First report of tomato as a natural host of tobacco vein banding mosaic virus (TVBMV) in Yunnan, China.

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

First report of potato virus H infecting tomato (Solanum lycopersicum) in China.

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

Endogenous nege-like viral elements in arthropod genomes reveal virus-host coevolution and ancient history of two plant virus families.

Negevirus is a recently proposed taxon of arthropod-infecting virus, which is associated with plant viruses of two families (Virgaviridae and Kitaviridae). Nevertheless, the evolutionary history of negevirus-host and its relationship with plant viruses remain poorly understood. Endogenous nege-like viral elements (ENVEs) are ancient nege-like viral sequences integrated into the arthropod genomes, which can serve as the molecular fossil records of previous viral infection. In this study, 292 ENVEs were identified in 150 published arthropod genomes, revealing the evolutionary history of nege-like viruses and two related plant virus families. We discovered three novel and eight strains of nege-like viruses in 11 aphid species. Further analysis indicated that 10 ENVEs were detected in six aphid genomes, and they were divided into four types (ENVE1-ENVE4). Orthologous integration and phylogenetic analyses revealed that nege-like viruses had a history of infection of over 60 My and coexisted with aphid ancestors throughout the Cenozoic Era. Moreover, two nege-like viral proteins (CP and SP24) were highly homologous to those of plant viruses in the families Virgaviridae and Kitaviridae. CP- and SP24-derived ENVEs were widely integrated into numerous arthropod genomes. These results demonstrate that nege-like viruses have a long-term coexistence with arthropod hosts and plant viruses of the two families, Virgaviridae and Kitaviridae, which may have evolved from the nege-like virus ancestor through horizontal virus transfer events. These findings broaden our perspective on the history of viral infection in arthropods and the origins of plant viruses. IMPORTANCE: Although negevirus is phylogenetically related to plant virus, the evolutionary history of negevirus-host and its relationship with plant virus remain largely unknown. In this study, we used endogenous nege-like viral elements (ENVEs) as the molecular fossil records to investigate the history of nege-like viral infection in arthropod hosts and the evolution of two related plant virus families (Virgaviridae and Kitaviridae). Our results showed the infection of nege-like viruses for over 60 My during the arthropod evolution. ENVEs highly homologous to viral sequences in Virgaviridae and Kitaviridae were present in a wide range of arthropod genomes but were absent in plant genomes, indicating that plant viruses in these two families possibly evolved from the nege-like virus ancestor through cross-species horizontal virus transmission. Our findings provide a new perspective on the virus-host coevolution and the origins of plant viruses.

Complete genome sequence and genetic characterization of a novel segmented RNA virus infecting Nilaparvata lugens.

The brown planthopper (BPH), Nilaparvata lugens, is a significant agricultural pest capable of long-distance migration and transmission of viruses that cause severe disease in rice. In this study, we identified a novel segmented RNA virus in a BPH, and this virus exhibited a close relationship to members of a recently discovered virus lineage known as "quenyaviruses" within the viral kingdom Orthornavirae. This newly identified virus was named "Nilaparvata lugens quenyavirus 1" (NLQV1). NLQV1 consists of five positive-sense, single-stranded RNAs, with each segment containing a single open reading frame (ORF). The genomic characteristics and phylogenetic analysis support the classification of NLQV1 as a novel quenyavirus. Notably, all of the genome segments of NLRV contained the 5'-terminal sequence AUCUG. The characteristic virus-derived small interfering RNA (vsiRNA) profile of NLQV1 suggests that the antiviral RNAi pathway of the host BPH was activated in response to virus infection. These findings represent the first documented report of quenyaviruses in planthoppers, contributing to our understanding of quenyaviruses and expanding our knowledge of insect-specific viruses in planthoppers.

Identification and Genome Characterization of a Novel Nege-like Virus Isolated from Aphids (Aphis gossypii) in Yunnan Province.

