Protocol for analyzing BCG-induced trained immunity in murine bone marrow-derived macrophages.

Bacillus Calmette-Guérin (BCG), the only licensed tuberculosis vaccine, provides non-specific protection against non-tuberculosis diseases that is mediated by trained immunity, a functional reprogramming mediated by innate immune memory. Here, we present a protocol for analyzing BCG-induced trained immunity in murine bone marrow-derived macrophages (BMDMs). We describe steps for preparing BCG single bacterial suspensions, isolating BMDM cells, and the training process. This protocol can assist researchers to conveniently utilize BMDM cells to study trained immunity. For complete details on the use and execution of this protocol, please refer to Xu et al.1.

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR­1301­3p/KIF23 axis.

Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR­545­3p (5'­TGGCTCAGTTCAGCAGGAAC­3') was actually for miR­24­3p (5'­UGGCUCAGUUCAGCAGGAACAG­3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR­670­5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I.  The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR­670­5p and miR­545­3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].

Cas12a RNP-mediated co-transformation enables transgene-free multiplex genome editing, long deletions, and inversions in citrus chromosome.

Introduction: Citrus canker, caused by Xanthomonas citri subsp. citri (Xcc), is a devastating disease worldwide. Previously, we successfully generated canker-resistant Citrus sinensis cv. Hamlin lines in the T0 generation. This was achieved through the transformation of embryogenic protoplasts using the ribonucleoprotein (RNP) containing Cas12a and one crRNA to edit the canker susceptibility gene, CsLOB1, which led to small indels. Methods: Here, we transformed embryogenic protoplasts of Hamlin with RNP containing Cas12a and three crRNAs. Results: Among the 10 transgene-free genome-edited lines, long deletions were obtained in five lines. Additionally, inversions were observed in three of the five edited lines with long deletions, but not in any edited lines with short indel mutations, suggesting long deletions maybe required for inversions. Biallelic mutations were observed for each of the three target sites in four of the 10 edited lines when three crRNAs were used, demonstrating that transformation of embryogenic citrus protoplasts with Cas12a and three crRNAs RNP can be very efficient for multiplex editing. Our analysis revealed the absence of off-target mutations in the edited lines. These cslob1 mutant lines were canker- resistant and no canker symptoms were observed after inoculation with Xcc and Xcc growth was significantly reduced in the cslob1 mutant lines compared to the wild type plants. Discussion: Taken together, RNP (Cas12a and three crRNAs) transformation of embryogenic protoplasts of citrus provides a promising solution for transgene-free multiplex genome editing with high efficiency and for deletion of long fragments.

Immunological characterization and comparison of children with COVID-19 from their adult counterparts at single-cell resolution.

Introduction: The immunological characteristics that could protect children with coronavirus disease 2019 (COVID-19) from severe or fatal illnesses have not been fully understood yet. Methods: Here, we performed single-cell RNA sequencing (scRNA-seq) analysis on peripheral blood samples of 15 children (8 with COVID-19) and compared them to 18 adults (13 with COVID-19). Results: The child-adult integrated single cell data indicated that children with the disease presented a restrained response to type I interferon in most of the major immune cell types, along with suppression of upstream interferon regulatory factor and toll-like receptor expression in monocytes, which was confirmed by in vitro interferon stimulation assays. Unlike adult patients, children with COVID-19 showed lower frequencies of activated proinflammatory CD14+ monocytes, possibly explaining the rareness of cytokine storm in them. Notably, natural killer (NK) cells in pediatric patients displayed potent cytotoxicity with a rich expression of cytotoxic molecules and upregulated cytotoxic pathways, whereas the cellular senescence, along with the Notch signaling pathway, was significantly downregulated in NK cells, all suggesting more robust cytotoxicity in NK cells of children than adult patients that was further confirmed by CD107a degranulation assays. Lastly, a modest adaptive immune response was evident with more naïve T cells but less activated and proliferated T cells while less naïve B cells but more activated B cells in children over adult patients. Conclusion: Conclusively, this preliminary study revealed distinct cell frequency and activation status of major immune cell types, particularly more robust NK cell cytotoxicity in PBMC that might help protect children from severe COVID-19.

TNF-α and RPLP0 drive the apoptosis of endothelial cells and increase susceptibility to high-altitude pulmonary edema.

