The species, density, and intra-plant distribution of mites on red raspberry (Rubus idaeus L.).

The adoption of the European Green Deal will limit acaricide use in high value crops like raspberry, to be replaced by biological control and other alternative strategies. More basic knowledge on mites in such crops is then necessary, like species, density, and their role as vectors of plant diseases. This study had four aims, focusing on raspberry leaves at northern altitude: (1) identify mite species; (2) study mite population densities; (3) investigate mite intra-plant distribution; (4) investigate co-occurrence of phytophagous mites, raspberry leaf blotch disorder and raspberry leaf blotch virus (RLBV). Four sites in south-eastern Norway were sampled five times. Floricanes from different parts of the sites were collected, taking one leaf from each of the upper, middle, and bottom zones of the cane. Mites were extracted with a washing technique and processed for species identification and RLBV detection. Mites and leaves were tested for RLBV by reverse transcription polymerase chain reaction (RT-PCR) with virus-specific primers. Phytophagous mites, Phyllocoptes gracilis, Tetranychus urticae, and Neotetranychus rubi, and predatory mites, Anystis baccarum and Typhlodromus (Typhlodromus) pyri were identified. All phytophagous mites in cultivated raspberry preferred the upper zone of floricanes, while in non-cultivated raspberry, they preferred the middle zone. The presence of phytophagous mites did not lead to raspberry leaf blotch disorder during this study. RLBV was detected in 1.3% of the sampled plants, none of them with leaf blotch symptoms, and in 4.3% of P. gracilis samples, and in some spider mite samples, implying that Tetranychids could also be vectors of RLBV.

ICTV Virus Taxonomy Profile: Fimoviridae 2024.

Members of the family Fimoviridae are plant viruses with a multipartite negative-sense enveloped RNA genome (-ssRNA), composed of 4-10 segments comprising 12.3-18.5 kb in total, within quasi-spherical virions. Fimoviruses are transmitted to plants by eriophyid mites and induce characteristic cytopathologies in their host plants, including double membrane-bound bodies in the cytoplasm of virus-infected cells. Most fimoviruses infect dicotyledonous plants, and many cause serious disease epidemics. This is a summary of the ICTV Report on the family Fimoviridae, which is available at ictv.global/report/fimoviridae.

In planta expression of specific single chain fragment antibody (scFv) against nucleocapsid protein of fig mosaic virus (FMV).

Fig mosaic virus (FMV) is recognized as the main viral agent associated with the mosaic disease (MD) of fig trees (Ficus carica). Due to its worldwide occurrence, FMV represents the most significant global threat to the production of fig fruit. A disease management strategy against the MD in fig orchards has never been effective; and therefore, expression of recombinant antibody in plant cells could provide an alternative approach to suppress FMV infections. In this study we focused on expressing a specific recombinant antibody, a single-chain variable fragment (scFv), targeting the nucleocapsid protein (NP) of FMV in planta. To accomplish this objective, we inserted the scFv gene into a plant expression vector and conducted transient expression in leaves of Nicotiana tabacum cv. Samson plants. The construct was transiently expressed in tobacco plants by agroinfiltration, and antibody of the anticipated size was detected by immunoblotting. The produced plantibody was then assessed for specificity using ELISA and confirmed by Western blot analysis. In this study, the plantibody developed against FMV could be considered as a potential countermeasure to the infection by conferring resistance to MD.

Molecular Population Genetics of Aspen Mosaic-Associated Virus in Finland and Sweden.

