RESUMEN
AIMS: Growing evidence suggests that an imbalanced gut microbiota composition plays a crucial role in the development of neuromyelitis optica spectrum disorders (NMOSD), an inflammatory demyelinating disease primarily affecting the optic nerves and central nervous system (CNS). In light of this, we explored the potential therapeutic benefits of GV-971 in NMOSD. GV-971 is a drug used for treating mild-to-moderate Alzheimer's disease, which targets the gut-brain axis and reduces neuroinflammation. METHODS: To evaluate GV-971's effects, we employed the experimental autoimmune encephalomyelitis (EAE) mouse model to establish NMOSD animal models. This was achieved by injecting NMO-IgG into aged mice (11 months old) or using NMO-IgG along with complement injection and microbubble-enhanced low-frequency ultrasound (MELFUS) techniques in young mice (7 weeks old). We assessed the impact of GV-971 on incidence rate, clinical scores, body weight, and survival, with methylprednisolone serving as a positive control. In NMOSD models of young mice, we analyzed spinal cord samples through H&E staining, immunohistochemistry, and Luxol Fast Blue staining. Fecal samples collected at different time points underwent 16S rRNA gene sequencing, while plasma samples were analyzed using cytokine array and untargeted metabolomics analysis. RESULTS: Our findings indicated that GV-971 significantly reduced the incidence of NMOSD, alleviated symptoms, and prolonged survival in NMOSD mouse models. The NMOSD model exhibited substantial neuroinflammation and injury, accompanied by imbalances in gut microbiota, peripheral inflammation, and metabolic disorders, suggesting a potentially vicious cycle that accelerates disease pathogenesis. Notably, GV-971 effectively reduces neuroinflammation and injury, and restores gut microbiota composition, as well as ameliorates peripheral inflammation and metabolic disorders. CONCLUSIONS: GV-971 attenuates the progression of NMOSD in murine models and reduces neuroinflammation and injury, likely through its effects on remodeling gut microbiota and peripheral inflammation and metabolic disorders.
Asunto(s)
Progresión de la Enfermedad , Encefalomielitis Autoinmune Experimental , Microbioma Gastrointestinal , Ratones Endogámicos C57BL , Neuromielitis Óptica , Animales , Neuromielitis Óptica/tratamiento farmacológico , Microbioma Gastrointestinal/efectos de los fármacos , Ratones , Encefalomielitis Autoinmune Experimental/tratamiento farmacológico , Encefalomielitis Autoinmune Experimental/patología , Femenino , Modelos Animales de EnfermedadRESUMEN
Sinomenine hydrochloride is an excellent drug with anti-inflammatory, antioxidant, immune-regulatory, and other functions. Atopic dermatitis is an inherited allergic inflammation that causes itchiness, redness, and swelling in the affected area, which can have a significant impact on the life of the patient. There are many therapeutic methods for atopic dermatitis, and sinomenine with immunomodulatory activity might be effective in the treatment of atopic dermatitis. In this study, the atopic dermatitis model was established in experimental mice, and physical experiments were carried out on the mice. In the experiment, sinomenine hydrochloride liposomes-in-hydrogel as a new preparation was selected for delivery. In this case, liposomes were dispersed in the colloidal hydrogel on a mesoscopic scale and could provide specific transfer properties. The results showed that the sinomenine hydrochloride-loaded liposomes-in-hydrogel system could effectively inhibit atopic dermatitis.
