Predicting pKa Values of Para-Substituted Aniline Radical Cations vs. Stable Anilinium Ions in Aqueous Media.

The focus of pKa calculations has primarily been on stable molecules, with limited studies comparing radical cations and stable cations. In this study, we comprehensively investigate models with implicit solvent and explicit water molecules, direct and indirect calculation approaches, as well as methods for calculating free energy, solvation energy, and quasi-harmonic oscillator approximation for para-substituted aniline radical cations (R-PhNH2•+) and anilinium cations (R-PhNH3+) in the aqueous phase. Properly including and positioning explicit H2O molecules in the models is important for reliable pKa predictions. For R-PhNH2•+, precise pKa values were obtained using models with one or two explicit H2O molecules, resulting in a root mean square error (RMSE) of 0.563 and 0.384, respectively, for both the CBS-QB3 and M062X(D3)/ma-def2QZVP methods. Further improvement was achieved by adding H2O near oxygen-containing substituents, leading to the lowest RMSE of 0.310. Predicting pKa values for R-PhNH3+ was more challenging. CBS-QB3 provided an RMSE of 0.349 and the M062X(D3)/ma-def2QZVP method failed to calculate pKa accurately (RMSE > 1). However, by adopting the double-hybrid functional method and adding H2O near the R substituent group, the calculations were significantly improved with an average absolute difference (ΔpKa) of 0.357 between the calculated and experimental pKa values. Our study offers efficient and reliable methods for pKa calculations of R-PhNH2•+ (especially) and R-PhNH3+ based on currently mature quantum chemistry software.

The toxicity of cisplatin derives from effects on renal organic ion transporters expression and serum endogenous substance levels.

Acute kidney injury (AKI) is a worldwide public health problem with high morbidity and mortality. Cisplatin is a widely used chemotherapeutic agent for treating solid tumors, but the induction of AKI restricts its clinical application. In this study, the effect of cisplatin on the expression of organic ion transporters was investigated through in vivo and in vitro experiments. Targeted metabolomics techniques were used to measure the levels of selected endogenous substances in serum. Transmission electron microscopy was used to observe the microstructure of renal tubular epithelial cells. Our results show that the toxicity of cisplatin on HK-2 cells or HEK-293 cells was time- and dose-dependent. Administration of cisplatin decreased the expression of OAT1/3 and OCT2 and increased the expression of MRP2/4. Mitochondrial damage induced by cisplatin lead to renal tubular epithelial cell injury. In addition, administration of cisplatin resulted in significant changes in endogenous substance levels in serum, including amino acids, carnitine, and fatty acids. These serum amino acids and metabolites (α-aminobutyric acid, proline, and alanine), carnitines (tradecanoylcarnitine, hexanylcarnitine, octanoylcarnitine, 2-methylbutyroylcarnitine, palmitoylcarnitine, and linoleylcarnitine) and fatty acids (9E-tetradecenoic acid) represent endogenous substances with diagnostic potential for cisplatin-induced AKI.

[Protective effects and mechanisms of berberine hydrochloride on intestinal mucosal barrier injury in rats with sepsis].