Aspen mosaic-associated virus (AsMaV) is a newly identified Emaravirus, in the family Fimoviridae, Bunyavirales, associated with mosaic symptoms in aspen trees (Populus tremula). Aspen trees are widely distributed in Europe and understanding the population structure of AsMaV may aid in the development of better management strategies. The virus genome consists of five negative-sense single-stranded RNA (-ssRNA) molecules. To investigate the genetic diversity and population parameters of AsMaV, different regions of the genome were amplified and analyzed and full-length sequence of the divergent isolates were cloned and sequenced. The results show that RNA3 or nucleoprotein is a good representative for studying genetic diversity in AsMaV. Developed RT-PCR-RFLP was able to identify areas with a higher number of haplotypes and could be applied for screening the large number of samples. In general, AsMaV has a conserved genome and based on the phylogenetic studies, geographical structuring was observed in AsMaV isolates from Sweden and Finland, which could be attributed to founder effects. The genome of AsMaV is under purifying selection but not distributed uniformly on genomic RNAs. Distant AsMaV isolates displayed amino acid sequence variations compared to other isolates, and bioinformatic analysis predicted potential post-translational modification sites in some viral proteins.

Genetic Diversity among Rose Rosette Virus Isolates: A Roadmap towards Studies of Gene Function and Pathogenicity.

The phylogenetic relationships of ninety-five rose rosette virus (RRV) isolates with full-length genomic sequences were analyzed. These isolates were recovered mostly from commercial roses that are vegetatively propagated rather than grown from seed. First, the genome segments were concatenated, and the maximum likelihood (ML) tree shows that the branches arrange independent of their geographic origination. There were six major groups of isolates, with 54 isolates in group 6 and distributed in two subgroups. An analysis of nucleotide diversity across the concatenated isolates showed lower genetic differences among RNAs encoding the core proteins required for encapsidation than the latter genome segments. Recombination breakpoints were identified near the junctions of several genome segments, suggesting that the genetic exchange of segments contributes to differences among isolates. The ML analysis of individual RNA segments revealed different relationship patterns among isolates, which supports the notion of genome reassortment. We tracked the branch positions of two newly sequenced isolates to highlight how genome segments relate to segments of other isolates. RNA6 has an interesting pattern of single-nucleotide mutations that appear to influence amino acid changes in the protein products derived from ORF6a and ORF6b. The P6a proteins were typically 61 residues, although three isolates encoded P6a proteins truncated to 29 residues, and four proteins extended 76-94 residues. Homologous P5 and P7 proteins appear to be evolving independently. These results suggest greater diversity among RRV isolates than previously recognized.

Field Resistance to Rose Rosette Disease as Determined by Multi-Year Evaluations in Tennessee and Delaware.

Rose rosette disease (RRD) caused by the rose rosette emaravirus (RRV) and transmitted by the eriophyid mite Phyllocoptes fructiphilus (Pf), both native to North America, has caused significant damage to roses over the last several decades. As cultural and chemical control of this disease is difficult and expensive, a field trial was established to systematically screen rose germplasm for potential sources of resistance. One hundred and eight rose accessions representing the diversity of rose germplasm were planted in Tennessee and Delaware, managed to encourage disease development, and evaluated for symptom development and viral presence for three years. All major commercial rose cultivars were susceptible to this viral disease to varying levels. The rose accessions with no or few symptoms were species accessions from the sections Cinnamomeae, Carolinae, Bracteatae, and Systylae or hybrids with these. Among these, some were asymptomatic; they displayed no symptoms but were infected by the virus. Their potential depends on their ability to serve as a source of viruses. The next step is to understand the mechanism of resistance and genetic control of the various sources of resistance identified.

Identification of a Second Vector for Rose Rosette Virus.

Rose rosette devastates the ornamentals industry in the United States. The disease, caused by rose rosette emaravirus (RRV), is vectored by the eriophyoid mite Phyllocoptes fructiphilus (Acari: Eriophyoidea). In this communication, we investigate two other Phyllocoptes species, P. adalius and P. arcani, for their vector competency and transmission efficiencies in single and multiple mite transfer experiments. P. arcani was identified as a second vector of RRV, a finding of significance for the epidemiology of the disease, as the second vector may be present in plants where P. fructiphilus is absent.

Exploring the Host Range of Rose rosette Virus among Herbaceous Annual Plants.

