The Evolution of Nucleic Acid-Based Diagnosis Methods from the (pre-)CRISPR to CRISPR era and the Associated Machine/Deep Learning Approaches in Relevant RNA Design.

Nucleic acid tests (NATs) are considered as gold standard in molecular diagnosis. To meet the demand for onsite, point-of-care, specific and sensitive, trace and genotype detection of pathogens and pathogenic variants, various types of NATs have been developed since the discovery of PCR. As alternatives to traditional NATs (e.g., PCR), isothermal nucleic acid amplification techniques (INAATs) such as LAMP, RPA, SDA, HDR, NASBA, and HCA were invented gradually. PCR and most of these techniques highly depend on efficient and optimal primer and probe design to deliver accurate and specific results. This chapter starts with a discussion of traditional NATs and INAATs in concert with the description of computational tools available to aid the process of primer/probe design for NATs and INAATs. Besides briefly covering nanoparticles-assisted NATs, a more comprehensive presentation is given on the role CRISPR-based technologies have played in molecular diagnosis. Here we provide examples of a few groundbreaking CRISPR assays that have been developed to counter epidemics and pandemics and outline CRISPR biology, highlighting the role of CRISPR guide RNA and its design in any successful CRISPR-based application. In this respect, we tabularize computational tools that are available to aid the design of guide RNAs in CRISPR-based applications. In the second part of our chapter, we discuss machine learning (ML)- and deep learning (DL)-based computational approaches that facilitate the design of efficient primer and probe for NATs/INAATs and guide RNAs for CRISPR-based applications. Given the role of microRNA (miRNAs) as potential future biomarkers of disease diagnosis, we have also discussed ML/DL-based computational approaches for miRNA-target predictions. Our chapter presents the evolution of nucleic acid-based diagnosis techniques from PCR and INAATs to more advanced CRISPR/Cas-based methodologies in concert with the evolution of deep learning (DL)- and machine learning (ml)-based computational tools in the most relevant application domains.

Quantitating primer-template interactions using deconstructed PCR.

When the polymerase chain reaction (PCR) is used to amplify complex templates such as metagenomic DNA using single or degenerate primers, preferential amplification of templates (PCR bias) leads to a distorted representation of the original templates in the final amplicon pool. This bias can be influenced by mismatches between primers and templates, the locations of mismatches, and the nucleotide pairing of mismatches. Many studies have examined primer-template interactions through interrogation of the final products of PCR amplification with controlled input templates. Direct measurement of primer-template interactions, however, has not been possible, leading to uncertainty when optimizing PCR reactions and degenerate primer pools. In this study, we employed a method developed to reduce PCR bias (i.e., Deconstructed PCR, or DePCR) that also provides empirical data regarding primer-template interactions during the first two cycles of PCR amplification. We systematically examined interactions between primers and templates using synthetic DNA templates and varying primer pools, amplified using standard PCR and DePCR protocols. We observed that in simple primer-template systems, perfect match primer-template interactions are favored, particularly when mismatches are close to the 3' end of the primer. In more complex primer-template systems that better represent natural samples, mismatch amplifications can dominate, and heavily degenerate primer pools can improve representation of input templates. When employing the DePCR methodology, mismatched primer-template annealing led to amplification of source templates with significantly lower distortion relative to standard PCR. We establish here a quantitative experimental system for interrogating primer-template interactions and demonstrate the efficacy of DePCR for amplification of complex template mixtures with complex primer pools.

Advancements and applications of loop-mediated isothermal amplification technology: a comprehensive overview.