OBJECTIVE: To investigate the protective effect of berberine hydrochloride on intestinal mucosal barrier damage in sepsis rats and its mechanism. METHODS: Forty-eight male SD rats were divided into a control group (Sham group, 6 cases), a sepsis model group (LPS group, 14 cases), a berberine hydrochloride intervention group (Ber group, 14 cases), and a Notch signaling pathway inhibition group (DAPT group, 14 cases) according to random number table method. The DAPT group was intraperitoneally injected with 5 mg/kg Notch signaling pathway inhibition DAPT 2 hours before modeling. The sepsis model was established by intraperitoneal injection of 10 mg/kg lipopolysaccharide (LPS); Sham group was injected with an equal amount of saline (2 mL). The Ber group and DAPT group were treated with gavage of 50 mg/kg berberine hydrochloride 2 hours after modeling; Sham group and LPS group were treated with gavage of an equal amount of saline (2 mL). The temperature, weight, behavior and survival rate of rats were observed at 0, 6, 12 and 24 hours of modeling. After 24 hours of modeling, abdominal aortic blood was collected under anesthesia, and intestinal tissues were obtained after euthanasia. The pathological changes of ileum were observed under light microscope. The ultrastructure of ileum was observed under transmission electron microscope. Enzyme linked immunosorbent assay (ELISA) was used to detect the levels of serum diamine oxidase (DAO), intestinal fatty acid binding protein (iFABP), tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6). Real time-polymerase chain reaction (RT-PCR) and Western blotting were used to detect the mRNA and protein expressions of tight junction proteins (Occludin and Claudin1), Notch1 and their downstream target signals in the ileum tissue. RESULTS: After 24 hours of modeling, compared with the Sham group, the LPS group, Ber group, and DAPT group showed a decrease in weight and an increase in temperature. Among them, the LPS group showed the most significant changes, followed by the DAPT group, and the Ber group showed the least significant changes. The survival rates of the LPS group, Ber group, and DAPT group were all lower than those of the Sham group [42.9% (6/14), 57.1% (8/14), 57.1% (8/14) vs. 100% (6/6)], and six rats were taken from each group for subsequent testing. Macroscopic observation of the intestine showed that the LPS group had the most severe edema in the ileum tissue and abdominal bleeding, with significant improvement in the Ber group and followed by the DAPT group. Under the light microscope, the LPS group showed disordered arrangement of glandular tissue in the ileum mucosa, significantly reduced goblet cells, and extensive infiltration of inflammatory cells, which were significantly improved in the Ber group but less improved in the DAPT group. Under electron microscopy, the LPS group showed extensive shedding of ileal microvilli and severe damage to the tight junction complex structure of intestinal epithelial cells, which was significantly improved in the Ber group but less improved in the DAPT group. The levels of serum DAO, iFABP, TNF-α, IL-6 in the LPS group were significantly higher than those in the Sham group, while the above indicators in the Ber group were significantly lower than those in the LPS group [DAO (µg/L): 4.94±0.44 vs. 6.53±0.49, iFABP (ng/L): 709.67±176.97 vs. 1 417.71±431.44, TNF-α (ng/L): 74.70±8.15 vs. 110.36±3.51, IL-6 (ng/L): 77.34±9.80 vs. 101.65±6.92, all P < 0.01], while the above indicators in the DAPT group were significantly higher than those in the Ber group. The results of RT-PCR and Western blotting showed that the mRNA and protein expressions of Occludin, Claudin1, Notch1, and Hes1 in the ileum tissue of LPS group rats were decreased compared to the Sham group, which were significantly increased in the Ber group compared with the LPS group [mRNA expression: Occludin mRNA (2-ΔΔCt): 1.61±0.74 vs. 0.30±0.12, Claudin1 mRNA (2-ΔΔCt): 1.97±0.37 vs. 0.58±0.14, Notch1 mRNA (2-ΔΔCt): 1.29±0.29 vs. 0.36±0.10, Hes1 mRNA (2-ΔΔCt): 1.22±0.39 vs. 0.27±0.04; protein expression: Occludin/GAPDH: 1.17±0.14 vs. 0.74±0.04, Claudin1/GAPDH: 1.14±0.06 vs. 0.58±0.10, Notch1/GAPDH: 0.87±0.11 vs. 0.56±0.09, Hes1/GAPDH: 1.02±0.13 vs. 0.62±0.01; all P < 0.05], while those in the DAPT group were significantly lower than those in the Ber group. CONCLUSIONS: Early use of berberine hydrochloride can significantly improve intestinal mucosal barrier damage in sepsis rats, and its mechanism may be related to inhibiting inflammatory response and regulating the expression of intestinal mechanical barrier tight junction protein through Notch1 signal.