To study the host range of Rose rosette virus (RRV), we employed crude sap inoculum extracted from RRV-infected roses and the RRV infectious clone. We inoculated plants from the families Solanaceae, Cucurbitaceae, Leguminosae, Malvaceae, Amaranthaceae, and Brassicaceae. Reverse transcription-polymerase chain reaction (RT-PCR) was used to detect RRV in the inoculated plants throughout their growth stages. Interestingly, RRV was detected in the newly developed leaves of tomato, pepper, tobacco, cucumber, squash, zucchini, pumpkin, pea, peanut, soybean, spinach, okra, and Chenopodium spp. The speed of upward advancement of RRV within infected plants was variable between plants as it took two to three weeks for some plant species and up to five weeks in other plant species to emerge in the newest leaves. No severe symptoms were detected on most of the inoculated plants. Chenopodium spp., spinach, cucumber and Nicotiana rustica exhibited either chlorotic or necrotic lesions with variable shapes and patterns on the systemically infected leaves. Double membrane-bound particles of 80-120 nm in diameter were detected by transmission electron microscopy in the infected tissues of cucumber, pepper, and N. benthamiana plants. This finding infers the validity of mechanical inoculation for RRV on a wide range of plants that would serve as potential natural reservoirs.

First report of perilla mosaic emaravirus infecting Perilla frutescens in South Korea.

Perilla mosaic virus (PerMV; the genus Emaravirus in the family Fimoviridae) has a multiple, negative-sense, single-stranded RNA genome (ICTV, 2018). PerMV has been reported in Japan, where it was transmitted by an eriophyid mite species (Acari: Eriophyidae) to Perilla frutescens (L.) Britton var. crispa (Kubota et al., 2020). In September 2021, typical symptoms of the virus including yellow flecks, mosaic symptoms, and malformation were observed in leaves of P. frutescens in a cultivated field in Iseo-myeon, Wanju, South Korea (Suppl. Fig. 1). Visual estimates indicated that symptom incidence reached 70%, and the top leaves of perilla plants exhibited more severe symptoms and leaf distortion. To identify the virus species accurately, total RNA was extracted from five symptomatic perilla leaves collected using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) then cDNAs were amplified by reverse-transcription polymerase chain reaction (RT-PCR) using two pairs of primers to PerMV specific primer set designed to amplify 412- and 491-bp cDNAs of the nucleocapsid protein gene RNA 3 and movement protein gene RNA 4, respectively (Suppl. Table). Single-infection of PerMV in symptomatic Korean perilla plants was confirmed by high-throughput sequence (HTS) analysis and de novo transcriptome assembly using the Illumina HiSeq 4000 platform (Macrogen Inc., Seoul, Korea). The assembled sequences were aligned with viral reference genomes through searches performed using the BLASTn tool. Seven contigs (597-7,213 bp) revealed 92.09-97.37% nucleotide homology with RNAs of the isolate PerMV_Kochi_Nankoku_2011 (accession numbers LC496090 to LC496099) in the GenBank database. Other viruses including turnip mosaic virus and cucumber green mottle mosaic virus were not identified by HTS analysis (Cho et al., 2021; Park et al., 2020; Song et al., 2022). Seven RNA genomes of PerMV were confirmed by RT-PCR using specific primer sets designed to amplify part of each genome (Suppl. Table 1 and Fig. 2). The complete nucleotide sequences of PerMV (named IS isolate) RNA 1-7 were determined to be 7,177, 2,089, 1,094, 1,302, 1,079, 1,098, and 995 bp in length, respectively; these were deposited in GenBank (LC721296-LC721303). Sap from a symptomatic leaf sample confirmed for single infection was inoculated mechanically onto the leaves of 10 healthy P. frutescens seedlings, which developed the same PerMV symptoms within 3 weeks. These results indicate that PerMV is the causal agent of viral disease in Korean perilla plants cultivated in South Korea. To our knowledge, this is the first report of a perilla mosaic emaravirus infecting to Korean perilla, P. frutescens in South Korea.