High-altitude pulmonary edema (HAPE) is a fatal threat for sojourners who ascend rapidly without sufficient acclimatization. Acclimatized sojourners and adapted natives are both insensitive to HAPE but have different physiological traits and molecular bases. In this study, based on GSE52209, the gene expression profiles of HAPE patients were compared with those of acclimatized sojourners and adapted natives, with the common and divergent differentially expressed genes (DEGs) and their hub genes identified, respectively. Bioinformatic methodologies for functional enrichment analysis, immune infiltration, diagnostic model construction, competing endogenous RNA (ceRNA) analysis and drug prediction were performed to detect potential biological functions and molecular mechanisms. Next, an array of in vivo experiments in a HAPE rat model and in vitro experiments in HUVECs were conducted to verify the results of the bioinformatic analysis. The enriched pathways of DEGs and immune landscapes for HAPE were significantly different between sojourners and natives, and the common DEGs were enriched mainly in the pathways of development and immunity. Nomograms revealed that the upregulation of TNF-α and downregulation of RPLP0 exhibited high diagnostic efficiency for HAPE in both sojourners and natives, which was further validated in the HAPE rat model. The addition of TNF-α and RPLP0 knockdown activated apoptosis signaling in endothelial cells (ECs) and enhanced endothelial permeability. In conclusion, TNF-α and RPLP0 are shared biomarkers and molecular bases for HAPE susceptibility during the acclimatization/adaptation/maladaptation processes in sojourners and natives, inspiring new ideas for predicting and treating HAPE.

The therapeutic potential of gelsolin in attenuating cytokine storm, ARDS, and ALI in severe COVID-19.

Severe COVID-19 cases often progress to life-threatening conditions such as acute respiratory distress syndrome (ARDS), sepsis, and multiple organ dysfunction syndrome (MODS). Gelsolin (GSN), an actin-binding protein with anti-inflammatory and immunomodulatory properties, is a promising therapeutic target for severe COVID-19. Plasma GSN levels are significantly decreased in critical illnesses, including COVID-19, correlating with dysregulated immune responses and poor outcomes. GSN supplementation may mitigate acute lung injury, ARDS, and sepsis, which share pathophysiological features with severe COVID-19, by scavenging actin, modulating cytokine production, enhancing macrophage phagocytosis, and stabilizing the alveolar-capillary barrier. Preliminary data indicate that recombinant human plasma GSN improves oxygenation and lung function in severe COVID-19 patients with ARDS. Although further research is needed to optimize GSN therapy, current evidence supports its potential to mitigate severe consequences of COVID-19 and improve patient outcomes. This review provides a comprehensive analysis of the biological characteristics, mechanisms, and therapeutic value of GSN in severe COVID-19.

Global citrus root microbiota unravels assembly cues and core members.

Introduction: Citrus is one of the most important fruit crops worldwide, and the root-associated microbiota can have a profound impact on tree health and growth. Methods: In a collaborative effort, the International Citrus Microbiome Consortium investigated the global citrus root microbiota with samples collected from nine citrus-producing countries across six continents. We analyzed 16S rDNA and ITS2 amplicon sequencing data to identify predominant prokaryotic and fungal taxa in citrus root samples. Comparative analyses were conducted between root-associated microbial communities and those from the corresponding rhizosphere and bulk soil samples. Additionally, genotype-based group-wise comparisons were performed to assess the impact of citrus genotype on root microbiota composition. Results: Ten predominant prokaryotic phyla, containing nine bacterial phyla including Proteobacteria, Actinobacteria, Acidobacteria, and Bacteroidetes and one archaeal phylum (Thaumarchaeota), and multiple fungal phyla including Ascomycota and Basidiomycota were identified in the citrus root samples. Compared with the microbial communities from the corresponding rhizosphere and bulk soil samples from the same trees, the prokaryotic and fungal communities in the roots exhibited lower diversity and complexity but greater modularity compared to those in the rhizosphere. In total, 30 root-enriched and 150 root-depleted genera in bacterial community were identified, whereas 21 fungal genera were enriched, and 147 fungal genera were depleted in the root niche compared with the rhizosphere. The citrus genotype significantly affected the root prokaryotic and fungal communities. In addition, we have identified the core root prokaryotic genera comprising Acidibacter, Allorhizobium, Bradyrhizobium, Chitinophaga, Cupriavidus, Devosia, Dongia, Niastella, Pseudomonas, Sphingobium, Steroidobacter and Streptomyces, and the core fungal genera including Acrocalymma, Cladosporium, Fusarium, Gibberella, Mortierella, Neocosmospora and Volutella. The potential functions of these core genera of root microbiota were predicted. Conclusion: Overall, this study provides new insights into the assembly of microbial communities and identifies core members of citrus root microbiota across a wide geographic range. The findings offer valuable information for manipulating root microbiota to enhance plant growth and health.

