Sequence Context in DNA i-Motifs Can Nurture Very Stable and Persistent Kinetic Traps.

I-motifs are non-canonical DNA structures with recognized biological significance and a proven utility in material engineering.  Consequently, understanding and control of i-motif properties is essential to sustain progress across both disciplines.  In this work, we systematically investigate how proximity to the most common form of DNA, a double-stranded duplex, influences the thermodynamic and kinetic properties of adjacent i-motifs.  We demonstrate that double-stranded stems in i-motif loops promote kinetic trapping of very stable and persistent partially folded conformations.  Further, we investigate pathways toward rational control over a folding topology makeup.

Non-canonical DNA structures in the human ribosomal DNA.

Non-canonical structures (NCS) refer to the various forms of DNA that differ from the B-conformation described by Watson and Crick. It has been found that these structures are usual components of the genome, actively participating in its essential functions. The present review is focused on the nine kinds of NCS appearing or likely to appear in human ribosomal DNA (rDNA): supercoiling structures, R-loops, G-quadruplexes, i-motifs, DNA triplexes, cruciform structures, DNA bubbles, and A and Z DNA conformations. We discuss the conditions of their generation, including their sequence specificity, distribution within the locus, dynamics, and beneficial and detrimental role in the cell.

Spectroscopic Characterization of Mitochondrial G-Quadruplexes.

Guanine quadruplexes (G4s) are highly polymorphic four-stranded structures formed within guanine-rich DNA and RNA sequences that play a crucial role in biological processes. The recent discovery of the first G4 structures within mitochondrial DNA has led to a small revolution in the field. In particular, the G-rich conserved sequence block II (CSB II) can form different types of G4s that are thought to play a crucial role in replication. In this study, we decipher the most relevant G4 structures that can be formed within CSB II: RNA G4 at the RNA transcript, DNA G4 within the non-transcribed strand and DNA:RNA hybrid between the RNA transcript and the non-transcribed strand. We show that the more abundant, but unexplored, G6AG7 (37%) and G6AG8 (35%) sequences in CSB II yield more stable G4s than the less profuse G5AG7 sequence. Moreover, the existence of a guanine located 1 bp upstream promotes G4 formation. In all cases, parallel G4s are formed, but their topology changes from a less ordered to a highly ordered G4 when adding small amounts of potassium or sodium cations. Circular dichroism was used due to discriminate different conformations and topologies of nucleic acids and was complemented with gel electrophoresis and fluorescence spectroscopy studies.

Spectroscopic and In Silico Studies on the Interaction of Substituted Pyrazolo[1,2-a]benzo[1,2,3,4]tetrazine-3-one Derivatives with c-Myc G4-DNA.

Herein we describe a combined experimental and in silico study of the interaction of a series of pyrazolo[1,2-a]benzo[1,2,3,4]tetrazin-3-one derivatives (PBTs) with parallel G-quadruplex (GQ) DNA aimed at correlating their previously reported anticancer activities and the stabilizing effects observed by us on c-myc oncogene promoter GQ structure. Circular dichroism (CD) melting experiments were performed to characterize the effect of the studied PBTs on the GQ thermal stability. CD measurements indicate that two out of the eight compounds under investigation induced a slight stabilizing effect (2-4 °C) on GQ depending on the nature and position of the substituents. Molecular docking results allowed us to verify the modes of interaction of the ligands with the GQ and estimate the binding affinities. The highest binding affinity was observed for ligands with the experimental melting temperatures (Tms). However, both stabilizing and destabilizing ligands showed similar scores, whilst Molecular Dynamics (MD) simulations, performed across a wide range of temperatures on the GQ in water solution, either unliganded or complexed with two model PBT ligands with the opposite effect on the Tms, consistently confirmed their stabilizing or destabilizing ability ascertained by CD. Clues about a relation between the reported anticancer activity of some PBTs and their ability to stabilize the GQ structure of c-myc emerged from our study. Furthermore, Molecular Dynamics simulations at high temperatures are herein proposed for the first time as a means to verify the stabilizing or destabilizing effect of ligands on the GQ, also disclosing predictive potential in GQ-targeting drug discovery.

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly.

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Controlled assembly of AIEgens based on a super-quadruplex scaffold for detection of plasma membrane proteins.

Quantification of plasma membrane proteins (PMPs) is crucial for understanding the fundamentals of cellular signaling systems and their related diseases. In this work, a super-quadruplex scaffold was designed to regulate assembly of oligonucleotide-grafted AIEgens for detection of PMPs. The nonfluorescence oligonucleotide-grafted AIEgen (Oligo-AIEgen) was firstly synthesized by attaching the AIEgen to 3'-terminus of the oligonucleotide through click chemistry. Meanwhile, the tetramolecular hairpin-conjugated super-quadruplex (THP-G4) as cleavage element and signal enhancement scaffold composited of three elements: a substrate sequence of DNAzyme in the loop region, partial hybridization region in the stem, and six guanine nucleotides to form G-quadruplex. Once the DNAzyme was anchored on the specific PMPs through aptamer-protein recognition, the substrate sequence on the loop of THP-G4 was cleaved by DNAzyme with the aid of cofactor MnII, resulting in the conformation switch of THP-G4 to the activated G-quadruplex scaffold. The latter could assemble Oligo-AIEgens to generate aggregation-induced emission (AIE) enhancement, resulting in a simple and sensitive strategy for detection of membrane proteins. Moreover, the DNAzyme continuously cut the next THP-G4 to achieve recycling amplification. Under the optimized conditions, this AIE-based strategy exhibited good linear relationship with the logarithm of MUC1 concentration from 0.01 to 10 µg mL-1 with the limit of detection down to 4.3 ng mL-1. The G4-assembled AIEgens provides a universal platform for detecting various biomolecules and a proof-of concept for AIE biosensing.