Mixed infection of an emaravirus, a crinivirus, and a begomovirus in Pueraria lobata (Willd) Ohwi.

Pueraria lobata (Willd) (Pueraria montana var. lobata (Willd.) Maesen & S. M. Almeida ex Sanjappa & Predeep) is an important herbal medicine used in many countries. In P. lobata plants showing symptoms of mosaic, yellow spots, and mottling, mixed infection of new viruses provisionally named Pueraria lobata-associated emaravirus (PloAEV, genus Emaravirus), Pueraria lobata-associated crinivirus (PloACV, genus Crinivirus), and isolate CQ of the previously reported kudzu mosaic virus (KuMV-CQ, genus Begomovirus) was confirmed through high-throughput sequencing. PloAEV has five RNA segments, encoding a putative RNA-dependent RNA polymerase, glycoprotein precursor, nucleocapsid protein, movement protein, and P5, respectively. PloACV has two RNA segments, encoding 11 putative proteins. Only PloAEV could be mechanically transmitted from mixed infected symptomatic kudzu to Nicotiana benthamiana plants. All three viruses were detected in 35 symptomatic samples collected from five different growing areas, whereas no viruses were detected in 21 non-symptomatic plants, suggesting a high association between these three viruses. Thus, this study provides new knowledge on the diversity and molecular characteristics of viruses in P. lobata plants affected by the viral disease.

First report of ash shoestring-associated virus (ASaV) infecting European ash (Fraxinus excelsior L.) in France.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

Rose Rosette Disease Resistance Loci Detected in Two Interconnected Tetraploid Garden Rose Populations.

Rose rosette disease (RRD), caused by the Rose rosette emaravirus (RRV), is a major threat to the garden rose industry in the United States. There has been limited work on the genetics of host plant resistance to RRV. Two interconnected tetraploid garden rose F1 biparental mapping populations were created to develop high-quality tetraploid rose linkage maps that allowed the discovery of RRD resistance quantitative trait loci (QTLs) on linkage groups (LGs) 5, 6, and 7. These QTLs individually accounted for around 18-40% of the phenotypic variance. The locus with the greatest effect on partial resistance was found in LG 5. Most individuals with the LG 5 QTL were in the simplex configuration; however, two individuals were duplex (likely due to double reduction). Identification of resistant individuals and regions of interest can help the development of diagnostic markers for marker-assisted selection in a breeding program.

Identification of QTLs for Reduced Susceptibility to Rose Rosette Disease in Diploid Roses.

Resistance to rose rosette disease (RRD), a fatal disease of roses (Rosa spp.), is a high priority for rose breeding. As RRD resistance is time-consuming to phenotype, the identification of genetic markers for resistance could expedite breeding efforts. However, little is known about the genetics of RRD resistance. Therefore, we performed a quantitative trait locus (QTL) analysis on a set of inter-related diploid rose populations phenotyped for RRD resistance and identified four QTLs. Two QTLs were found in multiple years. The most consistent QTL is qRRV_TX2WSE_ch5, which explains approximately 20% and 40% of the phenotypic variation in virus quantity and severity of RRD symptoms, respectively. The second, a QTL on chromosome 1, qRRD_TX2WSE_ch1, accounts for approximately 16% of the phenotypic variation for severity. Finally, a third QTL on chromosome 3 was identified only in the multiyear analysis, and a fourth on chromosome 6 was identified in data from one year only. In addition, haplotypes associated with significant changes in virus quantity and severity were identified for qRRV_TX2WSE_ch5 and qRRD_TX2WSE_ch1. This research represents the first report of genetic determinants of resistance to RRD. In addition, marker trait associations discovered here will enable better parental selection when breeding for RRD resistance and pave the way for marker-assisted selection for RRD resistance.

Occurrence and Characterization of Wheat Streak Mosaic Virus Found in Mono- and Mixed Infection with High Plains Wheat Mosaic Virus in Winter Wheat in Ukraine.