Negeviruses are insect-specific enveloped RNA viruses that exhibit a wide geographic distribution. A novel nege-like virus, tentatively named Aphis gossypii nege-like virus (AGNLV, GenBank: OR880429.1), was isolated from aphids (Aphis gossypii) in Lijiang City, Yunnan, China. AGNLV has a genome sequence of 9258 nt (excluding the polyA tail) encoding three open reading frames (ORFs). ORF1 (7149 nt) encodes a viral methyltransferase, a viral RNA helicase, and an RNA-dependent RNA polymerase. ORF2 (1422 nt) encodes a DiSB-ORF2_chro domain and ORF3 encodes an SP24 domain. The genome sequence of AGNLV shares the highest nucleotide identity of 60.0% and 59.5% with Wuhan house centipede virus 1 (WHCV1) and Astegopteryx formosana nege-like virus (AFNLV), respectively. Phylogenetic analysis based on the RNA-dependent RNA polymerase shows that AGNLV is clustered with other negeviruses and nege-like viruses discovered in aphids, forming a distinct "unclassified clade". Interestingly, AGNLV only encodes three ORFs, whereas AFNLV and WHCV1 have four ORFs. Structure and transmembrane domain predictions show the presence of eight alpha helices and five transmembrane helices in the AGNLV ORF3. Translational enhancement of the AGNLV 5' UTR was similar to that of the 5' UTR of plant viruses. Our findings provide evidence of the diversity and structure of nege-like viruses and are the first record of such a virus from a member of the genus Aphis.

Single-dose methamphetamine administration impairs ORM retrieval in mice via excessive DA-mediated inhibition of PrLGlu activity.

Methamphetamine (METH), an abused psychostimulant, impairs cognition through prolonged or even single-dose exposure, but animal experiments have shown contradictory effects on memory deficits. In this study we investigated the effects and underlying mechanisms of single-dose METH administration on the retrieval of object recognition memory (ORM) in mice. We showed that single-dose METH administration (2 mg/kg, i.p.) significantly impaired ORM retrieval in mice. Fiber photometry recording in METH-treated mice revealed that the activity of prelimbic cortex glutamatergic neurons (PrLGlu) was significantly reduced during ORM retrieval. Chemogenetic activation of PrLGlu or glutamatergic projections from ventral CA1 to PrL (vCA1Glu-PrL) rescued ORM retrieval impairment. Fiber photometry recording revealed that dopamine (DA) levels in PrL of METH-treated mice were significantly increased, and micro-infusion of the D2 receptor (D2R) antagonist sulpiride (0.25 µg/side) into PrL rescued ORM retrieval impairment. Whole-cell recordings in brain slices containing the PrL revealed that PrLGlu intrinsic excitability and basal glutamatergic synaptic transmission were significantly reduced in METH-treated mice, and the decrease in intrinsic excitability was reversed by micro-infusion of Sulpiride into PrL in METH-treated mice. Thus, the impaired ORM retrieval caused by single-dose METH administration may be attributed to reduced PrLGlu activity, possibly due to excessive DA activity on D2R. Selective activation of PrLGlu or vCA1Glu-PrL may serve as a potential therapeutic strategy for METH-induced cognitive dysfunction.

Metatranscriptome and small RNA sequencing revealed a mixed infection of newly identified bymovirus and bean yellow mosaic virus on peas.

Peas (Pisum sativum L.) are widely cultivated in temperate regions and are susceptible hosts for various viruses across different families. The discovery and identification of new viruses in peas has significant implications for field disease management. Here, we identified a mixed infection of two viruses from field-collected peas exhibiting virus-like symptoms using metatranscriptome and small RNA sequencing techniques. Upon identification, one of the viruses was determined to be a newly isolated and discovered bymovirus from peas, named "pea bymovirus 1 (PBV1)". The other was identified as a novel variant of bean yellow mosaic virus (BYMV-HZ1). Subsequently, mechanical inoculation and RT-PCR assays confirmed that both viruses could be inoculated back onto peas and tobaccos, showing mixed infection by PBV1 and BYMV-HZ1. To our knowledge, this is the first isolation of a bymovirus from pea and the first documented case of mixed infection of peas by PBV1 and BYMV-HZ1 in China.

