Early warning model for stroke recurrence in acute ischemic stroke patients based on traditional Chinese medicine syndrome theory.

OBJECTIVE: This study aimed to establish an early warning model for stroke recurrence in acute ischemic stroke patients based on Traditional Chinese Medicine (TCM) syndrome theory. METHODS: This retrospective study collected the data of 1741 patients with ischemic stroke from 7 clinical centers between July 2016 and November 2019. Distance correlation coefficient, mutual information entropy, and statistical correlation test were used for univariate analysis. Cox proportional hazards regression model was applied to construct and validate the stroke recurrence warning model at different time. The area under the ROC curve (AUC) was used to evaluate the early warning ability of the model. RESULTS: We successfully constructed the early warning model. The median follow-up time was 1.42 years (95% CI [1.37, 1.47]). Recurrence events occurred in 175 patients, with a cumulative recurrence rate of 10.05% (95% CI [8.64, 11.47]). The AUC of the model was 0.64±0.02 in the training set and 0.70±0.03 in the validation set. CONCLUSION: The TCM syndrome model can give an early warning for the recurrence of stroke and provide reference for the secondary prevention of ischemic stroke.

Poor efficacy of immune checkpoint inhibitor treatment in advanced thymic carcinoma patients with liver metastases.

Background: Although immune checkpoint inhibitor treatment for advanced thymic carcinoma exhibits promising efficacy, factors that affect the efficacy and prognosis, including metastases sites, remain uncertain. Objectives: Our study aimed to investigate the determinants of survival among patients with advanced thymic carcinoma who underwent immunotherapy in real-world settings, with implications for clinical practice. Designs: Different therapy regimens of immunotherapy were produced to analyze the influence of liver metastases on survival and prognosis for advanced thymic carcinoma patients. Methods: Data for advanced thymic carcinoma patients receiving immunotherapy and their metastases sites were collected for analysis from seven different hospitals between January 2015 and January 2023. Progression-free survival (PFS) and overall survival (OS) analyses were performed using the Kaplan-Meier method. Cox analysis was used to evaluate factors influencing survival. Results: The present study analyzed 136 advanced thymic carcinoma patients from seven different hospitals.The PFS for all patients receiving immunotherapy was 6.4 months, while the OS was 24.0 months. The objective response rate was different for patients with liver and non-liver metastases (11.9% versus 37.2%, p = 0.003). The disease control rate values were also different between the two groups (47.6% versus 80.9%, p = 0.037). The PFS for patients with liver metastases demonstrated poor immunotherapy efficacy compared to patients with non-liver metastases (3.0 versus 8.0 months, p < 0.0001). The OS was also significantly different between these two patient groups (16.1 versus 29.1 months, p = 0.009). Conclusion: Immunotherapy had poor efficacy in advanced thymic carcinoma patients with liver metastases.

Effects of sleep disturbance, cancer-related fatigue, and psychological distress on breast cancer patients' quality of life: a prospective longitudinal observational study.

More attention has gone to researching the cancer-related fatigue (CRF)-sleep disturbance (SD)-psychological distress (PD) symptom cluster in breast cancer patients during the chemotherapy period, but the change trend and heterogeneous development track in the whole treatment stage remain unclear, and it is also unclear whether the appearance of and changes in one symptom cause changes in other symptoms and quality of life (QoL). This study, using breast cancer patients' data collected through a validated questionnaire, examined the relationships between SD, CRF, PD, and QoL using latent growth modeling analyses. CRF developmental trajectories showed an upward trend over five surveys (slope = 0.649, P < 0.001); PD showed a significant weakening trend (slope = - 0.583, P < 0.001); SD showed an increasing trend (slope = 0.345, P < 0.001), and QoL showed a statistically significant weakening trend (slope = - 0.373, P < 0.001). The initial CRF (coefficient = - 0.233, P < 0.01), PD (coefficient = - 0.296, P < 0.01), and SD (coefficient = - 0.388, P < 0.001) levels had a statistically significant negative effect on initial QoL level. The linear development rate of PD was statistically significant and negatively affected that of QoL (coefficient = - 0.305, P < 0.05), whereas the quadratic development rate of SD negatively affected that of QoL (coefficient = - 0.391, P < 0.05). Medical staff should identify the change characteristics of different variables based on SD, CRF, PD, and QoL change trajectories, and advance the intervention time, as changes in variables affect other variables' subsequent changes.