Asunto(s)
Antioxidantes , Dermatitis Atópica , Hidrogeles , Liposomas , Morfinanos , Morfinanos/farmacología , Morfinanos/química , Morfinanos/uso terapéutico , Dermatitis Atópica/tratamiento farmacológico , Dermatitis Atópica/patología , Liposomas/química , Animales , Ratones , Antioxidantes/farmacología , Antioxidantes/química , Antioxidantes/administración & dosificación , Hidrogeles/química , Modelos Animales de Enfermedad , Masculino , Ratones Endogámicos BALB CRESUMEN
BACKGROUND: Increasing evidence suggests that DXS253E is critical for cancer development and progression, but the function and potential mechanism of DXS253E in colorectal cancer (CRC) remain largely unknown. In this study, we evaluated the clinical significance and explored the underlying mechanism of DXS253E in CRC. METHODS: DXS253E expression in cancer tissues was investigated using the Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. The Kaplan-Meier plot was used to assess the prognosis of DXS253E. The cBioPortal, MethSurv, and Tumor Immune Estimation Resource (TIMER) databases were employed to analyze the mutation profile, methylation, and immune infiltration associated with DXS253E. The biological functions of DXS253E in CRC cells were determined by CCK-8 assay, plate cloning assay, Transwell assay, flow cytometry, lactate assay, western blot, and qRT-PCR. RESULTS: DXS253E was upregulated in CRC tissues and high DXS253E expression levels were correlated with poor survival in CRC patients. Our bioinformatics analyses showed that high DXS253E gene methylation levels were associated with the favorable prognosis of CRC patients. Furthermore, DXS253E levels were linked to the expression levels of several immunomodulatory genes and an abundance of immune cells. Mechanistically, the overexpression of DXS253E enhanced proliferation, migration, invasion, and the aerobic glycolysis of CRC cells through the AKT/mTOR pathway. CONCLUSIONS: We demonstrated that DXS253E functions as a potential role in CRC progression and may serve as an indicator of outcomes and a therapeutic target for regulating the AKT/mTOR pathway in CRC.
RESUMEN
Heart failure is the prevalent complication of acute myocardial infarction. We aim to identify a biomarker for heart failure post-acute myocardial infarction. This observational study includes 1062 and 1043 patients with acute myocardial infarction in the discovery and validation cohorts, respectively. The outcomes are in-hospital and long-term heart failure events. S100A8/A9 is screened out through proteomic analysis, and elevated circulating S100A8/A9 is independently associated with heart failure in discovery and validation cohorts. Furthermore, the predictive value of S100A8/A9 is superior to the traditional biomarkers, and the addition of S100A8/A9 improves the risk estimation using traditional risk factors. We finally report causal effect of S100A8/A9 on heart failure in three independent cohorts using Mendelian randomization approach. Here, we show that S100A8/A9 is a predictor and potentially causal medicator for heart failure post-acute myocardial infarction.
Asunto(s)
Insuficiencia Cardíaca , Infarto del Miocardio , Humanos , Calgranulina B , Pronóstico , Proteómica , Calgranulina A/genética , Infarto del Miocardio/complicaciones , Insuficiencia Cardíaca/etiología , Biomarcadores , SíndromeRESUMEN
BACKGROUND: Myelin oligodendrocyte glycoprotein antibody-associated disease (MOGAD) is considered a demyelinating disease of the central nervous system, but an increasing number of encephalitis cases associated with MOG antibodies have been reported recently. METHODS: This was a single-center, retrospective study. All data for pediatric patients with MOGAD diagnosed at Beijing Children's Hospital from January 2017 to January 2022 were collected. Clinical characteristics and outcomes were analyzed, and treatment responses were compared between the rituximab (RTX) and mycophenolate mofetil (MMF) groups. RESULTS: A total of 190 patients (age range: 5 months to 16 years; median age: 7.2 years; females: 97) were included in this study. The phenotypes of the first attack included acquired demyelinating syndromes (105 [55%]), encephalitis other than acute disseminated encephalomyelitis (82 [43%]), and isolated meningitis (3 [2%]). After a median follow-up of 30.4 months (interquartile range: 14.8-43.7), 64 (34%) patients had relapses. Fifty-one of the 64 (80%) patients who had relapse received maintenance therapy, including MMF (41), RTX (11), maintenance intravenous immunoglobulin (two), and tocilizumab (two). The annualized relapse rates decreased significantly after treatment in both the RTX and MMF cohorts (P < 0.05); however, there were no significant differences between the two groups (P = 0.56). A total of 178 (94%) patients had complete (175 patients) or almost complete (three patients) recovery (modified Rankin scale [mRS] < 2), and 12 had moderate to severe deficits (mRS ≥ 2). CONCLUSIONS: The spectrum of pediatric MOGAD is broader than previously reported and includes demyelinating syndromes and encephalitis. Encephalitis is an important initial phenotype observed in pediatric patients with MOGAD.