Cross-kingdom RNA interference mediated by insect salivary microRNAs may suppress plant immunity.

Communication between insects and plants relies on the exchange of bioactive molecules that traverse the species interface. Although proteinic effectors have been extensively studied, our knowledge of other molecules involved in this process remains limited. In this study, we investigate the role of salivary microRNAs (miRNAs) from the rice planthopper Nilaparvata lugens in suppressing plant immunity. A total of three miRNAs were confirmed to be secreted into host plants during insect feeding. Notably, the sequence-conserved miR-7-5P is specifically expressed in the salivary glands of N. lugens and is secreted into saliva, distinguishing it significantly from homologues found in other insects. Silencing miR-7-5P negatively affects N. lugens feeding on rice plants, but not on artificial diets. The impaired feeding performance of miR-7-5P-silenced insects can be rescued by transgenic plants overexpressing miR-7-5P. Through target prediction and experimental testing, we demonstrate that miR-7-5P targets multiple plant genes, including the immune-associated bZIP transcription factor 43 (OsbZIP43). Infestation of rice plants by miR-7-5P-silenced insects leads to the increased expression of OsbZIP43, while the presence of miR-7-5P counteracts this upregulation effect. Furthermore, overexpressing OsbZIP43 confers plant resistance against insects which can be subverted by miR-7-5P. Our findings suggest a mechanism by which herbivorous insects have evolved salivary miRNAs to suppress plant immunity, expanding our understanding of cross-kingdom RNA interference between interacting organisms.

Complete genome analysis of a novel narnavirus in sweet viburnum (Viburnum odoratissimum).

Trees and shrubs provide important ecological services. However, few studies have surveyed the virome in trees and shrubs. In this study, we discovered a new positive-sense RNA virus originating from Viburnum odoratissimum, which we named "Vo narna-like virus". The complete genome of Vo narna-like virus is 3,451 nt in length with an open reading frame (ORF) encoding the RNA-dependent RNA polymerase (RdRP) protein. Phylogenetic analysis placed this virus within the betanarnavirus clade, sharing 53.63% amino acid sequence identity with its closest relative, Qingdao RNA virus 2. The complete sequence of the virus was confirmed by rapid amplification of cDNA ends (RACE) and Sanger sequencing. Small interfering RNA (siRNA) analysis indicated that this virus interacts with the RNA interference (RNAi) pathway of V. odoratissimum. This is the first report of a narnavirus in V. odoratissimum.

Histone deacetylase OsHDA706 orchestrates rice broad-spectrum antiviral immunity and is impeded by a viral effector.

Lysine acetylation is a dynamic post-translational modification of proteins. Extensive studies have revealed that the acetylation modulated by histone acetyltransferases and histone deacetylases (HDACs) plays a crucial role in regulating protein function. However, there has been limited focus on how HDACs regulate jasmonic acid (JA) biosynthesis in plants. Here, we uncover that the protein stability of OsLOX14, a critical enzyme involved in JA biosynthesis, is regulated by a histone deacetylase, OsHDA706, and is hindered by a viral protein. Our results show that OsHDA706 deacetylates OsLOX14 and enhances the stability of OsLOX14, leading to JA accumulation and an improved broad-spectrum rice antiviral defense. Furthermore, we found that the viral protein P2, encoded by the destructive rice stripe virus, disrupts the association of OsHDA706-OsLOX14, promoting viral infection. Overall, our findings reveal how HDAC manipulates the interplay of deacetylation and protein stability of a JA biosynthetic enzyme to enhance plant antiviral responses.

Identification and Genome Characterization of a Novel Virus within the Genus Totivirus from Chinese Bayberry (Myrica rubra).