Detection of common pathogenesis of rheumatoid arthritis and atherosclerosis via microarray data analysis.

Despite extensive research reveal rheumatoid arthritis (RA) is related to atherosclerosis (AS), common pathogenesis between these two diseases still needs to be explored. In current study, we explored the common pathogenesis between rheumatoid arthritis (RA) and atherosclerosis (AS) by identifying 297 Differentially Expressed Genes (DEGs) associated with both diseases. Through KEGG and GO functional analysis, we highlighted the correlation of these DEGs with crucial biological processes such as the vesicle transport, immune system process, signaling receptor binding, chemokine signaling and many others. Employing Protein-Protein Interaction (PPI) network analysis, we elucidated the associations between DEGs, revealing three gene modules enriched in immune system process, vesicle, signaling receptor binding, Pertussis, and among others. Additionally, through CytoHubba analysis, we pinpointed 11 hub genes integral to intergrin-mediated signaling pathway, plasma membrane, phosphotyrosine binding, chemokine signaling pathway and so on. Further investigation via the TRRUST database identified two key Transcription Factors (TFs), SPI1 and RELA, closely linked with these hub genes, shedding light on their regulatory roles. Finally, leveraging the collective insights from hub genes and TFs, we proposed 10 potential drug candidates targeting the molecular mechanisms underlying RA and AS pathogenesis. Further investigation on xCell revealed that 14 types of cells were all different in both AS and RA. This study underscores the shared pathogenic mechanisms, pivotal genes, and potential therapeutic interventions bridging RA and AS, offering valuable insights for future research and clinical management strategies.

Incidence and risk factors for psychological distress in adult female patients with breast cancer: a systematic review and meta-analysis.

Introduction: Cancer-related distress can be described as a complex and unpleasant combination of psychological (such as cognitive, behavioral, and emotional), social, and spiritual challenges that may impact an individual's ability to effectively cope with the physical symptoms of cancer and its treatment. Existing literature has confirmed psychological distress (PD) as an important sequela of breast cancer diagnosis and treatment. However, the incidence and risk factors for PD in adult female patients with breast cancer remain unclear; therefore, focusing on the PD of female breast cancer patients is meaningful, as they are at highest risk of contracting breast cancer, and might differ in their coping styles from men. Objective: This review aimed to identify the incidence and risk factors for PD in adult woman patients with breast cancer, and to help guide targeted intervention to prevent distress. Method: PubMed, Embase, Cochrane Library, CINAL, PsycINFO, China Knowledge Resource Integrated Database, Wanfang Database, the Chinese Biomedical Database, and Weipu Database were searched for data regarding the incidence and risk factors of PD in adult women with breast cancer. Results: The prevalence of PD, assessed using the distress thermometer, ranged between 11.2%-86.7%, and a meta-analysis of 47 studies with 15,157 adult female breast cancer patients showed that the pooled prevalence was 52.0%. Further, this study identified 40 risk factors. However, owing to the inclusion of at least two studies for a certain risk factor, 10 risk factors were merged for the meta-analysis. Independent risk factors included higher education level, late-stage tumor, emotional concerns, no medical insurance, modified radical mastectomy, and history of depression; age and neuroticism were not associated with PD; and higher monthly income was revealed as a protective factor against it. Conclusion: The incidence of PD in female patients with breast cancer is high and it involves 10 risk factors, though some are controversial owing to insufficient evidence. Further research is needed to explore the underlying mechanisms of PD and develop risk factor-based holistic intervention programs to reduce its incidence. Systematic review registration: The protocol of this study has been registered in the database PROSPERO (registration ID: CRD42023433578).

Psychological distress in adult women of reproductive age at different stages after breast cancer diagnosis: A qualitative study.