Loop-mediated isothermal amplification (LAMP) is a novel method for nucleic acid detection known for its isothermal properties, high efficiency, sensitivity, and specificity. LAMP employs 4 to 6 primers targeting 6 to 8 regions of the desired sequence, allowing for amplification at temperatures between 60 and 65°C and the production of up to 109 copies within a single hour. The product can be monitored by various methods such as turbidimetry, fluorometry, and colorimetry. However, it faces limitations such as the risk of non-specific amplification, challenges in primer design, unsuitability for short gene sequences, and difficulty in multiplexing. Recent advancements in polymerase and primer design have enhanced the speed and convenience of the LAMP reaction. Additionally, integrating LAMP with technologies like rolling circle amplification (RCA), recombinase polymerase amplification (RPA), and CRISPR-Cas systems has enhanced its efficiency. The combination of LAMP with various biosensors has enabled real-time analysis, broadening its application in point-of-care testing (POCT). Microfluidic technology has further facilitated the automation and miniaturization of LAMP assays, allowing for the simultaneous detection of multiple targets and preventing contamination. This review highlights advancements in LAMP, focusing on primer design, polymerase engineering, and its integration with other technologies. Continuous improvements and integration of LAMP with complementary technologies have significantly enhanced its diagnostic capabilities, making it a robust tool for rapid, sensitive, and specific nucleic acid detection with promising implications for healthcare, agriculture, and environmental monitoring.

New mitogenomes of Runcinidae and Facelinidae: two understudied heterobranch families (Mollusca: Gastropoda).

Here, we present the mitochondrial sequences of two sea slugs (Heterobranchia): Runcina aurata and Facelina auriculata, the latter being the type species of the family. The mitochondrial genomes are 14,282 and 14,171bp in length, respectively, with a complete set of 13 PCGs, 2 rRNAs, and 22 tRNAs. None of the mitogenomes show gene reorganization, keeping the standard mitogenomic structure of Heterobranchia. Nucleotide composition differs significantly between them, with R. aurata showing the most AT-rich mitogenome (25.7% GC content) reported to date in Heterobranchia, and F. auriculata showing a rich GC content (35%) compared with other heterobranch mitochondrial genomes.

ExonSurfer: a web-tool to design primers at exon-exon junctions.

BACKGROUND: Reverse transcription quantitative PCR (RT-qPCR) with intercalating dyes is one of the main techniques to assess gene expression levels used in basic and applied research as well as in diagnostics. However, primer design for RT-qPCR can be complex due to the high demands on primer quality. Primers are best placed on exon junctions, should avoid polymorphic regions, be specific to the target transcripts and also prevent genomic amplification accurately, among others. Current software tools manage to meet all the necessary criteria only insufficiently. Here, we present ExonSurfer, a novel, user-friendly web-tool for qPCR primer design. RESULTS: ExonSurfer combines the different steps of the primer design process, encompassing target selection, specificity and self-complementarity assessment, and the avoidance of issues arising from polymorphisms. Amplification of potentially contaminating genomic DNA is avoided by designing primers on exon-exon junctions, moreover, a genomic alignment is performed to filter the primers accordingly and inform the user of any predicted interaction. In order to test the whole performance of the application, we designed primer pairs for 26 targets and checked both primer efficiency, amplicon melting temperature and length and confirmed the targeted amplicon by Sanger sequencing. Most of the tested primers accurately and selectively amplified the corresponding targets. CONCLUSION: ExonSurfer offers a comprehensive end-to-end primer design, guaranteeing transcript-specific amplification. The user interface is intuitive, providing essential specificity and amplicon details. The tool can also be used by command line and the source code is available. Overall, we expect ExonSurfer to facilitate RT-qPCR set-up for researchers in many fields.

Design and Validation of Primer Sets for the Detection and Quantification of Antibiotic Resistance Genes in Environmental Samples by Quantitative PCR.