Chinese bayberry (Myrica rubra) is an economically significant fruit tree native to eastern Asia and widely planted in south-central China. However, studies about the viruses infecting M. rubra remain largely lacking. In the present study, we employed the metatranscriptomic method to identify viruses in M. rubra leaves exhibiting yellowing and irregular margin symptoms collected in Fuzhou, a city located in China's Fujian province in the year 2022. As a consequence, a novel member of the genus Totivirus was identified and tentatively named "Myrica rubra associated totivirus 1" (MRaTV1). The genome sequencing of MRaTV1 was determined by overlapping reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The two deduced proteins encoded by MRaTV1 have the highest amino acid (aa) sequence identity to the coat protein (CP) and RNA-dependent RNA polymerase (RdRP) of Panax notoginseng virus A (PNVA), a member of the genus Totivirus within the family Totiviridae, at 49.7% and 61.7%, respectively. According to the results of the phylogenetic tree and the species demarcation criteria of the International Committee on Taxonomy of Viruses (ICTV) for the genus Totivirus, MRaTV1 is considered a new member of the genus Totivirus.

Molecular Characterization of an Isolate of Bean Common Mosaic Virus First Identified in Gardenia Using Metatranscriptome and Small RNA Sequencing.

Gardenia (Gardenia jasminoides) is a popular and economically vital plant known for its ornamental and medicinal properties. Despite its widespread cultivation, there has been no documentation of plant viruses on gardenia yet. In the present study, gardenia leaves exhibiting symptoms of plant viral diseases were sampled and sequenced by both metatranscriptome and small RNA sequencing. As a consequence, bean common mosaic virus (BCMV) was identified in gardenia for the first time and named BCMV-gardenia. The full genome sequence of BCMV-gardenia is 10,054 nucleotides (nt) in length (excluding the poly (A) at the 3' termini), encoding a large polyprotein of 3,222 amino acids. Sequence analysis showed that the N-termini of the polyprotein encoded by BCMV-gardenia is less conserved when compared to other BCMV isolates, whereas the C-termini is the most conserved. Maximum likelihood phylogenetic analysis showed that BCMV-gardenia was clustered closely with other BCMV isolates identified outside the leguminous plants. Our results indicated that the majority of BCMV-gardenia virus-derived small interfering RNAs (vsiRNAs) were 21 nt and 22 nt, with 21 nt being more abundant. The first nucleotide at the 5' termini of vsiRNAs derived from BCMV-gardenia preferred U and A. The ratio of vsiRNAs derived from sense (51.1%) and antisense (48.9%) strands is approaching, and the distribution of vsiRNAs along the viral genome is generally even, with some hot spots forming in local regions. Our findings could provide new insights into the diversity, evolution, and host expansion of BCMV and contribute to the prevention and treatment of this virus.

Complete genome sequence of a novel robigovirus infecting Mentha arvensis.

The complete genomic sequence of a novel robigovirus, provisionally named "Mentha arvensis robigovirus 1" (MARV1), was determined by combining next-generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), and rapid amplification of cDNA ends (RACE) PCR. The complete genomic sequence of this new virus is 7617 nucleotides in length, excluding the 3' poly(A) tail. The MARV1 genome encodes a putative replicase, "triple gene block" proteins, and a coat protein. Phylogenetic analysis demonstrated that MARV1 is a member of the genus Robigovirus, with closest relationships to African oil palm ringspot virus (AOPRV). Furthermore, MARV1-derived small interfering RNAs (siRNAs) showed typical patterns of plant-virus-derived siRNAs produced by the host antiviral RNA interference pathway. This is the first report of a plant virus of the genus Robigovirus in M. arvensis.

The evolution and functional divergence of 10 Apolipoprotein D-like genes in Nilaparvata lugens.

