Redefining chimeric antigen receptor T-cell (CAR-T) regulation: China's responses to address secondary cancer risks of CAR-T therapy.

Since the United States Food and Drug Administration (FDA) approved the first chimeric antigen receptor T-cell (CAR-T) therapy in 2017, it has marked a major breakthrough in cancer treatment, leading to a surge in global research and applications in this field. In recent years, China has made rapid progress, quickly catching up through heavy investment in CAR-T construction, preparation processes, and treatment strategies. China's CAR-T therapy market is driven by substantial pharmaceutical investment targeting its vast population, yet high therapy costs remain uncovered by basic medical insurance. In November 2023, FDA issued a warning about the risk of secondary cancers in patients undergoing CAR-T therapy, sparking global concern. In fact, the China National Medical Products Administration (NMPA) preemptively implemented a series of measures to address the safety concerns of CAR-T therapy, emphasizing the risk of secondary cancers and advising lifelong monitoring as part of the approval process for CAR-T products. Nevertheless, additional regulatory measures are needed to address emerging risks, particularly the threat of secondary cancers. The authors believe that raising the standards for Investigational New Drug (IND) approval and establishing a dynamic reporting and feedback system based on real-world data will strengthen regulatory oversight and support the sustainable growth of the CAR-T industry in China.

Exploring the potential mechanism of Xiaojin Pill therapy for benign prostatic hyperplasia through metabolomics and gut microbiota analysis.

Background: Xiaojin Pill (XJP) is a traditional Chinese medicine prescribed for treating benign prostatic hyperplasia (BPH). It has been proven to have multiple effects, such as regulating sex hormone levels, exhibiting anti-tumor, anti-inflammatory, analgesic, and anti-platelet aggregation properties, and improving immunity. However, the material basis of XJP's therapeutic effect on BPH and its metabolic process in vivo remains to be clarified. At the same time, many microorganisms that exist in the urogenital tract, including those related to BPH, can also affect the health of the host. Methods: Using ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), the chemical components of XJP were identified. A BPH model was created through bilateral testicular ablation and injections of testosterone propionate. A comprehensive evaluation of XJP efficacy was conducted using pathological ELISA, TUNEL, and immunohistochemical techniques. In addition, UPLC-MS metabolomics and 16S rRNA sequencing revealed the serum metabolic profile and intestinal microbiota composition. We performed a Spearman correlation coefficient analysis to highlight the interactions between "intestinal microbiota-serum factors" and "intestinal microbiota-metabolites." Results: XJP contains 91 compounds that alleviate pathologies of BPH in rats, decreasing prostate weight, index, and serum levels of Dihydrotestosterone (DHT), Prostate-Specific Antigen (PSA), epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), and vascular endothelial growth factor (VEGF) levels. It inhibits prostatic epithelial cell apoptosis and downregulates Bax, TGF-ß1, and IGF-1 proteins in the caspase-3 pathway. Metabolomics studies have revealed 10 upregulated and 10 downregulated metabolites in treated rats, with 5-methylcytosine, uracil, and cytosine enriched in pyrimidine metabolism. L-arginine plays a pivotal role in metabolic pathways encompassing pyrimidine metabolism, arginine biosynthesis, and the mammalian target of rapamycin (mTOR) signaling pathway. 16S rRNA sequencing revealed that XJP optimized the diversity and balance of intestinal flora in BPH rats by decreasing the Bacteroidetes/Firmicutes (B/F) ratio, enhancing the beneficial bacteria, such as Eggerthellaceae, Anaerovoracaceae, and Romboutsia, and suppressing the dysfunctional bacteria, such as Atopobiaceae, Prevotellaceae_NK3B31_group, Dorea, and Frisingicoccus. According to the Spearman correlation coefficient analysis, Lactobacillus was found to be most associated with serum factors, whereas Romboutsia showed the highest correlation with metabolites. This finding suggests that XJP modulates pyrimidine metabolism disorders in BPH rats, a regulation that aligns closely with Romboutsia, Prevotellaceae_NK3B31_group, Lactobacillus, Chujaibacter, and Enterorhabdus, thereby providing valuable biological insights. Conclusion: In summary, these findings indicate that XJP possesses a synergistic anti-BHP effect through its multi-component, multi-target, multi-gut microbiota, and multi-metabolic pathway properties. The effect involves the regulation of sex hormone levels, growth factors, and the anti-epithelial cell apoptosis process. The modulation of specific gut microbiota by the host and the involvement of multiple metabolic pathways are likely one of the significant mechanisms of XJP in treating BPH. Notably, pyrimidine metabolism and the intestinal microbial ecosystem are closely intertwined in this process.