The high prevalence of antibiotic resistant bacteria (ARB) in several environments is a great concern threatening human health. Particularly, wastewater treatment plants (WWTP) become important contributors to the dissemination of ARB to receiving water bodies, due to the inefficient management or treatment of highly antibiotic-concentrated wastewaters. Hence, it is vital to develop molecular tools that allow proper monitoring of the genes encoding resistances to these important therapeutic compounds (antibiotic resistant genes, ARGs). For an accurate quantification of ARGs, there is a need for sensitive and robust qPCR assays supported by a good design of primers and validated protocols. In this study, eleven relevant ARGs were selected as targets, including aadA and aadB (conferring resistance to aminoglycosides); ampC, blaTEM, blaSHV, and mecA (resistance to beta-lactams); dfrA1 (resistance to trimethoprim); ermB (resistance to macrolides); fosA (resistance to fosfomycin); qnrS (resistance to quinolones); and tetA(A) (resistance to tetracyclines). The in silico design of the new primer sets was performed based on the alignment of all the sequences of the target ARGs (orthology grade > 70%) deposited in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, allowing higher coverages of the ARGs' biodiversity than those of several primers described to date. The adequate design and performance of the new molecular tools were validated in six samples, retrieved from both natural and engineered environments related to wastewater treatment. The hallmarks of the optimized qPCR assays were high amplification efficiency (> 90%), good linearity of the standard curve (R2 > 0.980), repeatability and reproducibility across experiments, and a wide linear dynamic range. The new primer sets and methodology described here are valuable tools to upgrade the monitorization of the abundance and emergence of the targeted ARGs by qPCR in WWTPs and related environments.

A full-length 18S ribosomal DNA metabarcoding approach for determining protist community diversity using Nanopore sequencing.

Protist diversity studies are frequently conducted using DNA metabarcoding methods. Currently, most studies have utilized short read sequences to assess protist diversity. One limitation of using short read sequences is the low resolution of the markers. For better taxonomic resolution longer sequences of the 18S rDNA are required because the full-length has both conserved and hypervariable regions. In this study, a new primer pair combination was used to amplify the full-length 18S rDNA and its efficacy was validated with a test community and then validated with field samples. Full-length sequences obtained with the Nanopore MinION for protist diversity from field samples were compared with Illumina MiSeq V4 and V8-V9 short reads. Sequences generated from the high-throughput sequencers are Amplicon Sequence Variants (ASVs). Metabarcoding results show high congruency among the long reads and short reads in taxonomic annotation at the major taxonomic group level; however, not all taxa could be successfully detected from sequences. Based on the criteria of ≥95% similarity and ≥1000 bp query length, 298 genera were identified by all markers in the field samples, 250 (84%) were detected by 18S, while only 226 (76%) by V4 and 213 (71%) by V8-V9. Of the total 85 dinoflagellate genera observed, 19 genera were not defined by 18S dinoflagellate ASVs compared to only three among the total 52 diatom genera. The discrepancy in this resolution is due to the lack of taxonomically available 18S reference sequences in particular for dinoflagellates. Overall, this preliminary investigation demonstrates that application of the full-length 18S rDNA approach can be successful in field studies.

Amplidiff: an optimized amplicon sequencing approach to estimating lineage abundances in viral metagenomes.

BACKGROUND: Metagenomic profiling algorithms commonly rely on genomic differences between lineages, strains, or species to infer the relative abundances of sequences present in a sample. This observation plays an important role in the analysis of diverse microbial communities, where targeted sequencing of 16S and 18S rRNA, both well-known hypervariable genomic regions, have led to insights into microbial diversity and the discovery of novel organisms. However, the variable nature of discriminatory regions can also act as a double-edged sword, as the sought-after variability can make it difficult to design primers for their amplification through PCR. Moreover, the most variable regions are not necessarily the most informative regions for the purpose of differentiation; one should focus on regions that maximize the number of lineages that can be distinguished. RESULTS: Here we present AmpliDiff, a computational tool that simultaneously finds highly discriminatory genomic regions in viral genomes of a single species, as well as primers allowing for the amplification of these regions. We show that regions and primers found by AmpliDiff can be used to accurately estimate relative abundances of SARS-CoV-2 lineages, for example in wastewater sequencing data. We obtain errors that are comparable with using whole genome information to estimate relative abundances. Furthermore, our results show that AmpliDiff is robust against incomplete input data and that primers designed by AmpliDiff also bind to genomes sampled months after the primers were selected. CONCLUSIONS: With AmpliDiff we provide an effective, cost-efficient alternative to whole genome sequencing for estimating lineage abundances in viral metagenomes.