Apolipoprotein D (ApoD), a member of the lipocalin superfamily of proteins, is involved in lipid transport and stress resistance. Whereas only a single copy of the ApoD gene is found in humans and some other vertebrates, there are typically several ApoD-like genes in insects. To date, there have been relatively few studies that have examined the evolution and functional differentiation of ApoD-like genes in insects, particularly hemi-metabolous insects. In this study, we identified 10 ApoD-like genes (NlApoD1-10) with distinct spatiotemporal expression patterns in Nilaparvata lugens (BPH), which is an important pest of rice. NlApoD1-10 were found to be distributed on 3 chromosomes in a tandem array of NlApoD1/2, NlApoD3-5, and NlApoD7/8, and show sequence and gene structural divergence in the coding regions, indicating that multiple gene duplication events occurred during evolution. Phylogenetic analysis revealed that NlApoD1-10 can be clustered into 5 clades, with NlApoD3-5 and NlApoD7/8 potentially evolving exclusively in the Delphacidae family. Functional screening using an RNA interference approach revealed that only NlApoD2 was essential for BPH development and survival, whereas NlApoD4/5 are highly expressed in testes, and might play roles in reproduction. Moreover, stress response analysis revealed that NlApoD3-5/9, NlApoD3-5, and NlApoD9 were up-regulated after treatment with lipopolysaccharide, H2 O2 , and ultraviolet-C, respectively, indicating their potential roles in stress resistance.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

Co-option of a non-retroviral endogenous viral element in planthoppers.

Non-retroviral endogenous viral elements (nrEVEs) are widely dispersed throughout the genomes of eukaryotes. Although nrEVEs are known to be involved in host antiviral immunity, it remains an open question whether they can be domesticated as functional proteins to serve cellular innovations in arthropods. In this study, we found that endogenous toti-like viral elements (ToEVEs) are ubiquitously integrated into the genomes of three planthopper species, with highly variable distributions and polymorphism levels in planthopper populations. Three ToEVEs display exon‒intron structures and active transcription, suggesting that they might have been domesticated by planthoppers. CRISPR/Cas9 experiments revealed that one ToEVE in Nilaparvata lugens, NlToEVE14, has been co-opted by its host and plays essential roles in planthopper development and fecundity. Large-scale analysis of ToEVEs in arthropod genomes indicated that the number of arthropod nrEVEs is currently underestimated and that they may contribute to the functional diversity of arthropod genes.

Viromic approach reveals differences in the composition, diversity and relative abundance of pumpkin viruses across main growing regions of China.

China is the leading country for pumpkin production in the world. As other cucurbits, diseases caused by viruses are among the serious threats to pumpkin production, but our knowledge on the virus species infecting pumpkin plants is fragmentary. To understand the occurrence of viral diseases on pumpkin, we determined the geographical distribution characteristics, relative abundance and evolutionary relationship of pumpkin infected viruses by meta-transcriptome sequencing (RNA-seq) and viromic analysis of 159 samples exhibited typical viral symptoms collected across China in this study. Totally, 11 known and 3 new viruses were identified. Interestingly, 3 new viruses identified in this study should be positive-sense single-stranded RNA virus whose hosts are prokaryotes. The viruses identified in different sampling locations exhibit significant variations in term of virus species and relative abundance. Here, the results provide valuable information for understanding the virus species and their diversity in cultivated pumpkin across major growing regions of China.

Prevalence of Reversed Genome Organizations for Viruses in the Family Iflaviridae, Order Picornavirales.