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR­1301­3p/KIF23 axis.

Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR­545­3p (5'­TGGCTCAGTTCAGCAGGAAC­3') was actually for miR­24­3p (5'­UGGCUCAGUUCAGCAGGAACAG­3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR­670­5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I.  The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR­670­5p and miR­545­3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].

The role of tetrahydrocurcumin in disease prevention and treatment.

In recent decades, natural compounds derived from herbal medicine or dietary sources have played important roles in prevention and treatment of various diseases and have attracted more and more attention. Curcumin, extracted from the Curcumae Longae Rhizoma and widely used as food spice and coloring agent, has been proven to possess high pharmacological value. However, the pharmacological application of curcumin is limited due to its poor systemic bioavailability. As a major active metabolite of curcumin, tetrahydrocurcumin (THC) has higher bioavailability and stability than curcumin. Increasing evidence confirmed that THC had a wide range of biological activities and significant treatment effects on diseases. In this paper, we reviewed the research progress on the biological activities and therapeutic potential of THC on different diseases such as neurological disorders, metabolic syndromes, cancers, and inflammatory diseases. The extensive pharmacological effects of THC involve the modulation of various signaling transduction pathways including MAPK, JAK/STAT, NF-κB, Nrf2, PI3K/Akt/mTOR, AMPK, Wnt/ß-catenin. In addition, the pharmacokinetics, drug combination and toxicology of THC were discussed, thus providing scientific basis for the safe application of THC and the development of its dietary supplements and drugs.

Gut microbiota in insulin resistance: a bibliometric analysis.

Background: Insulin resistance (IR) is considered the pathogenic driver of diabetes, and can lead to obesity, hypertension, coronary artery disease, metabolic syndrome, and other metabolic disorders. Accumulating evidence indicates that the connection between gut microbiota and IR. This bibliometric analysis aimed to summarize the knowledge structure of gut microbiota in IR. Methods: Articles and reviews related to gut microbiota in IR from 2013 to 2022 were retrieved from the Web of Science Core Collection (WoSCC), and the bibliometric analysis and visualization were performed by Microsoft Excel, Origin, R package (bibliometrix), Citespace, and VOSviewer. Results: A total of 4 749 publications from WoSCC were retrieved, including 3 050 articles and 1 699 reviews. The majority of publications were from China and USA. The University Copenhagen and Shanghai Jiao Tong University were the most active institutions. The journal of Nutrients published the most papers, while Nature was the top 1 co-cited journal, and the major area of these publications was molecular, biology, and immunology. Nieuwdorp M published the highest number of papers, and Cani PD had the highest co-citations. Keyword analysis showed that the most frequently occurring keywords were "gut microbiota", "insulin-resistance", "obesity", and "inflammation". Trend topics and thematic maps showed that serum metabolome and natural products, such as resveratrol, flavonoids were the research hotspots in this field. Conclusion: This bibliometric analysis summarised the hotspots, frontiers, pathogenesis, and treatment strategies, providing a clear and comprehensive profile of gut microbiota in IR. Supplementary Information: The online version contains supplementary material available at 10.1007/s40200-023-01342-x.

[New drug discovery and prospect of small nucleic acids derived from traditional Chinese medicine and natural medicine].

Small nucleic acid drugs mainly include small interfering RNA(siRNA), antisense oligonucleotide(ASO), microRNA(miRNA), messenger RNA(mRNA), nucleic acid aptamer(aptamer), and so on. Its translation or regulation can be inhibited by binding to the RNA of the target molecule. Due to its strong specificity, persistence, and curability, small nucleic acid drugs have received considerable attention in recent years. Recent studies have shown that some miRNAs from animal and plant sources can stably exist in the blood, tissue, and organs of animals and human beings and exert pharmacological action by regulating the expression of various target proteins. This paper summarized the discovery of small nucleic acids derived from traditional Chinese medicine(TCM) and natural drugs and their cross-border regulatory mechanisms and discussed the technical challenges and regulatory issues brought by this new drug, which can provide new ideas and methods for explaining the complex mechanism of TCM, developing new drugs of small nucleic acids from TCM and natural medicine, and conducting regulatory scientific research.