AIM: To explore the actual experience of psychological distress of adult women of reproductive age at different stages after breast cancer diagnosis. DESIGN: Qualitative. METHODS: Eighty-one patients with breast cancer-related distress thermometer scores >4 were selected using a purposive sampling method. Patients were divided into newly diagnosed and 1-, 3-, 6-, 9- and 12-month groups according to time since diagnosis and then interviewed. A phenomenological approach was adopted to analyse interview content, and different themes were extracted. RESULTS: Women exhibited different levels of psychological distress depending on the time since diagnosis, with newly diagnosed patients showing the highest distress. Within 1 year post-diagnosis, different events caused patients distress. Themes extracted at new diagnosis and 1-, 3-, 6-, 9- and 12 months post-diagnosis included sadness and disbelief, loss of control, optimistic but concerned, physical and mental exhaustion, difficulties returning to society and limited sexual intimacy, respectively; all groups expressed reproductive concerns. CONCLUSION: Clinical nurses should focus on different psychologically distressing events to provide targeted interventions at distinct phases. For women of childbearing age, clinical nurses should pay particular attention to patients' marriage and reproductive concerns. IMPLICATIONS FOR THE PROFESSION AND/OR PATIENT CARE: During the year after a breast cancer diagnosis, patients of childbearing age experience events that cause psychological distress that differ depending on time since diagnosis. Nurses should focus on core stressful events and perform specific nursing interventions. IMPACT: To provide holistic care, nurses should consider the psychological and emotional changes patients may undergo. For women of childbearing age, clinical nurses should pay particular attention to patients' marriage and fertility concerns, and be able to provide evidence-based professional guidance on reproductive preservation techniques. REPORTING METHOD: The study was reported using the consolidated criteria for reporting qualitative research guidelines. PATIENT OR PUBLIC CONTRIBUTION: Patients contributed to data collection through interviews.

Epidemiological Insights into the Omicron Outbreak via MeltArray-Assisted Real-Time Tracking of SARS-CoV-2 Variants.

The prolonged course of the COVID-19 pandemic necessitates sustained surveillance of emerging variants. This study aimed to develop a multiplex real-time polymerase chain reaction (rt-PCR) suitable for the real-time tracking of Omicron subvariants in clinical and wastewater samples. Plasmids containing variant-specific mutations were used to develop a MeltArray assay. After a comprehensive evaluation of both analytical and clinical performance, the established assay was used to detect Omicron variants in clinical and wastewater samples, and the results were compared with those of next-generation sequencing (NGS) and droplet digital PCR (ddPCR). The MeltArray assay identified 14 variant-specific mutations, enabling the detection of five Omicron sublineages (BA.2*, BA.5.2*, BA.2.75*, BQ.1*, and XBB.1*) and eight subvariants (BF.7, BN.1, BR.2, BQ.1.1, XBB.1.5, XBB.1.16, XBB.1.9, and BA.4.6). The limit of detection (LOD) of the assay was 50 copies/reaction, and no cross-reactivity was observed with 15 other respiratory viruses. Using NGS as the reference method, the clinical evaluation of 232 swab samples exhibited a clinical sensitivity of > 95.12% (95% CI 89.77-97.75%) and a specificity of > 95.21% (95% CI, 91.15-97.46%). When used to evaluate the Omicron outbreak from late 2022 to early 2023, the MeltArray assay performed on 1408 samples revealed that the epidemic was driven by BA.5.2* (883, 62.71%) and BF.7 (525, 37.29%). Additionally, the MeltArray assay demonstrated potential for estimating variant abundance in wastewater samples. The MeltArray assay is a rapid and scalable method for identifying SARS-CoV-2 variants. Integrating this approach with NGS and ddPCR will improve variant surveillance capabilities and ensure preparedness for future variants.

Efficacy of Tyrosine Kinase Inhibitors in Primary Driver-Gene-Positive Combined Small-Cell Lung Cancer: A Retrospective Study.