Asunto(s)
Autoanticuerpos , Encefalitis , Femenino , Humanos , Niño , Lactante , Estudios de Cohortes , Glicoproteína Mielina-Oligodendrócito , Estudios Retrospectivos , Encefalitis/tratamiento farmacológico , Rituximab/uso terapéutico , Recurrencia , Ácido MicofenólicoRESUMEN
BACKGROUND: Resting heart rate (RHR) during hospitalization has been shown to be associated with adverse outcomes in patients with myocardial infarction (MI). This study aimed to evaluate the long-term prognostic effect of RHR during the stable phase after MI in post-MI patients. METHODS: Patients who had prior or new-onset MI and RHR measurements during the stable period after MI between 2006 and 2018 in the community-based Kailuan Study were enrolled. RHR was divided into four groups based on quartiles. Cox regression analysis was used to analyze the association of RHR with primary composite outcome of all-cause death, hospitalization for heart failure (HF), stroke, and recurrent MI and its components. RESULTS: A total of 4447 post-MI patients were included. During a median follow-up of 7.5 years, 1813 patients (40.8%) developed primary outcomes. Compared to RHR ≤67 bpm, patients with 72 < RHR ≤80 bpm and RHR >80 bpm had increased risks of primary outcome, with adjusted hazard ratios (95% confidence intervals) of 1.23 (1.08-1.40) and 1.35 (1.18-1.55), respectively. The risk of primary outcome increased by 12% (1.07-1.17) for each 10-bpm increase in RHR. Similar results were observed in all-cause death and hospitalization for HF. Restricted cubic splines revealed a linear relationship between RHR and primary outcome, all-cause death, and hospitalization for HF (P for nonlinearity >0.05). CONCLUSIONS: RHR during the stable phase after MI was an independent predictor for primary outcome and all-cause death in post-MI patients, and RHR >72 bpm was associated with increased risk for primary outcome and all-cause death.
Asunto(s)
Insuficiencia Cardíaca , Infarto del Miocardio , Humanos , Estudios de Cohortes , Estudios Prospectivos , Frecuencia Cardíaca/fisiología , Infarto del Miocardio/diagnóstico , Pronóstico , Insuficiencia Cardíaca/diagnóstico , Síndrome , Factores de RiesgoRESUMEN
Protein tyrosine phosphatase receptor type O (PTPRO) plays an important role in inflammation-related pathways and has become an emerging drug target. In this study, we developed an in-line capillary electrophoresis (CE) method for the investigation of the enzymatic activity of PTPRO, which was based on electrophoretically mediated microanalysis (EMMA). After a thorough method validation of the optimized conditions, this protocol was successfully employed to determine the kinetics of PTPRO as well as the half-maximal inhibitory concentration (IC50) of two typical PTPRO inhibitors. The final results were consistent with the values obtained through classical ultraviolet-visible (UV-vis) spectrophotometry. Our new method exhibited improved accuracy and reduced consumption, avoiding the disadvantages of traditional methods. This work provides a new strategy for PTPRO enzyme kinetic studies as well as inhibitory activity determination through capillary electrophoresis for the first time.
Asunto(s)
Electroforesis Capilar , Ensayos Analíticos de Alto Rendimiento , Cinética , Electroforesis Capilar/métodos , Inhibidores Enzimáticos/farmacología , Proteínas Tirosina FosfatasasRESUMEN
Pulmonary fibrosis is a chronic and progressive lung disease with high mortality. This study aims to explore the protective mechanism of quercetin against pulmonary fibrosis regarding cell senescence and gut microbiota. Rats were intratracheally injected with bleomycin (BLM) to establish a pulmonary fibrosis rat model. RLE-6TN cells were stimulated with BLM to build the model of alveolar epithelial cell senescence, and RLE-6TN-derived conditional medium (CM) was harvested to further culture fibroblasts. Histopathological changes were assessed by H&E and Masson staining. α-SMA expression was assessed by immunofluorescence assay. Senescence-associated ß-galactosidase (SA-ß-gal) staining and senescence-associated secretory phenotype (SASP) cytokine assay were conducted to assess cellular senescence. Gut microbiota was analyzed by 16S rRNA gene sequencing. The fibrosis-, senescence-, and PTEN/PI3K/AKT signaling-related proteins were examined by western blot. In BLM-induced pulmonary fibrosis rats, quercetin exerted its protective effects by reducing histological injury and collagen deposition, lessening cellular senescence, and regulating gut microbiota. In BLM-induced alveolar epithelial cell senescence, quercetin inhibited senescence, lessened SASP cytokine secretion of alveolar epithelial cells, and further ameliorated collagen deposition in fibroblasts. In addition, quercetin might exert its functional effects by regulating the PTEN/PI3K/AKT signaling pathway. Moreover, quercetin regulated intestinal dysbacteriosis in BLM-induced pulmonary fibrosis rats, especially boosting the abundance of Akkermansia. To conclude, our findings provide an in-depth understanding of the potential mechanism behind the protective role of quercetin against pulmonary fibrosis.