[Bioinformatics database and production layout visual analysis platform of medicinal plants:a case study of Dao-di medicinal materials in Sichuan province].

In the new stage of trans-omics and trans-subjects for medicinal plants, it is an urgent need to integrate big data, provide interactive applications, and form a unified and multi-level research system and big data platform. Dao-di medicinal material, as an important source of medicinal plants, is a unique quality concept and comprehensive standard of tranditional Chinese medicine(TCM). Several databases have been developed in China and abroad, such as the Encyclopedia of Traditional Chinese Medicine(ETCM) and the Global Pharmacopoeia Genome Database(GPGD). Yet, most databases do not provide multi-dimensional data, including geographic data, phenotype data, compound data, and genetic data. Sichuan, known as the hometown of TCM therapies and the treasure trove of TCM, is the most representative region of medicinal plant diversity in China. According to the latest data of the fourth national survey of TCM resources, there are more than 8 000 TCM and 86 Dao-di medicinal materials in Sichuan province. Based on resource census data and relevant achievements, this study constructed the bioinformatics database of medicinal plants and the visual analysis platform of production layout by taking the Dao-di medicinal materials in Sichuan province as an example, covering geographic data, phenotype data, compound data, and genetic data. It effectively integrates multi-dimensional data of Dao-di medicinal materials and provides different levels of data interaction applications. The platform is the first large-scale multi-dimensional database and visual platform of Dao-di medicinal materials in Sichuan province, which serves as an essential resource for germplasm resources identification, decomposition of biosynthetic pathways, molecular breeding of varieties and provides medicinal plant resource information and data support for development and utilization of medicinal plants in China and abroad.

[Betulinic acid inhibits non-small cell lung cancer by repolarizing tumor-associated macrophages via mTOR signaling pathway].

The abnormal activation of the mammalian target of rapamycin(mTOR) signaling pathway in non-small cell lung cancer(NSCLC) is closely associated with distant metastasis, drug resistance, tumor immune escape, and low overall survival. The present study reported that betulinic acid(BA), a potent inhibitor of mTOR signaling pathway, exhibited an inhibitory activity against NSCLC in vitro and in vivo. CCK-8 and colony formation results demonstrated that BA significantly inhibited the viability and clonogenic ability of H1299, A549, and LLC cells. Additionally, the treatment with BA induced mitochondrion-mediated apoptosis of H1299 and LLC cells. Furthermore, BA inhibited the mobility and invasion of H1299 and LLC cells by down-regulating the expression level of matrix metalloproteinase 2(MMP2) and impairing epithelial-mesenchymal transition. The results demonstrated that the inhibition of mTOR signaling pathway by BA decreased the proportion of M2 phenotype(CD206 positive) cells in total macrophages. Furthermore, a mouse model of subcutaneous tumor was established with LLC cells to evaluate the anti-tumor efficiency of BA in vivo. The results revealed that the administration of BA dramatically retarded the tumor growth and inhibited the proliferation of tumor cells. More importantly, BA increased the ratio of M1/M2 macrophages in the tumor tissue, which implied the enhancement of anti-tumor immunity. In conclusion, BA demonstrated the inhibitory effect on NSCLC by repolarizing tumor-associated macrophages via the mTOR signaling pathway.

A positive feedback inhibition of isocitrate dehydrogenase 3ß on paired-box gene 6 promotes Alzheimer-like pathology.

Impaired brain glucose metabolism is an early indicator of Alzheimer's disease (AD); however, the fundamental mechanism is unknown. In this study, we found a substantial decline in isocitrate dehydrogenase 3ß (IDH3ß) levels, a critical tricarboxylic acid cycle enzyme, in AD patients and AD-transgenic mice's brains. Further investigations demonstrated that the knockdown of IDH3ß induced oxidation-phosphorylation uncoupling, leading to reduced energy metabolism and lactate accumulation. The resulting increased lactate, a source of lactyl, was found to promote histone lactylation, thereby enhancing the expression of paired-box gene 6 (PAX6). As an inhibitory transcription factor of IDH3ß, the elevated PAX6 in turn inhibited the expression of IDH3ß, leading to tau hyperphosphorylation, synapse impairment, and learning and memory deficits resembling those seen in AD. In AD-transgenic mice, upregulating IDH3ß and downregulating PAX6 were found to improve cognitive functioning and reverse AD-like pathologies. Collectively, our data suggest that impaired oxidative phosphorylation accelerates AD progression via a positive feedback inhibition loop of IDH3ß-lactate-PAX6-IDH3ß. Breaking this loop by upregulating IDH3ß or downregulating PAX6 attenuates AD neurodegeneration and cognitive impairments.