A comprehensive evaluation of the frog effect on drivers in mountain highway tunnels - The effect of low-volume intermittent information.

OBJECTIVE: The driver's inability to fully absorb and react to operational cues while driving is like boiling a frog in warm water. With intermittent, low-volume information, drivers can underreact by ignoring these minor but continuous changes. This paper aims to provide an opportunity to test the effects of intermittently occurring low-volume information on drivers. METHODS: A real vehicle test with naturalistic driving was used to collect driving speed data from 40 drivers on a highway tunnel section in Chongqing, China, where nine tunnels are located. Drivers were classified into three categories according to the degree of compliance of their driving speed with the speed limit required by traffic signs, and drivers were analyzed in terms of their sensitivity to traffic signs and their reaction to driving maneuvers. RESULTS: Conservative drivers are the most absorbent of low-volume intermittent information, and the cumulative effect of the frog effect does not exceed 2.00 km; eager drivers tend to ignore this information, and the cumulative effect of the frog effect reaches 2.91 km; and the general type of driver is in the middle of these two types of drivers, and the frog effect gradually penetrates the driving speed in a weakly increasing manner, up to a maximum of 9.8 km. CONCLUSION: At the beginning of a journey, drivers are most sensitive to traffic signs, and low-volume intermittent information can also play a role in guiding driving operations effectively at this time. However, as the driving distance increases, the effect of the frog effect on different types of drivers gradually increases, even exceeding the effect caused by the black-and-white hole effect, especially when driving in tunnel groups. Considering the driving characteristics of different types of drivers to improve the deployment of low-volume intermittent information and reduce the distance of the frog effect can effectively improve driving safety.

Unlocking the Potential of Organic-Inorganic Hybrid Manganese Halides for Advanced Optoelectronic Applications.

Organic-inorganic hybrid manganese(II) halides (OIMnHs) have garnered tremendous interest across a wide array of research fields owing to their outstanding optical properties, abundant structural diversity, low-cost solution processibility, and low toxicity, which make them extremely suitable for use as a new class of luminescent materials for various optoelectronic applications. Over the past years, a plethora of OIMnHs with different structural dimensionalities and multifunctionalities such as efficient photoluminescence (PL), radioluminescence, circularly polarized luminescence, and mechanoluminescence have been newly created by judicious screening of the organic cations and inorganic Mn(II) polyhedra. Specifically, through precise molecular and structural engineering, a series of OIMnHs with near-unity PL quantum yields, high anti-thermal quenching properties, and excellent stability in harsh conditions have been devised and explored for applications in light-emitting diodes (LEDs), X-ray scintillators, multimodal anti-counterfeiting, and fluorescent sensing. In this review, the latest advancements in the development of OIMnHs as efficient light-emitting materials are summarized, which covers from their fundamental physicochemical properties to advanced optoelectronic applications, with an emphasis on the structural and functionality design especially for LEDs and X-ray detection and imaging. Current challenges and future efforts to unlock the potentials of these promising materials are also envisioned.

Exploring the relationship between anal fistula and colorectal cancer based on Mendelian randomization and bioinformatics.