Although wheat streak mosaic virus (WSMV) is a well-known pathogen inducing significant crop losses and endangering wheat production worldwide, the recent discovery of High Plains wheat mosaic virus (HPWMoV) in Ukraine raises questions on the co-existence of these two viruses having a similar host range and the same mite vector. Here we report on the screening of winter wheat industrial plantings in several important regions of Ukraine for WSMV and HPWMoV. WSMV was identified in an extremely high number of symptomatic plants (>85%) as compared to HPWMoV detected in 40% of wheat samples. Importantly, the preferred mode of HPWMoV circulation in Ukraine was mixed infection with WSMV (>30%) as opposed to WSMV, which was typically found in monoinfection (60%). Screening wheat varieties for possible virus resistance indicated that all but one were susceptible to WSMV, whereas over 50% of the same varieties were not naturally infected with HPWMoV. Overall, phylogenetic analysis of the collected WSMV and HPWMoV isolates indicated their high identity and similarity to other known isolates of the respective viruses. Here we first characterize WSMV isolates found in winter wheat plants in mono- or mixed infection with HPWMoV, which was recently reported as a typical wheat pathogen in Ukraine.

Advancing the Rose Rosette Virus Minireplicon and Encapsidation System by Incorporating GFP, Mutations, and the CMV 2b Silencing Suppressor.

Plant infecting emaraviruses have segmented negative strand RNA genomes and little is known about their infection cycles due to the lack of molecular tools for reverse genetic studies. Therefore, we innovated a rose rosette virus (RRV) minireplicon containing the green fluorescent protein (GFP) gene to study the molecular requirements for virus replication and encapsidation. Sequence comparisons among RRV isolates and structural modeling of the RNA dependent RNA polymerase (RdRp) and nucleocapsid (N) revealed three natural mutations of the type species isolate that we reverted to the common species sequences: (a) twenty-one amino acid truncations near the endonuclease domain (named delA), (b) five amino acid substitutions near the putative viral RNA binding loop (subT), and (c) four amino acid substitutions in N (NISE). The delA and subT in the RdRp influenced the levels of GFP, gRNA, and agRNA at 3 but not 5 days post inoculation (dpi), suggesting these sequences are essential for initiating RNA synthesis and replication. The NISE mutation led to sustained GFP, gRNA, and agRNA at 3 and 5 dpi indicating that the N supports continuous replication and GFP expression. Next, we showed that the cucumber mosaic virus (CMV strain FNY) 2b singularly enhanced GFP expression and RRV replication. Including agRNA2 with the RRV replicon produced observable virions. In this study we developed a robust reverse genetic system for investigations into RRV replication and virion assembly that could be a model for other emaravirus species.

Temporal Incidence of Eriophyid Mites on Rose Rosette Disease-Symptomatic and -Asymptomatic Roses in Central Georgia, USA.

Phyllocoptes fructiphilus Keifer (Acari: Eriophyidae) is the vector of rose rosette virus (RRV), which causes rose rosette disease (RRD) in North America. The RRD symptoms, such as witches' broom, flower, and leaf deformation, disrupt the aesthetic appearance of plants and cause plant mortality. Because there is no cure for RRV, it is critical to manage the vector and reduce the spread of the virus. The information on the phenology of P. fructiphilus on rose plants is essential to develop management strategies and reduce its spread. Thus, the objectives of the study were to determine 1) the phenology of eriophyid mites (including P. fructiphilus) in central Georgia due to its widespread occurrence in the state and 2) the incidence of eriophyid mites on closed and opened flower buds and other plant parts. In central Georgia, eriophyid mites, including P. fructiphilus were active on both symptomatic and asymptomatic plants from April to December. The mite densities were greater during July and August than during the remaining months on asymptomatic plants. The mites were more abundant on the RRD-symptomatic than on the asymptomatic plants. Similar numbers of eriophyid mites were observed on closed and opened flower buds. Eriophyid mite densities were greater on sepals and leaf bases than on other plant parts.