Viruses in the order Picornavirales possess a positive-strand RNA genome that encodes structural proteins (SPs) and nonstructural proteins (NSPs). According to the recent report of the International Committee on Taxonomy of Viruses (ICTV), there are 8 families in Picornavirales, and monopartite picornaviruses in each family exhibit distinct types of genome organizations with rearranged genes coding for SPs and NSPs, namely, TypeI (5'-SPs-NSPs-3') and TypeII (5'-NSPs-SPs-3'). In the present study, 2 iflaviruses with the 2 genome types were unexpectedly identified in a damselfly host species, suggesting that these 2 genome types coexisted in the same host species, and the families of order Picornavirales might be more complex than previously thought. The consequent systematic homologous screening with all the publicly available picornaviruses successfully revealed a considerable number of candidates rearranged genome types of picornaviruses in various families of Picornavirales. Subsequently, phylogenetic trees were reconstructed based on RNA dependent RNA polymerase and coat protein, which evidently confirmed the prevalence of the 10 typeII iflaviruses in the Iflaviridae family. This suggests that genome types may not be relevant to viral taxonomy in this family. However, candidate picornaviruses with reversed genome types in the Secoviridae and Dicistroviridae families require further investigation. All in all, as the number of newly discovered viruses increases, more viruses with non-canonical genome arrangements will be uncovered, which can expand our current knowledge on the genome complexity and evolution of picornaviruses. IMPORTANCE Monopartite viruses in the order Picornavirales exhibit distinct genome arrangement of nonstructural proteins and structural proteins for each of the 8 families. Recent studies indicated that at least 4 ifla-like viruses possessed reversed genome organization in the family Iflaviridae, raising the possibility that this phenomenon may commonly present in different families of picornaviruses. Since we discovered 2 iflaviruses with exchanged structural and nonstructural proteins simultaneously in the damselfly, a systematic screening was subsequently performed for all of the current available picornaviruses (1,543 candidates). The results revealed 10 picornaviruses with reversed genome organization in the family Iflaviridae, implying that this phenomenon might prevalence in the order Picornavirales. These results will contribute to a better understanding for the future study on the genome complexity and taxonomy of picornaviruses.

Complete genome sequence of a new virus from Allium sativum L in China.

The complete genome of a new virus belonging to the family Betaflexiviridae was identified in garlic and sequenced by next-generation sequencing and reverse transcription PCR. The complete RNA genome (GenBank accession number OP021693) is 8191 nucleotides in length, excluding the 3' poly(A) tail, and contains five open reading frames (ORFs). These open reading frames encode the viral replicase, triple gene block, and coat protein, and the genome organization is typical of members of the subfamily Quinvirinae. The virus has been tentatively named "garlic yellow curl virus" (GYCV). Phylogenetic analysis suggested that it represents an independent evolutionary lineage in the subfamily, clustering with the currently unclassified garlic yellow mosaic associated virus (GYMaV) and peony betaflexivirus 1 (PeV1). Differences between the phylogenies inferred for the replicase and coat protein indicate that the new virus does not belong to any established genus of the family Betaflexiviridae. This is the first report of GYCV in China.

A novel hybrid learning paradigm with feature extraction for carbon price prediction based on Bi-directional long short-term memory network optimized by an improved sparrow search algorithm.

An efficient carbon trading market can effectively curb excessive carbon emissions and thus slow down the pace of global warming, which heightens the necessity of improving the accuracy of carbon price forecasting. In order to overcome the weakness of previous prediction model that always trained data in one-way neural networks and propagated the data sequentially, this paper proposes a novel hybrid learning paradigm WPD-ISSA-BiLSTM combining wavelet packet decomposition (WPD), improved sparrow search algorithm (ISSA), and Bi-directional long short-term memory network for deep feature exploration of carbon prices. Firstly, WPD decomposes and reconstructs the original carbon price series into several independent subseries. Then, the input features of the all subseries are filtered with random forest to select the best input features for the prediction model. Finally, a Bi-directional long short-term memory network optimized by the ISSA is employed to deeply delineate the intrinsic evolutionary trends of carbon prices, and the prediction results of all subseries are superimposed on each other to obtain the final carbon price prediction results. The actual carbon emission trading prices are collected as input to the model, and the experimental results show that the RMSE values of the proposed model are 0.2516 and 0.2962 under the mild and severe volatility scenarios, respectively. The proposed model has superiority and robustness compared to the comparison model and several existing models and better understands the intrinsic correlation between historical carbon price data. The results of this study can provide meaningful references for the carbon market development and emission reduction pathways.