The association between anal fistula patients and colorectal cancer, as well as the potential pathophysiological mechanisms, remains unclear. To explore the relationship between anal fistula and colorectal cancer and its potential mechanisms. Analysis of GEO and TCGA databases. Disease-related genes were also referenced from Coremine Medical, GeneCard and OMIM. Core hub genes were identified through protein-protein interaction analysis by intersecting differentially expressed genes from the datasets with disease data. On one hand, a prognostic model was developed using genes and its prognostic role was validated. On the other hand, the optimal diagnostic genes were selected through machine learning. Mendelian randomization (MR) analysis was conducted to explore the potential causal link between anal fistula and colorectal cancer. Thirteen core genes were identified (TMEM121B, PDGFRA, MID2, WNT10B, HOXD13, BARX1, SIX2, MMP1, SNAL1, CDKN2A, ITGB3, TIMP1, CALB2). Functional enrichment analysis revealed that the intersecting genes between anal fistula and colorectal cancer were associated with extracellular matrix components, signalling pathways, cell growth, protein modification, as well as important roles in cellular activities, tissue and organ development, and biological function maintenance. These genes were also involved in pathways related to Wnt signalling and colorectal cancer development. Prognostic analysis and immune infiltration analysis indicated a close relationship between core hub genes and the prognosis and immune infiltration in colorectal cancer. Machine learning showed that core genes played an essential role in the diagnostic differentiation of colorectal cancer. MR results suggested no causal relationship between anal fistula and colorectal cancer. This study identified shared core genes between anal fistula and colorectal cancer, involved in various pathways related to tumour development. These genes play crucial roles in prognosis and diagnosis.

Early recurrence and extensive retroperitoneal metastasis after surgery for high­grade mucinous tubular and spindle cell carcinoma: A case report and literature review.

Mucinous tubular and spindle cell carcinoma (MTSCC) is a rare subtype of renal cancer. The present report details the treatment experience of a case of MTSCC, where the patient underwent a right-side laparoscopic nephrectomy in October 2020 at Zhuji People's Hospital (Zhuji, China). A total of 3 months post-operation, multiple metastases were discovered in the right renal area and retroperitoneum, with rapid disease progression observed in the subsequent 2 months. Treatment with tislelizumab combined with pazopanib was ineffective, and the patient subsequently died. Although MTSCC is generally considered a low-grade 'indolent' tumor, with most patients achieving long-term survival post-surgery, a minority of cases, especially those of a higher grade, may experience postoperative recurrence and metastasis. Due to the rarity of metastatic MTSCC, most studies are based on small sample sizes or case reports, and there is a lack of standardized systemic treatment and follow-up strategies for metastatic MTSCC. The present paper summarizes and analyzes the clinical features, treatment methods and prognosis of metastatic MTSCC cases reported in the literature, aiming to provide assistance for the treatment and follow-up management of metastatic MTSCC. Even in cases of distant metastasis, aggressive surgical treatment, metastasectomy combined with molecular targeted or immunotherapy, may still be recommended.

Macrophage-derived exosomal miR-155 regulating hepatocyte pyroptosis in MAFLD.

Background: Previous studies have shown that pyroptosis in hepatocyte is essential for the development of MAFLD. Growing evidence has shown that exosomal miRNAs-mediated communication between inflammatory cells and hepatocyte is an important link in MAFLD. In the present study, we aim to elucidate whether macrophage-derived exosomal miRNAs contribute to the hepatocyte pyroptosis in the pathophysiological process of MAFLD. Methods: The effects of hepatocyte pyroptosis were investigated in an HFD-induced MAFLD mouse model and in the liver tissues from patients with MAFLD using immunohistochemistry, real-time PCR, Western blotting, and luciferase reporter assay, among other techniques. MiR-155 inhibitor tail injections and AAV-FoxO3a-GFP were also administered to respectively inhibit or overexpress its expression in an HFD-induced MAFLD mouse model. Results: Hepatocyte pyroptosis was heightened in the liver tissue of patients with MAFLD or HFD-induced MAFLD mouse. Importantly, treatment with a caspase-1 inhibitor or overexpression of FoxO3a reversed this trend. Our study also demonstrated that miR-155 expression and the number of infiltrated macrophages were increased, and knockdown of miR-155 attenuated hepotocyte pyroptosis and liver fibrosis in HFD-induced mouse. In addition, we demonstrated that macrophage-derived exosomal miR-155 was transferred to hepatocytes, leading to hepatocyte pyroptosis in MAFLD mouse. Furthermore, blockade of exosome secretion improved hepotocyte pyroptosis and liver fibrosis in HFD-induced mouse. On the contrary, macrophage-derived exosomal miR-155 worsened hepotocyte pyroptosis. Moreover, we found that miR-155 promoted hepatocyte pyroptosis in MAFLD by down-regulating FoxO3a. Conclusions: Taken together, our results demonstrated that macrophage-derived exosomal miR-155 promotes hepatocyte pyroptosis and liver fibrosis in MAFLD.