Exploring in-silico prediction for the development of a RT-qPCR-high resolution melting assay for the broad detection of emaraviruses.

High-resolution melting (HRM) has shown to be reliable for the detection, discrimination, and diagnosis of several diseases of plants, animals, and humans. The aim of this research was to explore the ability to predict HRM outputs when coupled to reverse transcription quantitative polymerase chain reaction (RT-qPCR). This research used the species in the Emaravirus genus as model to framework the development of genus-specific RT-qPCR-HRM assays. A pair of degenerate genus-specific primers were designed for use in endpoint RT-PCR and RT-qPCR-HRM detection of emaraviruses. Eleven species of RNA viruses infecting economically important crops are classified within the genus Emaravirus, family Fimoviridae. There are at least fifteen other non-classified species that may be added. Some of these viruses are spreading rapidly and cause economically important diseases on several crops, raising a need for a sensitive diagnostic technique for taxonomic and quarantine purposes. RT-PCR and RT-qPCR-HRM were able to detect seven emaravirus species in-vitro with sensitivity up to one fg of cDNA. Specific parameters for prediction in-silico of the melting temperatures of each expected emaravirus amplicon are provided and compared to the data obtained in-vitro. A very distinct isolate of the High Plains wheat mosaic virus was also detected. The prediction in-silico of fluorescence of high-resolution DNA melting curves of predicted RT-PCR products using uMeltSM speeded the design and development of RT-qPCR-HRM assay. This approach avoided rounds of HRM tests in-vitro when searching for the optimal regions that provides accurate diagnosis. The resultant assay provided sensitive detection and reliable diagnosis for potentially any emaravirus, including new species or strains.

Full Genome Evolutionary Studies of Wheat Streak Mosaic-Associated Viruses Using High-Throughput Sequencing.

Wheat streak mosaic (WSM), a viral disease affecting cereals and grasses, causes substantial losses in crop yields. Wheat streak mosaic virus (WSMV) is the main causal agent of the complex, but mixed infections with Triticum mosaic virus (TriMV) and High plains wheat mosaic emaravirus (HPWMoV) were reported as well. Although resistant varieties are effective for the disease control, a WSMV resistance-breaking isolate and several potential resistance-breaking isolates have been reported, suggesting that viral populations are genetically diverse. Previous phylogenetic studies of WSMV were conducted by focusing only on the virus coat protein (CP) sequence, while there is no such study for either TriMV or HPWMoV. Here, we studied the genetic variation and evolutionary mechanisms of natural populations of WSM-associated viruses mainly in Kansas fields and fields in some other parts of the Great Plains using high-throughput RNA sequencing. In total, 28 historic and field samples were used for total RNA sequencing to obtain full genome sequences of WSM-associated viruses. Field survey results showed WSMV as the predominant virus followed by mixed infections of WSMV + TriMV. Phylogenetic analyses of the full genome sequences demonstrated that WSMV Kansas isolates are widely distributed in sub-clades. In contrast, phylogenetic analyses for TriMV isolates showed no significant diversity. Recombination was identified as the major evolutionary force of WSMV and TriMV variation in KS fields, and positive selection was detected in some encoding genomic regions in the genome of both viruses. Furthermore, the full genome sequence of a second Kansas HPWMoV isolate was reported. Here, we also identified previously unknown WSMV isolates in the Great Plains sharing clades and high nucleotide sequence similarities with Central Europe isolates. The findings of this study will provide more insights into the genetic structure of WSM-associated viruses and, in turn, help in improving strategies for disease management.

High Plains wheat mosaic virus: An enigmatic disease of wheat and corn causing the High Plains disease.