BACKGROUND: Combined small-cell lung cancer (c-SCLC) with gene mutations is a rare subtype often found alongside adenocarcinoma. Targeted therapy may be effective because of the presence of specific molecular targets. However, due to its rarity and unconventional genetic testing, the efficacy remains uncertain. METHODS: A total of 31 c-SCLC patients with gene mutations were retrospectively included and grouped according to their treatment regimens. Treatment outcomes were evaluated. Kaplan-Meier method was used for survival analysis, with Log Rank test applied for comparison between groups. RESULTS: We divided the 31 patients into 3 groups according to first-line treatment: group A (chemotherapy, n = 16), group B (targeted monotherapy, n = 7), and group C (targeted combination therapy, n = 8). The overall response rates (ORR) were 43.8%, 42.9%, and 62.5%. The disease control rates (DCR) were 87.5%, 85.7%, and 100%. The median progression-free survival (PFS) was 4.0, 5.0, and 7.93 months (P = .024), with a significant difference between group A and C (P = .010). The median overall survival (OS) was 14.10, 17.43, and 12.93 months (P = .313). Seven patients in group A received targeted therapy in later-line. Of the total 22 patients received targeted monotherapy or combination therapy, the ORR and DCR were 54.5% and 90.9%. The median PFS and OS were 5.87 and 17.30 months. Additionally, adverse events (AEs) occurred in 53.8% and 88.9% of monotherapy and combination therapy. The most common AEs in monotherapy were elevated transaminases (23.1%) and in combination anemia (66.7%). CONCLUSIONS: TKIs showed encouraging efficacy in driver-gene-positive c-SCLC. While monotherapy may be a supplementary option, combination with chemotherapy appears to be preferable and superior.

The combination of etoposide and platinum for the treatment of thymic neuroendocrine neoplasms: A retrospective analysis.

BACKGROUND: To provide real-world outcomes for the combination of etoposide and platinum as a first-line treatment for advanced thymic neuroendocrine neoplasms (TNENs). METHODS: Retrospective analysis was performed on patients with advanced TNENs confirmed by pathology who received etoposide combined with platinum as a first-line chemotherapy in our institution between 2010 and 2022. RESULTS: A total of 16 patients were included in this study. Twelve patients (75%) received etoposide combined with cisplatin, and four patients (25%) received etoposide combined with carboplatin. Efficacy was evaluated in all patients, with an objective response rate of 31.3%. One patient achieved a complete response, four achieved a partial response, and in eight patients the disease remained stable; the disease control rate was 81.3%. The median progression-free survival (PFS) was 7.2 months with a 95% confidence interval (CI) of 2.1-12.3 months. The median overall survival (OS) was 50.4 months with a 95% CI of 32.1-68.8 months. No significant difference in efficacy was observed between the treatment groups with regards to PFS (p = 0.095) and OS (p = 0.061). Treatment-related adverse events were observed in all 12 patients when evaluated for toxicity, manifesting as hematologic toxicity. Grade 3-4 bone marrow suppression occurred in six patients (50%). No treatment-related deaths were recorded. CONCLUSION: This retrospective analysis, conducted in a real-life setting, suggests that the combination of etoposide and platinum has a promising anti-tumor activity in advanced TNENs, with a clinically significant overall response rate.

Immune checkpoint inhibitors beyond first-line progression with prior immunotherapy in patients with advanced non-small cell lung cancer.

Background: Immunotherapy, monotherapy, and immunotherapy plus platinum-based chemotherapy are the standard treatments for advanced non-small cell lung cancer (NSCLC) patients with negative driver genes. However, the impact of similar continuing immunotherapy beyond progression (IBP) of first-line immunotherapy for advanced NSCLC has not yet been shown. This study aimed to estimate the impact of immunotherapy beyond first-line progression (IBF) and evaluate the factors associated with second-line efficacity. Methods: Ninety-four cases of advanced NSCLC patients with progressive disease (PD) post first-line treatment with platinum-based chemotherapy plus immunotherapy and administrated prior immune checkpoint inhibitors (ICIs) between November 2017 and July 2021 were retrospectively analyzed. Survival curves were plotted using the Kaplan-Meier method. Cox proportional hazards regression analyses were applied to determine predictive factors independently associated with second-line efficacity. Results: A total of 94 patients were incorporated in this study. Patients who continued the original ICIs after initial PD were defined as IBF (n=42), whereas those who discontinued immunotherapy were defined as non-IBF (n=52). The second-line objective response rates (ORR, ORR = CR + PR) of patients in the IBF and non-IBF groups were 13.5% vs. 28.6%, respectively (P=0.070). No significant survival difference was found between patients in the IBF and non-IBF groups in first-line median progression-free survival (PFS) (mPFS1, 6.2 vs. 5.1 months, P=0.490), second-line median PFS (mPFS2, 4.5 vs. 2.6 months, P=0.216), or median overall survival (OS) (mOS, 14.4 vs. 8.3 months, P=0.188). However, the benefits inPFS2 were observed in individuals performed PFS1 >6 months (group A) than those of PFS1 ≤6 months (group B) (median PFS2, 4.6 vs. 3.2 months, P=0.038). Multivariate analyses did not reveal any independent prognostic factors for efficacy. Conclusions: The benefits of continuing prior ICIs administration beyond first-line immunotherapy progression might not be obvious in patients with advanced NSCLC, but those first line treatment showed a longer period may receive efficacy benefits.