Characterizing Biphoton Spatial Wave Function Dynamics with Quantum Wavefront Sensing.

With an extremely high dimensionality, the spatial degree of freedom of entangled photons is a key tool for quantum foundation and applied quantum techniques. To fully utilize the feature, the essential task is to experimentally characterize the multiphoton spatial wave function including the entangled amplitude and phase information at different evolutionary stages. However, there is no effective method to measure it. Quantum state tomography is costly, and quantum holography requires additional references. Here, we introduce quantum Shack-Hartmann wavefront sensing to perform efficient and reference-free measurement of the biphoton spatial wave function. The joint probability distribution of photon pairs at the back focal plane of a microlens array is measured and used for amplitude extraction and phase reconstruction. In the experiment, we observe that the biphoton amplitude correlation becomes weak while phase correlation shows up during free-space propagation. Our work is a crucial step in quantum physical and adaptive optics and paves the way for characterizing quantum optical fields with high-order correlations or topological patterns.

A comprehensive analysis of TRP-related gene signature, and immune infiltration in patients with colorectal cancer.

BACKGROUND: Transient receptor potential (TRP) channels are involved in the development and progression of tumors. However, their role in colorectal cancer (CRC) remains unclear, and this study aims to investigate the role of TRP-related genes in CRC. METHODS: Data was obtained from The Cancer Genome Atlas (TCGA) database, and analyses were conducted on the GSE14333 and GSE38832 datasets to assess the prognosis and mark TRP-related genes (TRGs). Subsequently, clustering analysis and immune infiltration analysis were performed to explore the relevant TRGs. In vitro validation of key TRGs' gene and protein expression was conducted using human colon cancer cells. RESULTS: Compared to normal tissues, 8 TRGs were significantly upregulated in CRC, while 11 were downregulated. TRPA1 was identified as a protective prognostic factor, whereas TRPM5 (HR = 1.349), TRPV4 (HR = 1.289), and TRPV3 (HR = 1.442) were identified as prognostic risk factors. Receiver operating characteristic (ROC) curves and Kaplan-Meier (KM) analyses yielded similar results. Additionally, lower expression of TRPA1 and higher expression of TRPV4 and TRPM5 were negatively correlated with patient prognosis, and experimental validation confirmed the underexpression of TRPA1 and overexpression of TRPV4 and TRPM5 in CRC cell lines. CONCLUSION: This study identifies a TRP channel-related prognosis in CRC, providing a novel approach to stratifying CRC prognosis.

Mimics of Host Defense Peptides Derived from Dendronized Polylysines for Antibacterial and Anticancer Therapy.

Bacteria in tumor microenvironments promote carcinogenesis and trigger complications, suggesting the significance of intervening in bacterial growth in cancer treatment. Here, dendrimer-derived mimics (DMs) of host defense peptides (HDPs) were designed for antibacterial and anticancer therapy, which feature a dendronized polylysine core and polycaprolactone arms. DMs displayed not only remarkable activities against Staphylococcus aureus and human lung cancer cells, but also exceptional selectivity. The membranolytic mechanism revealed by morphology analysis explained their low susceptibility to induce resistance. Further, the optimized DM inhibited tumor growth in the subcutaneous tumor model when administered via intraperitoneal injection and exhibited negligible toxicity to tissues. Overall, we combined the superiority of dendrimers and the mechanism from HDPs to design agents with dual antibacterial and anticancer activities that possess great potential for clinical oncology therapy.

Light-promoted stereoselective late-stage difunctionalization and anti-tumor activity of oridonin.

The late-stage difunctionalization of diterpene oridonin by light-promoted direct oxyamination with various O-benzoylhydroxylamines was carried out to afford C16α-N-C17-OBz-oridonin derivatives (1-25) for the first time. Though as a radical reaction, it features high stereoselectivity to only produce C16α-N-C17-OBz-oridonins. The in vitro antiproliferative activity of these C16α-N-C17-OBz-oridonins against the human breast cancer cell lines (MCF-7) was evaluated by MTT assay, showing that most of the synthesized compounds possessed moderate anticancer activity against MCF-7 cell lines superior or similar to the parent compound oridonin. The derivative 25 with a N-methyl-N-(naphthalen-1-ylmethyl) substitution showed better cytotoxicity against MCF-7 cells (IC50 value of 11.75 µM) than oridonin (IC50 value of 17.95 µM).