BRIEF HISTORY: In 1993, severe mosaic and necrosis symptoms were observed on corn (maize) and wheat from several Great Plains states of the USA. Based on the geographical location of infections, the disease was named High Plains disease and the causal agent was tentatively named High Plains virus. Subsequently, researchers renamed this virus as maize red stripe virus and wheat mosaic virus to represent the host and symptom phenotype of the virus. After sequencing the genome of the pathogen, the causal agent of High Plains disease was officially named as High Plains wheat mosaic virus. Hence, High Plains virus, maize red stripe virus, wheat mosaic virus, and High Plains wheat mosaic virus (HPWMoV) are synonyms for the causal agent of High Plains disease. TAXONOMY: High Plains wheat mosaic virus is one of the 21 definitive species in the genus Emaravirus in the family Fimoviridae. VIRION: The genomic RNAs are encapsidated in thread-like nucleocapsids in double-membrane 80-200 nm spherical or ovoid virions. GENOME CHARACTERIZATION: The HPWMoV genome consists of eight single-stranded negative-sense RNA segments encoding a single open reading frame (ORF) in each genomic RNA segment. RNA 1 is 6,981-nucleotide (nt) long, coding for a 2,272 amino acid protein of RNA-dependent RNA polymerase. RNA 2 is 2,211-nt long and codes for a 667 amino acid glycoprotein precursor. RNA 3 has two variants of 1,439- and 1,441-nt length that code for 286 and 289 amino acid nucleocapsid proteins, respectively. RNA 4 is 1,682-nt long, coding for a 364 amino acid protein. RNA 5 and RNA 6 are 1,715- and 1,752-nt long, respectively, and code for 478 and 492 amino acid proteins, respectively. RNA 7 and RNA 8 are 1,434- and 1,339-nt long, code for 305 and 176 amino acid proteins, respectively. BIOLOGICAL PROPERTIES: HPWMoV can infect wheat, corn (maize), barley, rye brome, oat, rye, green foxtail, yellow foxtail, and foxtail barley. HPWMoV is transmitted by the wheat curl mite and through corn seed. DISEASE MANAGEMENT: Genetic resistance against HPWMoV in wheat is not available, but most commercial corn hybrids are resistant while sweet corn varieties remain susceptible. Even though corn hybrids are resistant to virus, it still serves as a green bridge host that enables mites to carry the virus from corn to new crop wheat in the autumn. The main management strategy for High Plains disease in wheat relies on the management of green bridge hosts. Cultural practices such as avoiding early planting can be used to avoid mite buildup and virus infections.

Characterisation and Distribution of Karaka Okahu Purepure Virus-A Novel Emaravirus Likely to Be Endemic to New Zealand.

We report the first emaravirus on an endemic plant of Aotearoa New Zealand that is, to the best of our knowledge, the country's first endemic virus characterised associated with an indigenous plant. The new-to-science virus was identified in the endemic karaka tree (Corynocarpus laevigatus), and is associated with chlorotic leaf spots, and possible feeding sites of the monophagous endemic karaka gall mite. Of the five negative-sense RNA genomic segments that were fully sequenced, four (RNA 1-4) had similarity to other emaraviruses while RNA 5 had no similarity with other viral proteins. A detection assay developed to amplify any of the five RNAs in a single assay was used to determine the distribution of the virus. The virus is widespread in the Auckland area, particularly in mature trees at Okahu Bay, with only occasional reports elsewhere in the North Island. Phylogenetic analysis revealed that its closest relatives are pear chlorotic leaf spot-associated virus and chrysanthemum mosaic-associated virus, which form a unique clade within the genus Emaravirus. Based on the genome structure, we propose this virus to be part of the family Emaravirus, but with less than 50% amino acid similarity to the closest relatives in the most conserved RNA 1, it clearly is a novel species. In consultation with mana whenua (indigenous Maori authority over a territory and its associated treasures), we propose the name Karaka Okahu purepure virus in te reo Maori (the Maori language) to reflect the tree from which it was isolated (karaka), a place where the virus is prevalent (Okahu), and the spotted symptom (purepure, pronounced pooray pooray) that this endemic virus appears to cause.