Dig-up Primers: A Pipeline for Identification of Polymorphic Microsatellites Loci within Assemblies of Related Species.

Simple sequence repeats (SSRs) have become one of the most popular molecular markers and are used in numerous fields, including conservation genetics, population genetic studies, and genetic mapping. Advances in next-generation sequencing technology and the growing amount of genomic data are driving the development of bioinformatics tools for SSR marker design. These tools work with different combinations of input data, which can be raw reads or assemblies, and with one or more input datasets. We present here a new strategy and implementation of a simple standalone pipeline that utilizes more than one assembly for the in silico design of PCR primers for microsatellite loci in more than one species. Primers are tested in silico to determine if they are polymorphic, eliminating the need to test time-consuming cross-species amplification in the laboratory. The end result is a set of markers that are in silico polymorphic in all analyzed species and have great potential for the identification of interspecies hybrids. The efficiency of the tool is demonstrated using two examples at different taxonomic levels and with different numbers of input assemblies to generate promising, high-quality SSR markers.

Rapid and cost-effective molecular karyotyping in wheat, barley, and their cross-progeny by chromosome-specific multiplex PCR.

BACKGROUND: Interspecific hybridisation is a powerful tool for increasing genetic diversity in plant breeding programmes. Hexaploid wheat (Triticum aestivum, 2n = 42) × barley (Hordeum vulgare, 2n = 14) intergeneric hybrids can contribute to the transfer of agronomically useful traits by creating chromosome addition or translocation lines as well as full hybrids. Information on the karyotype of hybrid progenies possessing various combinations of wheat and barley chromosomes is thus essential for the subsequent breeding steps. Since the standard technique of chromosome in situ hybridisation is labour-intensive and requires specific skills. a routine, cost-efficient, and technically less demanding approach is beneficial both for research and breeding. RESULTS: We developed a Multiplex Polymerase Chain Reaction (MPCR) method to identify individual wheat and barley chromosomes. Chromosome-specific primer pairs were designed based on the whole genome sequences of 'Chinese Spring' wheat and 'Golden Promise' barley as reference cultivars. A pool of potential primers was generated by applying a 20-nucleotide sliding window with consecutive one-nucleotide shifts on the reference genomes. After filtering for optimal primer properties and defined amplicon sizes to produce an ordered ladder-like pattern, the primer pool was manually curated and sorted into four MPCR primer sets for the wheat A, B, and D sub-genomes, and for the barley genome. The designed MPCR primer sets showed high chromosome specificity in silico for the genome sequences of all 18 wheat and barley cultivars tested. The MPCR primers proved experimentally also chromosome-specific for the reference cultivars as well as for 13 additional wheat and four barley genotypes. Analyses of 16 wheat × barley F1 hybrid plants demonstrated that the MPCR primer sets enable the fast and one-step detection of all wheat and barley chromosomes. Finally, the established genotyping system was fully corroborated with the standard genomic in situ hybridisation (GISH) technique. CONCLUSIONS: Wheat and barley chromosome-specific MPCR offers a fast, labour-friendly, and versatile alternative to molecular cytogenetic detection of individual chromosomes. This method is also suitable for the high-throughput analysis of distinct (sub)genomes, and, in contrast to GISH, can be performed with any tissue type. The designed primer sets proved to be highly chromosome-specific over a wide range of wheat and barley genotypes as well as in wheat × barley hybrids. The described primer design strategy can be extended to many species with precise genome sequence information.

State-of-the-Art Circular RNA Analytics Using the Circtools Software Suite.