Maternal genetic polymorphisms in the major mitotic checkpoint genes MAD1L1 and MAD2L1 associated with the risk of survival in abnormal chromosomal fetuses.

Background: The genetic etiology of fetal chromosome abnormalities remains unknown, which brings about an enormous burden for patients, families, and society. The spindle assembly checkpoint (SAC) controls the normal procedure of chromosome disjunction and may take part in the process. Objective: The aim of this study was to explore the association between polymorphisms of MAD1L1 rs1801368 and MAD2L1 rs1283639804, involved in SAC and fetal chromosome abnormalities. Methods: The case-control study collected 563 cases and 813 health controls to test the genotypes of MAD1L1 rs1801368 and MAD2L1 rs1283639804 polymorphisms by polymerase chain reaction-restrictive fragment length polymorphism methods (PCR-RFLP). Results: MAD1L1 rs1801368 polymorphism was associated with fetal chromosome abnormalities alone or combined to lower homocysteine (HCY) levels (alone: dominant: OR: 1.75, 95%CI: 1.19-2.57, and p = 0.005; CT vs. CC: OR = 0.73, 95%CI: 0.57-0.94, and p = 0.016; lower HCY: C vs. T: OR = 0.74, 95%CI: 0.57-0.95, and p = 0.02; dominant: OR = 1.75, 95%CI: 0.79-1.92, and p = 0.005). No significant differences were found in other genetic models or subgroups (p > 0.05, respectively). MAD2L1 rs1283639804 polymorphism revealed a sole genotype in the studied population. HCY is significantly associated with fetal chromosome abnormalities in younger groups (OR: 1.78, 95%CI: 1.28-2.47, and p = 0.001). Conclusion: The results implied that the polymorphism of MAD1L1 rs1801368 may become the susceptibility factor to fetal chromosome abnormalities alone or combined to lower HCY levels but not to MAD2L1 rs1283639804 polymorphism. In addition, HCY significantly affects fetal chromosomal abnormalities in younger women.

Molecular cloning and functional characterization of the promoter of a novel Aspergillus flavus inducible gene (AhOMT1) from peanut.

Peanut is an important oil and food legume crop grown in more than one hundred countries, but the yield and quality are often impaired by different pathogens and diseases, especially aflatoxins jeopardizing human health and causing global concerns. For better management of aflatoxin contamination, we report the cloning and characterization of a novel A. flavus inducible promoter of the O-methyltransferase gene (AhOMT1) from peanut. The AhOMT1 gene was identified as the highest inducible gene by A. flavus infection through genome-wide microarray analysis and verified by qRT-PCR analysis. AhOMT1 gene was studied in detail, and its promoter, fussed with the GUS gene, was introduced into Arabidopsis to generate homozygous transgenic lines. Expression of GUS gene was studied in transgenic plants under the infection of A. flavus. The analysis of AhOMT1 gene characterized by in silico assay, RNAseq, and qRT-PCR revealed minute expression in different organs and tissues with trace or no response to low temperature, drought, hormones, Ca2+, and bacterial stresses, but highly induced by A. flavus infection. It contains four exons encoding 297 aa predicted to transfer the methyl group of S-adenosyl-L-methionine (SAM). The promoter contains different cis-elements responsible for its expression characteristics. Functional characterization of AhOMT1P in transgenic Arabidopsis plants demonstrated highly inducible behavior only under A. flavus infection. The transgenic plants did not show GUS expression in any tissue(s) without inoculation of A. flavus spores. However, GUS activity increased significantly after inoculation of A. flavus and maintained a high level of expression after 48 hours of infection. These results provided a novel way for future management of peanut aflatoxins contamination through driving resistance genes in A. flavus inducible manner.