Generating synthetic signaling networks for in silico modeling studies.

Predictive models of signaling pathways have proven to be difficult to develop. Traditional approaches to developing mechanistic models rely on collecting experimental data and fitting a single model to that data. This approach works for simple systems but has proven unreliable for complex systems such as biological signaling networks. Thus, there is a need to develop new approaches to create predictive mechanistic models of complex systems. To meet this need, we developed a method for generating artificial signaling networks that were reasonably realistic and thus could be treated as ground truth models. These synthetic models could then be used to generate synthetic data for developing and testing algorithms designed to recover the underlying network topology and associated parameters. We defined the reaction degree and reaction distance to measure the topology of reaction networks, especially to consider enzymes. To determine whether our generated signaling networks displayed meaningful behavior, we compared them with signaling networks from the BioModels Database. This comparison indicated that our generated signaling networks had high topological similarities with BioModels signaling networks with respect to the reaction degree and distance distributions. In addition, our synthetic signaling networks had similar behavioral dynamics with respect to both steady states and oscillations, suggesting that our method generated synthetic signaling networks comparable with BioModels and thus could be useful for building network evaluation tools.

Vertically resolved meteorological adjustments of aerosols and trace gases in Beijing, Taiyuan, and Hefei by using RF model.

Air pollution represents a complex phenomenon defined by the presence of various gases and particulate matter, leading to intricate spatio-temporal fluctuations. This study aims to enhance our understanding of how meteorological factors influence trace gases and aerosols, exacerbating air pollution in various geographical locations, specifically in Beijing's Fengtai (BJFT), Taiyuan City (SXTY), and Hefei's Science Island (HFDP). The study employs 2D-MAX-DOAS observations and utilizes the Random Forest (RF) model to decouple the influence of meteorological conditions from pollutant data. The vertical profile of nitrogen dioxide (NO2), sulfur dioxide (SO2), formaldehyde (HCHO), and aerosols at each study site was classified into four distinct layers, followed by conducting a meteorological decoupling analysis on each layer. This decoupling analysis demonstrates that meteorology significantly influences aerosols across all sites, with reductions ranging from 75 % to 95 % after de-weathering. SO2 shows minimal susceptibility, with the changes ranging from ±20 % to ±60 % after de-weathering. Among all sites, BJFT's pollutants exhibit less susceptibility overall, while pollutants at HFDP are more susceptible. The findings further reveal significant meteorological interventions in pollutants in surface layers (0.05 km and 0.2-0.4 km) at BJFT, with some exceptions at SXTY. However, pollutants, particularly NO2 and aerosols in higher layers (0.6-0.8 km and 1.0-1.2 km) at HFDP, also experience significant meteorological interferences. The findings at HFDP and SXTY reveal that removing meteorological influence also adjusts the profile shape of pollutants. For instance, the NO2 profile at HFDP during the winter season shifted from a bimodal to an exponential shape after de-weathering. Overall, this study sheds light on the complex interplay between meteorological factors and trace gases at various altitudes across different geographic locations, offering insights crucial for holistic and effective pollution mitigation strategies.

Prolong the shelf-life of the Pakchoi seedlings through the ammonium glycyrrhizinate.

Pakchoi seedlings (Brassica chinensis L.) is susceptible to damage and spoilage during harvest and transport, leading to significant quality deterioration and financial losses. This study explored the use of ammonium glycyrrhizinate (AG) to address these issues. AG self-assembles into macromolecules at room temperature, blocking stomata and regulating respiration rates in Pakchoi seedlings. Additionally, it disrupts bacterial cell biofilm and inhibits its synthesis. While AG has been used in medicine, its application in the food industry remains limited. The study found that incorporating AG in Pakchoi seedlings preserves water content and total soluble solids (TSS), while preventing declines in catalase (CAT), Vitamin C (VC), and chlorophyll during storage. AG also reduced malondialdehyde (MDA) levels and maintained peroxidase (POD) and superoxide dismutase (SOD) activities. At a concentration of 4.25 g L-1, AG enhanced radical scavenging ability and extended the shelf life of Pakchoi seedlings by inhibiting bacteria and postponing senescence.