drought tolerance in Arabidopsis.

Effects of lily/maize intercropping on rhizosphere microbial community and yield of Lilium davidii var. unicolor.

Continuous cropping of lily (Lilium davidii var. unicolor) or any other crop seriously affects yield and quality. In this study, we compared continuous cropping with lily/maize intercropping. We also examined the lily rhizosphere microbes community in both sole lily cropping and lily/maize intercropping systems, by the llumina Miseq platform. Here we refer to data of recent years field experimentation of a lily/maize intercrop system in different planting configurations in the Gaolan Ecological and Agricultural Research Station. Treatments included sole crops of lily and maize, an intercrop consisting of strips of four lily rows alternating with one maize rows. The land equivalent ratio (LER) of intercrops was 1.294. The results showed that compared to sole cropping, the yield of lily in the first year of planting increased when lily was intercropped with maize. The species annotation of the high-throughput sequencing experiment showed that there was no difference in the diversity of the lily rhizosphere soil microbes on phylum taxonomic level, but the relative abundance of some genus changed obviously. The relative abundance of harmful fungus Fusarium spp. and, Funneliformis spp., decreased, and the relative abundance of beneficial bacteria Sphingomonas spp. and, Nitrospira spp., increased. In addition, we found that Lecanicillium spp., appeared only in the intercropping lily rhizosphere soil and sole cropping maize rhizosphere soil. In conclusion, the findings indicated that lily/maize intercropping could change soil microenvironment, and affect the diversity and structure of microorganism community in lily rhizosphere, with further beneficial effect on the yield of lily.

Overexpression of LhSorNPR1, a NPR1-like gene from the oriental hybrid lily 'Sorbonne', conferred enhanced resistance to Pseudomonas syringae pv. tomato DC3000 in Arabidopsis.

The non-expressor of the pathogenesis-related genes 1 (NPR1) is a master regulator in defense signaling of plants and plays a key role in basal and systemic acquired resistance. In this study, we isolated a NPR1-like gene from the oriental hybrid lily 'Sorbonne' (designated as LhSorNPR1) using rapid amplification of cDNA ends (RACE). The open reading frame of LhSorNPR1 consisted of 1854 bp, encoding a protein of 617 amino acids. Multiple sequence alignment revealed that LhSorNPR1 shares high similarity to NPR1-like proteins and characteristics of the BTB/POZ domain and ankyrin repeats. A comparison between the intron/exon organization of LhSorNPR1 and orthologs from other plant species demonstrated that NPR1 genomic fragments (including LhSorNPR1) are all composed of 4 exons and 3 introns. We also identified sequence motifs involved in hormone response and binding sites for RAV1 proteins and WRKY transcription factors through the prediction of cis-regulatory elements in the LhSorNPR1 promoter. Our gene expression analysis showed that LhSorNPR1 transcript levels significantly differed in various tissues, and that LhSorNPR1 expressions were induced by sodium salicylate, ethephon, and methyl jasmonate. Furthermore, we transformed LhSorNPR1 into Col-0 wild-type Arabidopsis to conduct function analysis, and we observed enhanced resistance to the bacterial pathogen Pseudomonas syringae pv. tomato DC3000 in the Arabidopsis expressing LhSorNPR1 gene. The enhanced disease resistance of LhSorNPR1 expressing plants could correlate to elevated expression levels in pathogenesis-related genes (PR1, PR2, and PR5) in vivo.

Effects of gravel-sand mulching on soil bacterial community and metabolic capability in the semi-arid Loess Plateau, China.