Emerging Omicron subvariants evade neutralizing immunity elicited by vaccine or BA.1/BA.2 infection.

The newly emerging severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) Omicron BA.2.75 and BA.2.76 subvariants contained 35 and 29 additional mutations in its spike (S) protein compared with the reference SARS-CoV-2 genome, respectively. Here, we measured the evasion degree of the BA.1, BA.2, BA.4, BA.5, BA.2.75, and BA.2.76 subvariants from neutralizing immunity in people previously infected with the Omicron BA.1 and BA.2, determined the effect of vaccination on immune evasion, and compared the titers of neutralizing antibodies in serums between acute infection and convalescence. Results showed that the neutralization effect of serums from patients with different vaccination statuses and BA.1/BA.2 breakthrough infection decreased with the Omicron evolution from BA.1 to BA.2, BA.4, BA.5, BA.2.75, and BA.2.76. This study also indicated that the existing vaccines could no longer provide effective protection, especially for the emerging BA.2.75 and BA.2.76 subvariants. Therefore, vaccines against emerging epidemic strains should be designed specifically. In the future, we can not only focus on the current strains, but also predict and design new vaccines against potential mutant strains. At the same time, we can combine the virus strains' infection characteristics to develop protective measures for virus colonization areas, such as nasal protection spray. Besides, further studies on the Y248N mutation of BA.2.76 subvariant were also necessary to explore its contribution to the enhanced immune evasion ability.

Beliefs and perceptions of electronic cigarettes among medical staff in respiratory departments of Fujian Province, China, in 2021.

INTRODUCTION: Due to the popularity of e-cigarettes, more and more patients ask about e-cigarettes, and it is particularly important to understand doctors' beliefs and perceptions on e-cigarettes. The aim was to evaluate the belief and perception of electronic cigarettes among medical staff in the respiratory department of medical institutions located in Fujian Province. METHODS: The electronic questionnaires were conveyed to the medical staff of the respiratory department in Fujian Province during March to April 2021. Descriptive statistics were calculated for all questions, and the relationship between relevant factors and the perception of e-cigarette-related statements was analyzed by logistic regression analysis. RESULTS: Among 1028 medical staff in the respiratory departments of Fujian Province, 90.5% of medical staff agreed that electronic cigarettes are harmful to the human body; 61.4% of medical staff agreed that e-cigarettes cannot be regarded as a type of smoking cessation treatment; 71.7% of medical staff agreed that e-cigarettes could be a 'gateway' to other tobacco use; and 69.2% of medical staff agreed that electronic cigarettes are in 'Three No' states. The multivariate logistic regression analysis showed that the respondents' perception of 'e-cigarettes cannot be regarded as a type of smoking cessation treatment' were related to gender, professional title and whether they participated in the cessation clinic. CONCLUSIONS: The medical staff of the respiratory department in Fujian Province put more emphasis on the adverse effects of e-cigarettes on health, but lack the cognition of the effect of e-cigarette smoking cessation. In order to better carry out smoking cessation work, it is necessary to strengthen the training of respiratory medical staff at all levels of medical institutions on e-cigarette knowledge.

Accessible and Adaptable Multiplexed Real-Time PCR Approaches to Identify SARS-CoV-2 Variants of Concern.

Rapid identification and continuous surveillance of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants are critical for guiding the response to the COVID-19 pandemic. Whole-genome sequencing (WGS) is a preferred tool for this aim, but many laboratories suffer from a lack of resources to support population-level sequencing. Here, we describe two PCR strategies targeting spike protein mutations to identify the Alpha, Delta, and Omicron variants. Signature mutations were selected using a dedicated bioinformatic program. The selected mutations in Alpha and Delta variants were detected using multicolor melting curve analysis (MMCA). Thirty-two mutations of the Omicron variant were targeted using the MeltArray approach in one reaction, which was able to detect the Omicron subvariants BA.1, BA.2, BA.3, and BA.4/5. The limits of detection varied from five to 50 copies of RNA templates/reactions. No cross-reactivity was observed with nine other respiratory viruses, including other coronaviruses. We validated the MMCA and MeltArray assays using 309 SARS-CoV-2 positive samples collected at different time points. These assays exhibited 98.3% to 100% sensitivity and 100% specificity compared with WGS. Multiplexed real-time PCR strategies represent an alternative tool capable of identifying current SARS-CoV-2 VOCs, adaptable for emerging variants and accessible for laboratories using existing equipment and personnel. IMPORTANCE Rapid detection and mutation surveillance of SARS-CoV-2 VOCs is crucial for COVID-19 control, management, and prevention. We developed two rapid molecular assays based on the real-time PCR platform to identify important variants of concern, including the Omicron variant with a large number of mutations. Signature mutations were selected by an R program. Then, MMCA assays were established for Alpha and Delta variants, and a MeltArray assay targeting 32 mutations was developed for Omicron variant. These multiplexed PCR assays could be performed in a 96-well real-time PCR instrument within 2.5 h, offering a high-throughput choice for dynamic monitoring of SARS-CoV-2 VOCs in a standard microbiology laboratory.