Determination of the chromosomal position effects for plug-and-play application in the Myxococcus xanthus chassis cells.

The chromosomal position effect can significantly affect the transgene expression, which may provide an efficient strategy for the inauguration of alien genes in new hosts, but has been less explored rationally. The bacterium Myxococcus xanthus harbors a large circular high-GC genome, and the position effect in this chassis may result in a thousand-fold expression variation of alien natural products. In this study, we conducted transposon insertion at TA sites on the M. xanthus genome, and used enrichment and dilution indexes to respectively appraise high and low expression potentials of alien genes at insertion sites. The enrichment sites are characteristically distributed along the genome, and the dilution sites are overlapped well with the horizontal transfer genes. We experimentally demonstrated the enrichment sites as high expression integration sites (HEISs), and the dilution sites unsuitable for gene integration expression. This work highlights that HEISs are the plug-and-play sites for efficient expression of integrated genes.

BGP-15 alleviates LPS-induced depression-like behavior by promoting mitophagy.

The high prevalence of major depressive disorder (MDD) frequently imposes severe constraints on psychosocial functioning and detrimentally impacts overall well-being. Despite the growing interest in the hypothesis of mitochondrial dysfunction, the precise mechanistic underpinnings and therapeutic strategies remain unclear and require further investigation. In this study, an MDD model was established in mice using lipopolysaccharide (LPS). Our research findings demonstrated that LPS exposure induced depressive-like behaviors and disrupted mitophagy by diminishing the mitochondrial levels of PINK1/Parkin in the brains of mice. Furthermore, LPS exposure evoked the activation of the NLRP3 inflammasome, accompanied by a notable elevation in the concentrations of pro-inflammatory factors (TNF-α, IL-1ß, and IL-6). Additionally, neuronal apoptosis was stimulated through the JNK/p38 pathway. The administration of BGP-15 effectively nullified the impact of LPS, corresponding to the amelioration of depressive-like phenotypes and restoration of mitophagy, prevention of neuronal injury and inflammation, and suppression of reactive oxygen species (ROS)-mediated NLRP3 inflammasome activation. Furthermore, we elucidated the involvement of mitophagy in BGP-15-attenuated depressive-like behaviors using the inhibitors targeting autophagy (3-MA) and mitophagy (Mdivi-1). Notably, these inhibitors notably counteracted the antidepressant and anti-inflammatory effects exerted by BGP-15. Based on the research findings, it can be inferred that the antidepressant properties of BGP-15 in LPS-induced depressive-like behaviors could potentially be attributed to the involvement of the mitophagy pathway. These findings offer a potential novel therapeutic strategy for managing MDD.

Glucuronidation dynamics of curcumin and tetrahydrocurcumin for differential structures and chemical reactivities in human liver microsome and uridine diphosphate glucuronosyltransferase 2B7.

THC is the main metabolite of curcumin with better bioactivity. This study aimed to explore the factors that cause differences in the bioactivity of curcumin and THC. We analyzed the metabolic activities of curcumin and THC and the factors responsible for the differences in their activities by glucuronidation activity assay, LC-MS, HPLC, homologous sequence comparisons, and molecular docking. Curcumin has higher metabolic activity than THC in HLM and UGT2B7, while the keto-enol isomers of curcumin and THC were distinctly different under different pH, and their structural transformations were hypothesized. Furthermore, UGT1A and UGT2B are differential sequences of curcumin and THC in UGTs. The binding sites and patterns of curcumin and THC in UGT2B7 are markedly different. In summary, the difference in keto-enolic interconversion isomerism between curcumin and THC is the main factor causing the difference in their activities, which provides a scientific basis for the development of curcumin.

Acetylated tau exacerbates apoptosis by disturbing mitochondrial dynamics in HEK293 cells.

An increase in tau acetylation at K274 and K281 and abnormal mitochondrial dynamics have been observed in the brains of Alzheimer's disease (AD) patients. Here, we constructed three types of tau plasmids, TauKQ (acetylated tau mutant, by mutating its K274/K281 into glutamine to mimic disease-associated lysine acetylation), TauKR (non-acetylated tau mutant, by mutating its K274/K281 into arginine), and TauWT (wild-type human full-length tau). By transfecting these tau plasmids in HEK293 cells, we found that TauWT and TauKR induced mitochondrial fusion by increasing the level of mitochondrial fusion proteins. Conversely, TauKQ induced mitochondrial fission by reducing mitochondrial fusion proteins, exacerbating mitochondrial dysfunction and apoptosis. BGP-15 ameliorated TauKQ-induced mitochondrial dysfunction and apoptosis by improving mitochondrial dynamics. Our findings suggest that acetylation of K274/281 represents an important post-translational modification site regulating mitochondrial dynamics, and that BGP-15 holds potential as a therapeutic agent for mitochondria-associated diseases such as AD.

Novel Leflunomide Analog, UTLOH-4e, Ameliorates Gouty Arthritis Induced by Monosodium Urate Via NF-κB/NLRP3 Signaling Pathway.

BACKGROUND: Gouty arthritis (GA) is a common form of inflammatory arthritis caused by intra-articular deposition of monosodium urate (MSU) crystals; however, there is a tremendous lack of safe and effective therapy in the clinic. OBJECTIVE: The goal of this work was to investigate a novel leflunomide analogue, N-(2,4- dihydroxyphenyl)-5-methyl-1,2-oxazole-3-carboxamide (UTLOH-4e), for its potential to prevent/ treat gouty arthritis. METHODS: In this study, the anti-inflammatory activity of UTLOH-4e was evaluated by MSUinduced GA model in vivo and in vitro, and the molecular docking test was applied to estimate the affinity of UTLOH-4e/UTL-5g/b for MAPKs, NF-κB, and NLRP3. RESULTS: In vitro, UTLOH-4e (1~100 µM) treatment inhibited the inflammatory reaction with no obvious cytotoxicity in PMA-induced THP-1 macrophages exposed to MSU crystals for 24 h, involving the prominent decreased production and gene expression of IL-1ß, TNF-α, and IL-6. Western blot analyses demonstrated that UTLOH-4e (1~100 µM) significantly suppressed the activation of NLRP3 inflammasomes, NF-κB, and MAPK pathways. Furthermore, the data from the experiment on gouty rats induced by intra-articular injection of MSU crystal confirmed that UTLOH-4e markedly ameliorated rat paw swelling, articular synovium inflammation and reduced the concentration of IL-1ß and TNF-α in serum through down-regulating NLRP3 protein expression. CONCLUSION: These results manifested that UTLOH-4e ameliorates GA induced by MSU crystals, which contributes to the modulation of NF-κB/ NLRP3 signaling pathway, suggesting that UTLOH- 4e is a promising and potent drug candidate for the prevention and treatment of gouty arthritis.

Identification of γ-Fagarine as a novel antiviral agent against respiratory virus (hMPV) infection.

Human metapneumovirus (hMPV) causes significant upper and lower respiratory disease in all age groups worldwide. However, there is no licensed drugs or vaccine available against hMPV. γ-Fagarine, an alkaloid isolated from the root of zanthoxylum, has been reported to be effective in the treatment of cancer, inflammatory diseases and antivirals. However, little is known about the inhibitory effect of γ-Fagarine against respiratory virus infection and the mechanism. In this study, we aim to investigate the effect of γ-Fagarine on hMPV infection and explore its underlying molecular mechanisms. Vero-E6 and 16HBE cells were used as cell models. Virus replication and microcosm character were explored in Vero-E6 cells. Then, the antiviral activities were investigated by quantitative real-time PCR (RT-qPCR), western blotting (WB), and indirect immunofluorescence assays (IFAs) in Vero-E6 and 16HBE. Potential mechanisms of γ-Fagarine related to HSPG and lysosome pH were assessed in 16HBE cells. Lastly, a virus-infected mouse model was established and antiviral assay in vivo was conducted. γ-Fagarine showed no toxicity toward Vero-E6 cells and 16HBE cells but demonstrated anti-hMPV activity. Virus titers of γ-Fagarine group were reduced to 33% and 45% of the hMPV groups, respectively. Besides, mechanistic studies revealed that γ-Fagarine could inhibit hMPV by dual mechanisms of direct restraining virus binding with HSPG and influencing lysosome pH. Furthermore, oral delivery of γ-Fagarine to hMPV-infected mice at a dosage of 25 mg/kg reduced the hMPV load in lung tissues. After γ-Fagarine treatment, pathological damage caused by viral infection was also ameliorated. These findings suggest that γ-Fagarine has antiviral effects in vitro and in vivo, which are associated with its ability to restrain virus binding with HSPG and influence lysosome pH, thus indicating that γ-Fagarine has the potential to serve as a candidate to fight against hMPV infection and other respiratory viruses such as influenza viruses and SARS-CoV-2.

The role of the symbiotic microecosystem in cancer: gut microbiota, metabolome, and host immunome.

The gut microbiota is not just a simple nutritional symbiosis that parasitizes the host; it is a complex and dynamic ecosystem that coevolves actively with the host and is involved in a variety of biological activities such as circadian rhythm regulation, energy metabolism, and immune response. The development of the immune system and immunological functions are significantly influenced by the interaction between the host and the microbiota. The interactions between gut microbiota and cancer are of a complex nature. The critical role that the gut microbiota plays in tumor occurrence, progression, and treatment is not clear despite the already done research. The development of precision medicine and cancer immunotherapy further emphasizes the importance and significance of the question of how the microbiota takes part in cancer development, progression, and treatment. This review summarizes recent literature on the relationship between the gut microbiome and cancer immunology. The findings suggest the existence of a "symbiotic microecosystem" formed by gut microbiota, metabolome, and host immunome that is fundamental for the pathogenesis analysis and the development of therapeutic strategies for cancer.

Sources, morphology, phytochemistry, pharmacology of Curcumae Longae Rhizoma, Curcumae Radix, and Curcumae Rhizoma: a review of the literature.

Curcumae Longae Rhizoma (turmeric), Curcumae Radix and Curcumae Rhizoma are derived from the Curcuma species, and have gradually become three of the most commonly used medicinal herbs in China due to their different origins, processing methods and medicinal part. These three herbs have certain similarities in morphology, chemical composition, and pharmacological effects. All three of these herbs contain curcuminoids and volatile oil compounds, which exhibit anti-inflammatory, anti-tumor, antioxidant, and neuroprotective properties, although modern clinical applications have their own requirements. At present, there is no systematic guidelines for the clinical application of these three of Curcuma species; consequently, there is a high risk of unwanted phenomena associated with the mixing and indiscriminate use of these herbs. In this review, we focus predominantly on morphology, chemical composition, and the pharmacological activity of these three Curcuma herbs and summarize the current status of research in this field. Our goal is to provide a better understanding of clinical value of these Curcuma species so that we can provide reference guidelines for their further development, utilization and rational clinical application.

A systematic review of the research progress of traditional Chinese medicine against pulmonary fibrosis: from a pharmacological perspective.

Pulmonary fibrosis is a chronic progressive interstitial lung disease caused by a variety of etiologies. The disease can eventually lead to irreversible damage to the lung tissue structure, severely affecting respiratory function and posing a serious threat to human health. Currently, glucocorticoids and immunosuppressants are the main drugs used in the clinical treatment of pulmonary fibrosis, but their efficacy is limited and they can cause serious adverse effects. Traditional Chinese medicines have important research value and potential for clinical application in anti-pulmonary fibrosis. In recent years, more and more scientific researches have been conducted on the use of traditional Chinese medicine to improve or reduce pulmonary fibrosis, and some important breakthroughs have been made. This review paper systematically summarized the research progress of pharmacological mechanism of traditional Chinese medicines and their active compounds in improving or reducing pulmonary fibrosis. We conducted a systematic search in several main scientific databases, including PubMed, Web of Science, and Google Scholar, using keywords such as idiopathic pulmonary fibrosis, pulmonary fibrosis, interstitial pneumonia, natural products, herbal medicine, and therapeutic methods. Ultimately, 252 articles were included and systematically evaluated in this analysis. The anti-fibrotic mechanisms of these traditional Chinese medicine studies can be roughly categorized into 5 main aspects, including inhibition of epithelial-mesenchymal transition, anti-inflammatory and antioxidant effects, improvement of extracellular matrix deposition, mediation of apoptosis and autophagy, and inhibition of endoplasmic reticulum stress. The purpose of this article is to provide pharmaceutical researchers with information on the progress of scientific research on improving or reducing Pulmonary fibrosis with traditional Chinese medicine, and to provide reference for further pharmacological research.