Exponential quadruplex priming amplification for DNA-based isothermal diagnostics.

Polymerase chain reaction (PCR) is a method of choice for molecular diagnostics. However, PCR relies on thermal cycling, which is not compatible with the goals of point-of-care diagnostics. A simple strategy to turn PCR into an isothermal method would be to use specific primers, which upon polymerase elongation can self-dissociate from the primer-binding sites. We recently demonstrated that a monomolecular DNA quadruplex, GGGTGGGTGGGTGGG, meets these requirements, which led to the development of the linear versions of quadruplex priming amplification (QPA). Here we demonstrate exponential version of isothermal QPA, which allows an unprecedented 10(10)-fold amplification of DNA signal in less than 40 min.

Quadruplex-forming DNA sequences spread by retrotransposons may serve as genome regulators.

Transposable elements (TEs) are ubiquitous genome inhabitants in eukaryotes. Increasing evidence shows that TEs are involved in regulatory networks of eukaryotic cells and contribute to genome evolution. Recently, we reported that many plant long-terminal repeat (LTR) retrotransposons contain DNA quadruplex-forming sequences at precise positions inside their LTRs and that quadruplexes are better preserved in evolutionary younger elements. As quadruplexes can modulate molecular processes, quadruplexes found at specific distances upstream and downstream from the endogenous TE promoter can affect transcription of the element. Moreover, quadruplexes found in solo LTRs, as well as in 3' ends of 5'-truncated copies of LINE-1 elements, can affect expression of neighboring genes. Here, we propose that this way retrotransposons can serve as vehicles for spread of DNA quadruplexes. Quadruplexes can thus fulfill a dual regulatory role-to influence both the retrotransposons carrying them and the neighboring host genes, e.g., by direct effect on transcription or by modifying the local chromatin state. Additionally, four-stranded DNA structures may serve as hotspots for recombination-based genome rearrangements.

Thermal stability of quadruplex primers for highly versatile isothermal DNA amplification.

Quadruplex priming amplification (QPA) allows isothermal amplification of nucleic acids with improved yield and simplified detection. This assay is based on a DNA quadruplex, GGGTGGGTGGGTGGG (G3T), which in the presence of specific cations possesses unusually high thermal stability. QPA employs truncated G3T sequences as primers, which upon polymerase elongation, self-dissociate from the binding site and allow the next round of priming without thermal unfolding of amplicons. The rate of amplification strongly depends on the thermal stability of the primer/primer binding site (PBS) complex and to date QPA has been demonstrated to work over a narrow temperature range. To expand the capabilities of QPA, in the present study, we studied the fold and thermodynamic properties of the wild-type G3T and variants containing sequence modifications or extensions at the 5'-end. Circular dichroism studies demonstrate that the substitution of thymidines by other nucleotides or GC addition at the 5'-end does not change the parallel fold of G3T. Thermal unfolding experiments revealed that purine bases incorporated at loop positions and 5'-end dinucleotide extension significantly destabilize the quadruplex, while loop pyrimidines have almost no effect. Overall, the results of these studies suggest that linear isothermal QPA can be performed over a wide temperature range to accommodate both thermophilic and mesophilic DNA polymerases.

Isothermal amplification of DNA using quadruplex primers with fluorescent pteridine base analogue 3-methyl isoxanthopterin.

We previously developed a method, known as quadruplex priming amplification (QPA), which greatly simplifies DNA amplification and quantification assays. QPA employs specific primers based on GGGTGGGTGGGTGGG (G3T) sequence, which upon polymerase elongation spontaneously dissociates from the target and folds into a stable quadruplex. Fluorescent nucleotide analogs, when incorporated into these primers, emit light upon quadruplex formation and permit simple, specific, and sensitive quantification without the attachment of probe molecules. Here, we studied optical [fluorescence and circular dichroism (CD)] and thermodynamic properties of the G3T sequence and variants incorporating 3-methylisoxanthopterin (3MI), a highly fluorescent nucleotide analog suitable for QPA. CD studies demonstrate that the incorporation of 3MI does not change the overall tertiary structure of G3T; however, thermal unfolding experiments revealed that it significantly destabilizes the quadruplex. Enzymatic studies revealed that Taq and Bst are practically unable to incorporate any nucleotides opposite to template 3MI. Based on this knowledge, we designed QPA assays with truncated targets that demonstrate efficient amplification around 55°C. Overall, these studies suggest that 3MI-based QPA is a useful assay for DNA amplification and detection.