Asunto(s)
Células Epiteliales Alveolares , Bleomicina , Senescencia Celular , Disbiosis , Microbioma Gastrointestinal , Fosfohidrolasa PTEN , Fosfatidilinositol 3-Quinasas , Proteínas Proto-Oncogénicas c-akt , Fibrosis Pulmonar , Quercetina , Transducción de Señal , Animales , Quercetina/farmacología , Senescencia Celular/efectos de los fármacos , Proteínas Proto-Oncogénicas c-akt/metabolismo , Fibrosis Pulmonar/metabolismo , Fibrosis Pulmonar/tratamiento farmacológico , Fibrosis Pulmonar/patología , Fibrosis Pulmonar/inducido químicamente , Fibrosis Pulmonar/prevención & control , Transducción de Señal/efectos de los fármacos , Fosfohidrolasa PTEN/metabolismo , Masculino , Bleomicina/toxicidad , Ratas , Fosfatidilinositol 3-Quinasas/metabolismo , Microbioma Gastrointestinal/efectos de los fármacos , Células Epiteliales Alveolares/efectos de los fármacos , Células Epiteliales Alveolares/metabolismo , Células Epiteliales Alveolares/patología , Ratas Sprague-Dawley , Línea Celular , Modelos Animales de EnfermedadRESUMEN
Glioblastoma (GBM) is the most common and aggressive malignant brain tumor in adults and is poorly controlled. Previous studies have shown that both macrophages and angiogenesis play significant roles in GBM progression, and co-targeting of CSF1R and VEGFR is likely to be an effective strategy for GBM treatment. Therefore, this study developed a novel and selective inhibitor of CSF1R and VEGFR, SYHA1813, possessing potent antitumor activity against GBM. SYHA1813 inhibited VEGFR and CSF1R kinase activities with high potency and selectivity and thus blocked the cell viability of HUVECs and macrophages and exhibited anti-angiogenetic effects both in vitro and in vivo. SYHA1813 also displayed potent in vivo antitumor activity against GBM in immune-competent and immune-deficient mouse models, including temozolomide (TMZ) insensitive tumors. Notably, SYHA1813 could penetrate the blood-brain barrier (BBB) and prolong the survival time of mice bearing intracranial GBM xenografts. Moreover, SYHA1813 treatment resulted in a synergistic antitumor efficacy in combination with the PD-1 antibody. As a clinical proof of concept, SYHA1813 achieved confirmed responses in patients with recurrent GBM in an ongoing first-in-human phase I trial. The data of this study support the rationale for an ongoing phase I clinical study (ChiCTR2100045380).
RESUMEN
Anastomotic leakage (AL), one of the most severe complications in rectal surgery, is often diagnosed late because of the low specificity of the clinical symptoms and limitations of current clinical investigations. Identification of patients with early AL remains challenging. Here, we explored the protein expression profiles of AL patients to provide potential biomarkers to identify AL in patients who undergo surgery for rectal cancer. We screened differentially expressed proteins (DEPs) in drainage fluid from AL and non-AL patients using a tandem mass tag method. A total of 248 DEPs, including 98 upregulated and 150 downregulated proteins, were identified between AL and non-AL groups. Gene ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses suggested that DEPs were enriched in neutrophil degranulation, bacterial infection, proteolysis, hemostasis, and complement and coagulation cascades. The results of enzyme-linked immunosorbent assay validated that the expression of the top three upregulated DEPs, AMY2A, RETN, and CELA3A, was significantly increased in the drainage fluid of AL patients, compared with that of non-AL patients (AMY2A, P = 0.001; RETN, P < 0.0001; and CELA3A, P = 0.023). Thus, our findings provide several potential biomarkers for the early diagnosis of AL after rectal cancer resection.