Gravel and sand mulching is an indigenous technology used for the crop yield for at least 300 years in the loess area of northwest China; however, little is known about the changes of soil bacterial community and metabolic capability under the mulching. In this study, we investigated the soil microbial community structure and metabolic functional diversity during mulching using Illumina MiSeq sequencing and Biolog ECO method. Totally, 9417 OTUs were classified at 97% similarity level for soil samples after 0 (control), 4, 7, and 10 years of mulching. Dendrogram result indicated that mulching affected the soil bacterial community; and the higher richness and diversity of bacterial community were detected in mulching samples. The average abundance of soil bacteria (such as Proteobacteria, Actinobacteria, Firmicutes and Nitrospirae) in mulching samples was higher than samples without mulching. Besides, some microbial communities (such as Rhodobacteraceae, Phenylobacterium, Pseudonocardia, Nonomuraea and Aeromicrobium) were only present in the mulched soil samples. However, the lower metabolic capability was observed in mulching samples based on Biolog method, which the main reason for the opposite result might be that the soil objects detected by the two methods are different. In conclusion, these results demonstrated that gravel and sand mulching affected the structure and metabolic capability of bacterial community and was one reason for crop yield.

Characterization of LhSorTGA2, a novel TGA2-like protein that interacts with LhSorNPR1 in oriental hybrid lily Sorbonne.

BACKGROUND: Non-expressor of pathogenesis-related genes 1 (NPR1) regulates expression of pathogenesis-related (PR) genes by interacting with TGA family proteins during systemic acquired resistance (SAR). However, no TGA-like proteins or their interacting partners have been characterized in lily. RESULTS: In the present study, LhSorTGA2, a novel TGA-like protein, was identified as an interacting partner of LhSorNPR1 (an NPR-like protein) by bimolecular fluorescence complementation (BIFC) and yeast two-hybrid assay (Y2H). Subcellular localization of GFP-tagged proteins targeted LhSorTGA2 to the nucleus, whereas GFP-labeled LhSorNPR1 was observed both in the nucleus and at the cytomembrane. Sequence alignment revealed that LhSorTGA2 was featured with a basic leucine zipper (bZIP) domain and two glutamine rich acid domains (QI and QII). Further phylogenetic analysis showed that TGA family proteins can be grouped into three subclades, within which LhSorTGA2 was clustered into subclade I, together with AtTGA2/5/6. Expression of LhSorTGA2 was investigated in different tissues by qPCR, and the highest expression level was observed in stem. Besides, when treated with phytohormones (SA, MeJA, ETH and ABA) or fungal pathogen Botrytis elliptica, LhSorTGA2 expression was also induced at different time points post treatments. CONCLUSIONS: Collectively, these results suggested that LhSorTGA2 was an interacting partner of LhSorNPR1, which might function in regulating expression of PR genes in lily during SAR.

Transcriptome profiling of genes involved in induced systemic salt tolerance conferred by Bacillus amyloliquefaciens FZB42 in Arabidopsis thaliana.

Plant growth-promoting Bacillus amyloliquefaciens FZB42 induces systemic salt tolerance in Arabidopsis and enhances the fresh and dry weight. However, the underlying molecular mechanism that allows plants to respond to FZB42 and exhibit salt tolerance is largely unknown. Therefore, we performed large-scale transcriptome sequencing of Arabidopsis shoot tissues grown under salt stress with or without FZB42 inoculation by using Illumina sequencing to identify the key genes and pathways with important roles during this interaction. In total, 1461 genes were differentially expressed (FZB42-inoculated versus non-inoculated samples) at 0 mM NaCl, of which 953 were upregulated and 508 downregulated, while 1288 genes were differentially expressed at 100 mM NaCl, of which 1024 were upregulated and 264 were downregulated. Transcripts associated with photosynthesis, auxin-related, SOS scavenging, Na+ translocation, and osmoprotectant synthesis, such as trehalose and proline, were differentially expressed by FZB42 inoculation, which reduced the susceptibility to salt and facilitated salt adaptation. Meanwhile, etr1-3, eto1, jar1-1, and abi4-102 hormone-related mutants demonstrated that FZB42 might induce plant salt tolerance via activating plants ET/JA signaling but not ABA-dependent pathway. The results here characterize the plant transcriptome under salt stress with plant growth-promoting bacteria inoculation, thereby providing insights into the molecular mechanisms responsible for induced salt tolerance.

Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily.