Integrated analysis of multiple microarray studies to establish differential diagnostic models of Crohn's disease and ulcerative colitis based on a metalloproteinase-associated module.

Background: The ulcerative colitis (UC) and Crohn's disease (CD) subtypes of inflammatory bowel disease (IBD) are autoimmune diseases influenced by multiple complex factors. The clinical treatment strategies for UC and CD often differ, indicating the importance of improving their discrimination. Methods: Two methods, robust rank aggregation (RRA) analysis and merging and intersection, were applied to integrate data from multiple IBD cohorts, and the identified differentially expressed genes (DEGs) were used to establish a protein-protein interaction (PPI) network. Molecular complex detection (MCODE) was used to identify important gene sets. Two differential diagnostic models to distinguish CD and UC were established via a least absolute shrinkage and selection operator (LASSO) logistic regression, and model evaluation was performed in both the training and testing groups, including receiver operating characteristic (ROC) curves, calibration plots and decision curve analysis (DCA). The potential value of MMP-associated genes was further verified using different IBD cohorts and clinical samples. Results: Four datasets (GSE75214, GSE10616, GSE36807, and GSE9686) were included in the analysis. Both data integration methods indicated that the activation of the MMP-associated module was significantly elevated in UC. Two LASSO models based on continuous variable (Model_1) and binary variable (Model_2) MMP-associated genes were established to discriminate CD and UC. The results showed that Model_1 exhibited good discrimination in the training and testing groups. The calibration analysis and DCA showed that Model_1 exhibited good performance in the training group but failed in the testing group. Model_2 exhibited good discrimination, calibration and DCA results in the training and testing groups and exhibited greater diagnostic value. The effects of Model_1 and Model_2 were further verified in a new IBD cohort of GSE179285. The MMP genes exhibited high value as biomarkers for the discrimination of IBD patients using published cohort and immunohistochemistry (IHC) staining data. The MMP-associated gene levels were statistically significantly positively correlated with the levels of the differentially expressed cell types, indicating their potential value in differential diagnosis. The single-cell analysis confirmed that the expression of ANXA1 in UC was higher than that in CD. Conclusion: MMP-associated modules are the main differential gene sets between CD and UC. The established Model_2 overcomes batch differences and has good clinical applicability. Subsequent in-depth research investigating how MMPs are involved in the development of different IBD subtypes is necessary.

A novel electrochemical immunosensor for highly sensitive detection of aflatoxin B1 in corn using single-walled carbon nanotubes/chitosan.

A sensitive electrochemical immunosensor for aflatoxin B1 (AFB1) detection based on single-walled carbon nanotubes/chitosan was presented. The immunosensor was based on an indirect competitive binding to a fixed amount of anti-AFB1 between free AFB1 and AFB1-bovine serum albumin, which conjugate immobilized on covalently functionalized nanotubes/chitosan laid on the glass carbon electrode. Then, the anti-mouse immunoglobulin G secondary antibody labeled with alkaline phosphatase was bound to the electrode surface through reacting with primary antibody. Finally, alkaline phosphatase catalyzes the hydrolysis of the substrate α-naphthyl phosphate, which produced electrochemical signal. Compared with conventional methods, the established immunosensor was more sensitive and simple. Under optimal conditions, this method could quantitatively detect AFB1 from 0.01 to 100 ng mL(-1) with a detection limit of 3.5 pg mL(-1). Moreover, the immunosensor was successfully applied to assay AFB1 in corn powder, which showed good correlation with the results obtained from high performance liquid chromatography.

[Distribution of the of nosocomial infection pathogens among general hospital in China: a Meta analysis].

OBJECTIVE: To provide basic and direction for nosocomial infection prevention and control through evaluation the distribution of nosocomial infection pathogens and understand current situation of pathogens among general hospital in China. METHODS: Articles were searched and collected from CBM, CNKI,VIP database and Wanfang database published between creating database to March. 2013 about investigation of nosocomial infection. Those literatures were screened and extracted according to the inclusion and exclusion criteria by two reviewers independently. The analysis of pathogens distribution was performed by using comprehensive Meta analysis software and stratified by factor as year, hospital level and region of the study. The distribution rate of different pathogens were merged according to statistical tests for the heterogeneity test. RESULTS: The 345 trials were included. The results show 1)the pooled distribution rates of common pathogens in 1987-2000 were as follows:18.6% (95% CI:13.7%-24.9%), 18.1% (95% CI:15.4%-21.0%), 14.8% (95% CI: 12.2%-17.9%), 5.2% (95%CI:4.1%-6.6%) for Fungus, Staphylococcus, Pseudomonas, and Klebsiella respectively;the pooled rates of common pathogens in 2001-2012 were as follows:17.6% (95% CI: 16.4%-18.8%), 15.0% (95% CI:14.2%-15.8%), 13.9% (95% CI:13.1%-14.7%), 10.4% (95% CI: 9.9%-11.0%)for Fungus, Staphylococcus, Pseudomonas, and Klebsiella respectively. 2)The pooled distribution rates of pathogens in second and below grade hospital were 3.2% (95%CI:0.3%-29.9%), 4.7% (95% CI:3.4%-6.3%), 7.2% (95% CI:1.7%-26.1%)for Mycoplasma, Shigella and Alkaligenes respectively;the pooled distribution rates of pathogens in third grade hospital were 1.1% (95% CI: 0.1%-15.4%), 1.8% (95%CI:0.6%-5.1%), 4.3% (95%CI:2.3%-8.0%)for Mycoplasma, Shigella and Alkaligenes respectively. 3)The pooled rate of Mycoplasma for Yangtze River Economic Area was 14.3% (95%CI:2.0%-58.1%)and for Southwest Economic Area was 0.3% (95%CI:0.1%-1.1%). The pooled rate of Corynebacterium for Yangtze River Economic Area was 0.4% (95%CI:0.1%-1.4%)and for Southeast Economic Area was 9.5% (95% CI:2.4%-31.1%). The pooled rate of Haemophilus for Northern Economic Area was 0.5% (95%CI:0.2%-0.9%)and for Southeast Economic Area was 9.2% (95% CI:7.3%-11.6%). The pooled rate of Salmonella for Yangtze River Economic Area was 6.3% (95% CI:4.6%-8.6% ) and for Southeast Economic Area was 0.4% (95% CI:0.1%-3.0% ). CONCLUSION: The common nosocomial infection pathogens were Fungus, Staphylococcus, Pseudomonas and Escherichia among general hospitals in China. A remarkable note is that Klebsiella was increased significantly in recent years and becomes one of the most common pathogens. There were differences in the distribution rate of nosocomial infection pathogens among general hospitals between levels and regions in China.