Effects of tracking linkage self-management mode on the compliance of prenatal examinations and delivery modes in primiparas.

To explore the effects of tracking linkage self-management mode on the compliance of prenatal examinations and delivery modes in primiparas. A total of 270 primiparas undergoing prenatal examinations in Shijiazhuang Obstetrics and Gynecology Hospital were enrolled for prospective study between January 2021 and January 2022. They were divided into control group and observation group, 135 cases in each group. The control group was given routine management mode, while observation group was given tracking linkage self-management mode. All were intervened till discharge. The compliance (time and frequency of prenatal examinations), cognition of prenatal examinations, score of exercise of self-care agency scale, self-rating anxiety scale and self-rating depression scale, delivery modes and the occurrence of neonatal adverse outcomes were compared between the 2 groups. After intervention, total compliance rate of prenatal examinations in observation group was higher than that in control group (84.44% vs 72.59%) (P < .05). The scores of pregnancy care, genetic diseases counseling, prevention of birth defects and reasonable nutrition during pregnancy in observation group were higher than those in control group (P < .05), scores of health cognition, self-care skills, self-care responsibility and self-concept were higher than those in control group (P < .05), scores of self-rating anxiety scale and self-rating depression scale were lower than those in control group (P < .05), natural delivery rate was higher than that in control group (85.93% vs 74.81%) (P < .05), and incidence of neonatal adverse outcomes was lower than that in control group (0.74% vs 5.93%) (Fisher exact probability = 0.036). The application of tracking linkage self-management mode can significantly improve cognition to prenatal examinations, improve compliance of prenatal examinations and self-care ability, relieve anxiety and depression, increase natural delivery rate and reduce the incidence of neonatal adverse outcomes in primiparas.

Arbuscular mycorrhizal fungi by inducing watermelon roots secretion phthalates, altering soil enzyme activity and bacterial community composition to alleviate the watermelon wilt.

BACKGROUND: Long-term continuous cropping has resulted in the frequent occurrence of fusarium wilt of watermelon (Citrullus lanatus). AMF inoculation can alleviate the continuous cropping barrier and reduce the incidence of fusarium wilt of watermelon. Our previous study found that the root exudates of mycorrhizal watermelon can enhance watermelon resistance to this disorder. It is necessary to further isolate and identify the specific compounds in root exudates of mycorrhizal watermelon and explore their control effects on fusarium wilt of continuous cropping watermelon. RESULT: The results of this study showed that the root system of watermelon seedlings inoculated with AMF (Funneliformis mosseae or Glomus versiforme) secreted diisooctyl phthalate (A) and dibutyl phthalate (B). Compared with water treatment, treatment with 0.1 ml/L (A1, B1), 0.5 ml/L (A2, B2) and 1 ml/L (A3, B3) of A or B significantly increased soil enzyme activities, the numbers of bacteria and actinomycetes, and the bacteria/fungi ratio in the rhizosphere. Furthermore, the Disease indexes (DI) of A1 and B3 were 25% and 20%, respectively, while the prevention and control effects (PCE) were 68.8% and 75%, respectively. In addition, diisooctyl phthalate or dibutyl phthalate increased the proportions of Gemmatimonadetes, Chloroflexi, and Acidobacteria in the rhizosphere of continuous cropping watermelon, and decreased the proportions of Proteobacteria and Firmicutes, with Novosphingobium, Kaistobacter, Bacillus, and Acinetobacter as the predominant bacteria. Compared with the water treatment, the abundance of Neosphingosaceae, Kateybacterium and Bacillus in the A1 group was increased by 7.33, 2.14 and 2.18 times, respectively, while that in the B2 group was increased by 60.05%, 80.24% and 1 time, respectively. In addition, exogenous diisooctyl phthalate and dibutyl phthalate were shown to promote growth parameters (vine length, stem diameter, fresh weight and dry weight) and antioxidant enzyme system activities (SOD, POD and CAT) of continuous cropping watermelon. CONCLUSION: Lower watermelon fusarium wilt incidence in mycorrhizal watermelons was associated with phthalate secretion in watermelons after AMF inoculation. Exogenous diisooctyl phthalate and dibutyl phthalate could alleviate the continuous cropping disorder of watermelon, reduce the incidence of fusarium wilt, and promote the growth of watermelon by increasing the enzyme activities and the proportion of beneficial bacteria in rhizosphere soil. In addition, the low concentration of phthalate diisooctyl and high concentration of phthalic acid dibutyl works best. Therefore, a certain concentration of phthalates in the soil can help alleviate continuous cropping obstacles.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Recruitment or activation of mast cells in the liver aggravates the accumulation of fibrosis in carbon tetrachloride-induced liver injury.

Liver diseases caused by viral infections, alcoholism, drugs, or chemical poisons are a significant health problem: Liver diseases are a leading contributor to mortality, with approximately 2 million deaths per year worldwide. Liver fibrosis, as a common liver disease characterized by excessive collagen deposition, is associated with high morbidity and mortality, and there is no effective treatment. Numerous studies have shown that the accumulation of mast cells (MCs) in the liver is closely associated with liver injury caused by a variety of factors. This study investigated the relationship between MCs and carbon tetrachloride (CCl4)-induced liver fibrosis in rats and the effects of the MC stabilizers sodium cromoglycate (SGC) and ketotifen (KET) on CCl4-induced liver fibrosis. The results showed that MCs were recruited or activated during CCl4-induced liver fibrosis. Coadministration of SCG or KET alleviated the liver fibrosis by decreasing SCF/c-kit expression, inhibiting the TGF-ß1/Smad2/3 pathway, depressing the HIF-1a/VEGF pathway, activating Nrf2/HO-1 pathway, and increasing the hepatic levels of GSH, GSH-Px, and GR, thereby reducing hepatic oxidative stress. Collectively, recruitment or activation of MCs is linked to liver fibrosis and the stabilization of MCs may provide a new approach to the prevention of liver fibrosis.

[Interaction between NOD-like receptor protein 3 inflammatory corpuscles and mitochondrial dysfunction in the pathogenesis of septic cardiomyopathy].

Septic cardiomyopathy (SCM) has a high incidence and complex pathogenesis, which can significantly increase the mortality of sepsis patients. NOD-like receptor protein 3 (NLRP3) inflammatory corpuscles play an important role in the pathogenesis of SCM. Mitochondrial dysfunction in cardiomyocytes is also one of the important pathogenesis of SCM. Activation of NLRP3 inflammatory corpuscles is closely related to mitochondrial dysfunction. The study of interaction mechanism between the two is helpful to find a new therapeutic scheme for SCM. This article reviews the interaction between NLRP3 inflammatory corpuscles and mitochondrial dysfunction in the pathogenesis of SCM, as well as the related mechanisms of traditional Chinese medicine (TCM) prevention and treatment of SCM, providing theoretical reference for further exploring therapeutic targets for SCM.

Cognitive behavioral stress management is an effective intervention to relieve anxiety and depression, improve the quality of life in patients with cervical cancer.