CCL5 mediates breast cancer metastasis and prognosis through CCR5/Treg cells.

Background and aims: CCL5 is considered to contribute to the biological function of a variety of cancer types, but its specific mechanism is still unclear. This study aimed to reveal the mechanism of CCL5 in the invasion, metastasis, and prognosis of breast cancer. Methods: The expression of CCL5 in tumor tissue and serum was measured with a Luminex protein detection kit, and the correlation between CCL5 and clinical parameters was evaluated. Kaplan-Meier analysis was used to analyze the effect of CCL5 on the prognosis of breast cancer patients. Protein interaction network analysis and gene coexpression were used to determine the receptor that has the strongest interaction with CCL5. Enrichment analysis was used to study the possible pathway by which CCL5 affects breast cancer progression. We used immunofluorescence staining and flow cytometry to estimate the fraction of immunity-related components in the tumor microenvironment. Results: The expression level of CCL5 in breast cancer patients was positively correlated with the degree of axillary lymph node metastasis; CCL5 in tumor tissue was correlated with estrogen receptor status (P = 0.034), progesterone receptor (P = 0.009), nuclear grade (P = 0.013), clinical stage (P < 0.001) and molecular subtype (P = 0.024) in breast cancer patients. Breast cancer patients with high CCL5 expression had worse disease-free survival (P = 0.031) and breast cancer-specific survival (P = 0.043); however, CCL5 had no effect on overall survival (P = 0.077). CCL5 affected tumor progression through CCR5, and the T-cell-related immune pathway may be the main pathway; the CD4+/CD8+, CCR5+/CD4+ and Treg/CCR5+ cell ratios were significantly increased in the lymph node metastasis group. Conclusion: CCL5 affects the Treg/CD4+CCR5+ cell ratio in breast cancer patients through CCR5, thus affecting breast cancer metastasis and prognosis.

The Emerging Roles of Circ-ABCB10 in Cancer.

Circular RNAs (circRNAs) are non-coding RNAs (ncRNAs) without 5' caps and 3' tails, which are formed from precursor mRNAs (pre-mRNAs) that are inversely back-spliced by exons. CircRNAs are characterized by a covalently closed circular structure and are abundantly expressed in eukaryotic cells. With the development of RNA-sequencing, it was discovered that circRNAs play important roles in the regulation of numerous human genes and are related to the occurrence, development, and prognosis of diseases. Studies in various cancers have revealed that circRNAs have both positive and negative effects on the occurrence and development of tumors. Circ-ABCB10, a circular RNA originating from exons of ABCB10 located on chromosome 1q42, has been proven to play an important role in different types of cancers. Here, we report the primary findings of recent research studies by many contributors about the roles of circ-ABCB10 in cancer and clearly formulate its influence and functions in different aspects of cancer biology, which gives us a broad picture of circ-ABCB10. Thus, this study aimed to generalize the roles of circ-ABCB10 in the diagnosis and treatment of different types of tumors and its related miRNA genes. In this way, we wish to provide a sufficient understanding and assess the future development direction of the research on circ-ABCB10.

Five novel globin gene mutations identified in five Chinese families by next-generation sequencing.

BACKGROUND: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of ß-thalassemia caused by five different mutations in the globin gene. METHODS: Next-generation sequencing (NGS) was used to identify novel α- and ß-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. RESULTS: NGS revealed five novel cases of α- and ß-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed. CONCLUSION: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.