Asunto(s)
Fuga Anastomótica , Neoplasias del Recto , Humanos , Fuga Anastomótica/diagnóstico , Fuga Anastomótica/etiología , Fuga Anastomótica/cirugía , Proteómica , Detección Precoz del Cáncer , Neoplasias del Recto/cirugía , Neoplasias del Recto/complicaciones , Drenaje/efectos adversos , Drenaje/métodos , BiomarcadoresRESUMEN
Neutral lipid-storage disease with myopathy (NLSDM) is an autosomal recessive neuromuscular disorder caused by mutations in PNPLA2, and the average age at onset is 30 years. To date, only eight patients with childhood-onset NLSDM have been reported in detail. We investigated 3 unreported patients with NLSDM detected in childhood and reviewed 8 childhood-onset and 82 adult-onset patients with NLSDM documented in the literature. In the childhood-onset cohort, NLSDM presented initially as asymptomatic or paucisymptomatic hyperCKemia in 6/11 patients, and follow-up data showed onset of muscle weakness in 6/11 childhood-onset patients. In the adult-onset cohort, 95.1% (78/82) of patients showed muscle weakness. Cardiac involvement developed in 6/11 childhood-onset patients. Hepatomegaly was observed in 3/11 childhood-onset patients. Serum creatine kinase levels were elevated greater than five-fold of the upper limit of normal (ULN) in most childhood-onset patients and were elevated to less than ten-fold of the ULN in most adult-onset patients. Peripheral blood smears and muscle biopsies showed cytoplasmic lipid droplets in leukocytes and myocytes. NLSDM can present in children with asymptomatic or paucisymptomatic hyperCKemia before the onset of muscle weakness. The presence of lipid droplets in leucocytes (Jordans' anomaly) aids in diagnosing and confirming the pathogenicity of PNPLA2 variants of uncertain significance. There were no clear genotype-phenotype correlations in patients with NLSDM.
Asunto(s)
Errores Innatos del Metabolismo Lipídico , Enfermedades Musculares , Adulto , Niño , Humanos , Enfermedades Musculares/diagnóstico , Enfermedades Musculares/genética , Debilidad Muscular , Errores Innatos del Metabolismo Lipídico/diagnóstico , Errores Innatos del Metabolismo Lipídico/genéticaRESUMEN
Poly(ADP-ribose) polymerase 1 (PARP1) inhibitors can selectively kill homologous recombination (HR) deficient cancer cells and elicit anticancer effect through a mechanism of synthetic lethality. In this study, we designed, synthesized and pharmacologically evaluated a series of [1,2,4]triazolo[4,3-a]pyrazine derivatives as a class of potent PARP1 inhibitors. Among them, compounds 17m, 19a, 19c, 19e, 19i and 19k not only displayed more potent inhibitory activities (IC50s < 4.1 nM) than 9 and 1 against PARP1, but also exhibited nanomolar range of antiproliferative effects against MDA-MB-436 (BRCA1-/-, IC50s < 1.9 nM) and Capan-1 (BRCA2-/-, IC50s < 21.6 nM) cells. Notably, 19k significantly inhibited proliferation of resistant Capan-1 cells (IC50s < 0.3 nM). Collectively, the newly discovered PARP1 inhibitors act as a useful pharmacological tool for investigating the mechanism of acquired resistance to PARP1 inhibitors, and may also represent promising therapeutic agents for the treatment of HR deficient cancers with the potential to overcome the acquired resistance.