BACKGROUND: Cognitive behavioral stress management (CBSM) modifies individuals' maladaptive cognition and improves their ability in managing stress. The present study was to inquire about the utility of CBSM in mental health and quality of life in patients with cervical cancer. METHODS: Totally, 172 postoperative cervical cancer patients were randomly classified into CBSM (N=86) and normal care group (N=86) to receive 8-week CBSM and normal care, correspondingly. Self-rating anxiety/depression scale (SAS/SDS), EuroQol-5 dimensions (EQ-5D), EuroQol-visual analogue scale (EQ-VAS), and quality of life questionnaire-core 30 (QLQ-C30) scores were evaluated at discharge (M0), 1st month (M1), M3, and M6 after discharge. RESULTS: SAS scores at M6 (P=0.003), M1 (P=0.042), and M3 (P=0.010), and the proportion of patients with SAS-defined anxiety at M3 (P=0.040) and M6 (P=0.019) were reduced in CBSM group versus normal care group. SDS scores at M3 (P=0.020) and M6 (P=0.016), and the proportion of patients with SDS-defined depression at M6 (P=0.036) was descended in CBSM group versus normal care group. EQ-VAS score at M1 (P=0.044), M3 (P=0.014), and M6 (P=0.002) were increased, while EQ-5D score at M3 (P=0.030) was descended in CBSM group versus normal care group. Meanwhile, QLQ-C30 global health status score at M1 (P=0.046), M3 (P=0.037), and M6 (P=0.007), QLQ-C30 function score at M3 (P=0.033) and M6 (P=0.016) were ascended, but QLQ-C30 symptom score at M3 (P=0.042) was declined in CBSM group versus normal care group. CONCLUSION: CBSM is an effective intervention for decreasing anxiety and depression, and improving quality of life in patients with cervical cancer.

[Relationship between Notch signaling pathway and mitochondrial energy metabolism].

Notch signaling pathway is a highly conserved signaling pathway in the process of evolution. It is composed of three parts: Notch receptor, ligand and effector molecules responsible for intracellular signal transduction. It plays an important role in cell proliferation, differentiation, development, migration, apoptosis and other processes, and has a regulatory effect on tissue homeostasis and homeostasis. Mitochondria are the sites of oxidative metabolism in eukaryotes, where sugars, fats and proteins are finally oxidized to release energy. In recent years, the regulation of Notch signaling pathway on mitochondrial energy metabolism has attracted more and more attention. A large number of data have shown that Notch signaling pathway has a significant effect on mitochondrial energy metabolism, but the relationship between Notch signaling pathway and mitochondrial energy metabolism needs to be specifically and systematically discussed. In this paper, the relationship between Notch signaling pathway and mitochondrial energy metabolism is reviewed, in order to improve the understanding of them and provide new ideas for the treatment of related diseases.

Genetic variations in the DYNC2H1 gene causing SRTD3 (short-rib thoracic dysplasia 3 with or without polydactyly).

Background and aims: Short-rib thoracic dysplasia 3 with or without polydactyly (SRTD3) represents a type of severe fetal skeletal dysplasia (SD) characterized by shortened limbs, narrow thorax with or without polydactyly, which is caused by the homozygous or compound heterozygous mutations in the DYNC2H1 gene. SRTD3 is a recessive disorder, identification of the responsible genetic variation would be beneficial to an accurate prenatal diagnosis and well-grounded counseling for the affected families. Material and methods: Two families having experienced recurrent fetal SDs were recruited and submitted to a multiplatform genetic investigation. Whole-exome sequencing (WES) was performed with samples collected from the probands. Sanger sequencing and fluorescent quantitative PCR (qPCR) were conducted as validation assays for suspected variations. Results: WES identified two compound heterozygous variations in the DYNC2H1(NM_001080463.2) gene, namely c.2386C>T (p.Arg796Trp) and c.7289T>C (p.Ile2430Thr) for one; and exon (64-83)del and c.8190G>T (p.Leu2730Phe) for the other, respectively. One variant in them, exon (64-83)del, was novelly identified. Conclusion: The study detected two compound heterozygous variation in DYNC2H1 including one novel deletion: exon (64-83) del. Our findings clarified the cause of fetal skeletal dysplasia in the subject families, provided guidance for their future pregnancies, and highlighted the value of WES in diagnosis of skeletal dysplasia with unclear prenatal indications.

Organic ligands activate the dark formation of hydroxyl radicals (HO•) in surface soil/sediment: Yields, mechanisms, and applications.