[Infection of the mononuclear cell subpopulations in murine bone marrow with murine cytomegalovirus].

This study was aimed to explore the infection characteristics of murine mononuclear cell subpopulations in bone marrow with murine cytomegalovirus (MCMV). Subpopulations of mononuclear cells, including lin(+), lin(-), lin(-)CD117(+) and lin(-)CD117(-) cells, were infected with MCMV after being separated by MACS, and induced to differentiation by adding cytokines or inducer, then nucleic acid and proteins were detected. The results indicated that the MCMV DNA, IE transcripts and IE protein could be detected in the lin(+) cells infected with MCMV; no virus products were detected in infected lin(-) cells without adding any stimulating factors, while IE and E transcripts and proteins were detected after adding GM-CSF, rhEPO or phorbol ester in the lin(-) cells infected with MCMV. Furthermore, no IE or E gene transcripts were detected in the lin(-)CD117(+) and lin(-)CD117(-) cells, but the cell colony formation of lin(-)CD117(+) hematopoietic stem and progenitor cells was inhibited after MCMV infection and expression of CD117 antigen on cell surface of the lin(-) cells was downregulated. It is concluded that MCMV can latently infect subpopulations of mononuclear cells in the murine bone marrow. Cells which are of characteristics of primitive stem and progenitor cells are not susceptible to MCMV, but infection of these cells with MCMV can inhibit functions of cells and downregulate the expression of antigen on cells surface.

Human cytomegalovirus-encoded chemokine receptor homolog US28 stimulates the major immediate early gene promoter/enhancer via the induction of CREB.

The major immediate early (MIE) gene of cytomegalovirus plays a key role in determining the activation and replication of cytomegalovirus, which represents the most important event signaling the onset of virus-induced disease relapse. The viral-encoded chemokine receptor homolog US28 can constitutively activate many cellular transcription factors, which can bind to the promoter/enhancer of the MIE gene and activate its transcription. Using reporter gene assays in HEK293 cells, we found that US28 enhanced the transcription efficiency of MIE and other genes via cAMP response element-binding protein (CREB). Inhibition of CREB partially blocked the effect of US28, whereas forskolin enhanced this effect. There was a direct correlation between CREB and transcription of MIE gene. These data, together with the broad-spectrum effect of cellular transcription factors, suggest that US28 may be involved in the very early transcription of the host cell during virus activation.

[Human cytomegalovirus-encoded US28 stimulates the CREB related transcriptional activity].

AIM: To observe the effect of the human cytomegalovirus(HCMV)-encoded chemokine receptor homolog US28 on the human transcription factor CREB related transcriptional activity. METHODS: The US28 gene was cloned from DNA of HCMV-infected fibroblast at 72 h post infection. The amplified gene fragment was subsequently cloned into pcDNA3.1 eukaryotic expression vector. The recombinant plasmid was selected and identified by sequence analysis. US28-pcDNA3.1 was added to the Dual-Luciferase Reporter Assay System. The immunoreactive bands of phospho-CREB(p-CREB)and luminescence values were observed. RESULTS: The constructed recombinant vector was verified by PCR analysis and DNA sequencing. US28 enhanced the transcriptional efficiency of CRE driving gene via p-CREB. CONCLUSION: HCMV could enhance the transcriptional activity of CRE driving gene via p-CREB. CREB might be involved in the very early reprogramming of the host cell during virus activation.

[Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus].

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.

[The effect of methylene blue/photochemical method for virus inactivation on plasma components].

Virus inactivation of plasma can be achieved by methylene blue/photochemical method. To investigate the effect of this method on immunological properties and biochemical functions of plasma components, the virus-inactivation method was performed on single-donor plasma that was exposed to visible light (40,000 lux) at room temperature for 1 h in the presence of 1 micro mol/L methylene blue. The results showed that activities of the factor VIII, PT and APTT were decreased to a certain degree while most of other plasma proteins were not affected significantly. Human plasma components including albumin, glucose and minerals as well as plasma pH were also not affected. By using different electrophoreses and immunochemical techniques, no neoantigens were found in photodynamically treated plasma and electrophoretic mobility revealed identical patterns for untreated and treated plasma. In conclusion, methylene blue/photochemical method dose not considerably influence the properties of major of plasma components.