Asunto(s)
Neoplasias , Inhibidores de Poli(ADP-Ribosa) Polimerasas , Humanos , Inhibidores de Poli(ADP-Ribosa) Polimerasas/farmacología , Inhibidores de Poli(ADP-Ribosa) Polimerasas/uso terapéutico , Poli(ADP-Ribosa) Polimerasa-1 , Neoplasias/tratamiento farmacológico , Recombinación Homóloga , Línea Celular TumoralRESUMEN
The inhibition of histone deacetylases (HDACs) has been considered a promising therapeutic strategy for treatment of many diseases, especially cancer. In the current study, a series of 8-substituted quinoline-2-carboxamide derivatives were designed and synthesized as potent HDAC inhibitors. The most potent compound 21 g (IC50 = 0.050 µM) exhibited 3-fold greater HDAC inhibitory activity compared to the known HDAC inhibitor Vorinostat (IC50 = 0.137 µM). Additionally, compound 21g exhibited low toxicity against normal cells(IC50 in HUVEC cell > 50 µM) and showed good liver microsomal stability, therefore, may serve as a new lead compound for further development.
Asunto(s)
Antineoplásicos , Hidroxiquinolinas , Quinolinas , Inhibidores de Histona Desacetilasas/farmacología , Línea Celular Tumoral , Antineoplásicos/farmacología , Histona Desacetilasas/metabolismo , Diseño de Fármacos , Simulación del Acoplamiento Molecular , Hidroxiquinolinas/farmacología , Quinolinas/farmacología , Proliferación Celular , Relación Estructura-Actividad , Histona Desacetilasa 1RESUMEN
Poly-ADP-ribose polymerase (PARP) inhibitors (PARPi) have shown great promise for treating BRCA-deficient tumors. However, over 40% of BRCA-deficient patients fail to respond to PARPi. Here, we report that thioparib, a next-generation PARPi with high affinity against multiple PARPs, including PARP1, PARP2, and PARP7, displays high antitumor activities against PARPi-sensitive and -resistant cells with homologous recombination (HR) deficiency both in vitro and in vivo. Thioparib treatment elicited PARP1-dependent DNA damage and replication stress, causing S-phase arrest and apoptosis. Conversely, thioparib strongly inhibited HR-mediated DNA repair while increasing RAD51 foci formation. Notably, the on-target inhibition of PARP7 by thioparib-activated STING/TBK1-dependent phosphorylation of STAT1, triggered a strong induction of type I interferons (IFNs), and resulted in tumor growth retardation in an immunocompetent mouse model. However, the inhibitory effect of thioparib on tumor growth was more pronounced in PARP1 knockout mice, suggesting that a specific PARP7 inhibitor, rather than a pan inhibitor such as thioparib, would be more relevant for clinical applications. Finally, genome-scale CRISPR screening identified PARP1 and MCRS1 as genes capable of modulating thioparib sensitivity. Taken together, thioparib, a next-generation PARPi acting on both DNA damage response and antitumor immunity, serves as a therapeutic potential for treating hyperactive HR tumors, including those resistant to earlier-generation PARPi.
Asunto(s)
Interferón Tipo I , Neoplasias , Animales , Ratones , Línea Celular Tumoral , Reparación del ADN , Recombinación Homóloga , Interferón Tipo I/genética , Interferón Tipo I/uso terapéutico , Neoplasias/genética , Ftalazinas/farmacología , Inhibidores de Poli(ADP-Ribosa) Polimerasas/farmacología , Reparación del ADN por Recombinación , Proteínas de Unión al ARN/genética , Resistencia a AntineoplásicosRESUMEN
Rheumatoid arthritis (RA) is a chronic degenerative disease characterized by persistent systemic synovitis, with a high risk of stiffness, pain, and swelling. It may affect the other extra-articular tissues. There is no ideal treatment for this disease at present, and it can only be controlled by medication to alleviate the prognosis. Exosomes are small vesicles secreted by various cells in the organism under normal or pathological conditions, and play a role in immune response, antigen presentation, cell migration, cell differentiation, tumor invasion and so on. Due to the adverse effects of conventional drugs and treatments in the treatment of RA, exosomes, as a nanocarrier with many advantages, can have a great impact on the loading of drugs for the treatment of RA. This article reviews the role of exosomes in the pathogenesis of RA and the progress of exosome-based therapy for RA.