Soil is an important sink for various pollutants. Recent findings suggest that soil and sediment would spontaneously form HO• through Fenton or Fenton-like reactions under natural conditions. In this study, the effects and mechanisms of organic ligands (OLs) on the occurrence of HO• in surface soil/sediment were experimentally and computationally examined. Results confirmed that HO• generation was ND-12.92 nmol/g in surface soil/sediment, and the addition of EDTA-2Na would significantly enhance the yields of HO• by 1.4-352 times. Moisture was the decisive factor of soil HO• generation. The release of Fe(II) from solid into the aqueous phase was essential for the stimulation of HO• in EDTA-2Na suspensions. Furthermore, complexation reactions between Fe(II) and OLs would enhance single electron transfer (SET) reactions and the formation of O2•-. Interestingly, for specific OLs, their stimulations on SET and formation of O2•- would depress HO• generation. Provoking HO• generation by OLs could be efficiently used to degrade sulfamethoxazole in rice field sediment. The study provided new knowledge on how commonly synthetic OLs affect the HO• generation in surface soil/sediment, and it additionally shed light on the engineered stimulation of in-situ Fenton reactions in natural soil/sediment.

Heme oxygenase-1 inhibits basophil maturation and activation but promotes its apoptosis in T helper type 2-mediated allergic airway inflammation.

The anti-inflammatory role of heme oxygenase-1 (HO-1) has been studied extensively in many disease models including asthma. Many cell types are anti-inflammatory targets of HO-1, such as dendritic cells and regulatory T cells. In contrast to previous reports that HO-1 had limited effects on basophils, which participate in T helper type 2 immune responses and antigen-induced allergic airway inflammation, we demonstrated in this study, for the first time, that the up-regulation of HO-1 significantly suppressed the maturation of mouse basophils, decreased the expression of CD40, CD80, MHC-II and activation marker CD200R on basophils, blocked DQ-ovalbumin uptake and promoted basophil apoptosis both in vitro and in vivo, leading to the inhibition of T helper type 2 polarization. These effects of HO-1 were mimicked by exogenous carbon monoxide, which is one of the catalytic products of HO-1. Furthermore, adoptive transfer of HO-1-modified basophils reduced ovalbumin-induced allergic airway inflammation. The above effects of HO-1 can be reversed by the HO-1 inhibitor Sn-protoporphyrin IX. Moreover, conditional depletion of basophils accompanying hemin treatment further attenuated airway inflammation compared with the hemin group, indicating that the protective role of HO-1 may involve multiple immune cells. Collectively, our findings demonstrated that HO-1 exerted its anti-inflammatory function through suppression of basophil maturation and activation, but promotion of basophil apoptosis, providing a possible novel therapeutic target in allergic asthma.

Basophil-associated OX40 ligand participates in the initiation of Th2 responses during airway inflammation.

Asthma is characterized by increased airway submucosal infiltration of T helper (Th) cells and myeloid cells that co-conspire to sustain a chronic inflammation. While recent studies have demonstrated that the myeloid basophils promote Th2 cells in response to various types of allergens, the underlying mechanisms are poorly understood. Here, we found for the first time that in a mouse model of allergic asthma basophils highly expressed OX40 ligand (OX40L) after activation. Interestingly, blockade of OX40-OX40L interaction suppressed basophils-primed Th2 cell differentiation in vitro and ameliorated ovalbumin (OVA)-induced allergic eosinophilic inflammation mediated by Th2 activation. In accordance, the adoptive transfer of basophils derived from mediastinal lymph nodes (MLN) of OVA-immunized mice triggered a robust Th2 response and eosinophilic inflammation in wild-type mice but largely muted in OX40(-/-) mice and mice receiving OX40L-blocked basophils. Taken together, our results reveal a critical role of OX40L presented by the activated basophils to initiate Th2 responses in an allergic asthma model, implicating OX40-OX40L signaling as a potential therapeutic target in the treatment of allergic airway inflammation.