Asunto(s)
Artritis Reumatoide , Exosomas , Sinovitis , Humanos , Artritis Reumatoide/diagnóstico , Artritis Reumatoide/tratamiento farmacológico , Sinovitis/diagnóstico , PronósticoRESUMEN
As a potent zinc chelator, hydroxamic acid has been applied in the design of inhibitors of zinc metalloenzyme, such as histone deacetylases (HDACs). A series of hydroxamic acids with HDAC inhibitory activities were subjected to the QSRR (Quantitative Structure-Retention Relationships) study. Experimental data in combination with calculated molecular descriptors were used for the development of the QSRR model. Specially, we employed PCA (principal component analysis) to accomplish dimension reduction of descriptors and utilized the principal components of compounds (16 training compounds, 4 validation compounds and 7 test compounds) to execute GA (genetic algorithm)-BP (error backpropagation) algorithm. We performed double cross-validation approach for obtaining a more convincing model. Moreover, we introduced molecular interaction-based features (molecular docking scores) as a new type of molecular descriptor to represent the interactions between analytes and the mobile phase. Our results indicated that the incorporation of molecular interaction-based features significantly improved the accuracy of the QSRR model, (R2 value is 0.842, RMSEP value is 0.440, and MAE value is 0.573). Our study not only developed QSRR model for the prediction of the retention time of hydroxamic acid in HPLC but also proved the feasibility of using molecular interaction-based features as molecular descriptors.
RESUMEN
Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.
RESUMEN
We initially described two children who developed Guillain-Barré syndrome (GBS) complicated by rhabdomyolysis (RML), and reviewed five adult patients from the literature. Through analysis of the clinical features, laboratory examination, treatment and prognostic data from these seven patients, we found that when GBS "meets" RML, the most prominent characteristics were the following: male dominance; limb weakness, pain and respiratory failure could be caused by multiple factors; limb weakness and respiratory muscle paralysis were more serious than with GBS alone; and the probability of mechanical ventilation was increased. Neuroelectrophysiological studies revealed axonal lesions. Close monitoring and timely identification and intervention to remedy potentially fatal complications such as electrolyte disorder multisystem complications and kidney injury are crucial. With plasma exchange, peritoneal dialysis and supportive treatment, the long-term outcome of most patients was satisfactory.
RESUMEN
Both Src homology-2 domain-containing phosphatase 2 (SHP2) and histone deacetylase (HDAC) are important oncoproteins and potential immunomodulators. In this study, we first observed a synergistic antiproliferation effect of an allosteric SHP2 inhibitor (SHP099) and HDAC inhibitor (SAHA) in MV4-11 cells. Inspired by this result, a series of SHP2/HDAC dual inhibitors were designed based on the pharmacophore fusion strategy. Among these inhibitors, the most potent compound 8t showed excellent inhibitory activities against SHP2 (IC50 = 20.4 nM) and HDAC1 (IC50 = 25.3 nM). In particular, compound 8t exhibited improved antitumor activities compared with those of SHP099 and SAHA in vitro and in vivo. Our study also indicated that treatment with 8t could trigger efficient antitumor immunity by activating T cells, enhancing the antigen presentation function and promoting cytokine secretion. To our knowledge, we report the first small molecular SHP2/HDAC dual inhibitor and demonstrate a new strategy for cancer immunotherapy.
Asunto(s)
Antineoplásicos , Inhibidores de Histona Desacetilasas , Antineoplásicos/farmacología , Antineoplásicos/uso terapéutico , Línea Celular Tumoral , Proliferación Celular , Citocinas/farmacología , Ensayos de Selección de Medicamentos Antitumorales , Inhibidores de Histona Desacetilasas/farmacología , Inhibidores de Histona Desacetilasas/uso terapéutico , Histona Desacetilasas/metabolismo , Humanos , Monoéster Fosfórico Hidrolasas , Piperidinas , Pirimidinas , VorinostatRESUMEN
A new negative-strand RNA (nsRNA) virus genome was discovered in Edgeworthia chrysantha Lindl. This virus, tentatively named "Edgeworthia chrysantha mosaic-associated virus" (ECMaV), has a bipartite genome that comprises (i) a nsRNA1, encoding the viral RNA-dependent RNA polymerase (RdRp), and (ii) an ambisense RNA2, coding for the putative movement protein (MP) and nucleocapsid protein (NP), with the open reading frames separated by a long AU-rich intergenic region (IR). Sequence comparisons and phylogenetic analysis showed that the RdRp is closely related to those of other recently discovered plant-infecting nsRNA viruses in the new genus Coguvirus and that ECMaV can be classified as a member of a novel species.