Circular RNAs (circRNAs) are types of RNA molecules that have been discovered relatively recently and have been found to be widely expressed in eukaryotic cells. Unlike canonical linear RNA molecules, circRNAs form a covalently closed continuous loop structure without a 5' or 3' end. They are generated by a process called back-splicing, in which a downstream splice donor site is joined to an upstream splice acceptor site. CircRNAs have been found to play important roles in various biological processes, including gene regulation, alternative splicing, and protein translation. They can act as sponges for microRNAs or RNA-binding proteins and can also encode peptides or proteins. Additionally, circRNAs have been implicated in several diseases, including cancer, neurological disorders, and cardiovascular diseases.This protocol provides all necessary steps to detect and analyze circRNAs in silico from RNA sequencing data using the circtools circRNA analytics software suite. The protocol starts from raw sequencing data with circRNA detection via back-splice events and includes statistical testing of circRNAs as well as primer design for follow-up wet lab experiments.

Development of alternative diagnosis of HH1, HH3, HH5 and HCD fertility haplotypes and subfertility syndrome in cattle.

The increasing prevalence of hereditary anomalies in Holstein cattle populations presents a pressing issue, leading to concerns such as embryonic mortality and the birth of non-viable offspring. This study addresses the urgency of managing harmful genetic mutations in Holstein cattle by developing alternative diagnostic methods. The research aims to devise effective means to diagnose fertility haplotypes HH1, HH3, HH5, HCD and BY and subfertility syndrome in cattle. To achieve this goal, a range of molecular genetic techniques were employed, including Tetra-Primer ARMS-PCR methods, PCR-RFLP analysis and allele-specific PCR. These methods facilitated the identification of heterozygous carriers of various fertility haplotypes and subfertility syndrome in Holstein cows and servicing bulls. The study reveals the prevalence of these genetic defects within the Republic of Kazakhstan's cattle population. HH1, HH3, HH5, HCD and BY fertility haplotypes were found to have occurrence rates ranging from 1.4% to 16.6%, with subfertility syndrome detected in 4.5% of Simmental bulls. The practical significance of this research lies in its contribution to genetic monitoring and management strategies for Holstein cattle populations. By introducing affordable, rapid and accurate diagnostic methods, such as the T-ARMS-PCR, the study provides a valuable tool for controlling and mitigating the spread of harmful genetic mutations, ultimately improving the overall genetic health and productivity of Holstein cattle in the region. This research addresses a critical need in the cattle breeding industry and underscores the importance of genetic monitoring to ensure the long-term viability and sustainability of Holstein cattle populations.

GetPrimers: A generalized PCR-based genetic targeting primer designer enabling easy and standardized targeted gene modification across multiple systems.

Genetic targeting (e.g., gene knockout and tagging) based on polymerase chain reaction (PCR) is a simple yet powerful approach for studying gene functions. Although originally developed in classic budding and fission yeast models, the same principle applies to other eukaryotic systems with efficient homologous recombination. One-step PCR-based genetic targeting is conventionally used but the sizes of the homologous arms that it generates for recombination-mediated genetic targeting are usually limited. Alternatively, gene targeting can also be performed via fusion PCR, which can create homologous arms that are orders of magnitude larger, therefore substantially increasing the efficiency of recombination-mediated genetic targeting. Here, we present GetPrimers (https://www.evomicslab.org/app/getprimers/), a generalized computational framework and web tool to assist automatic targeting and verification primer design for both one-step PCR-based and fusion PCR-based genetic targeting experiments. Moreover, GetPrimers by design runs for any given genetic background of any species with full genome scalability. Therefore, GetPrimers is capable of empowering high-throughput functional genomic assays at multipopulation and multispecies levels. Comprehensive experimental validations have been performed for targeting and verification primers designed by GetPrimers across multiple organism systems and experimental setups. We anticipate GetPrimers to become a highly useful and popular tool to facilitate easy and standardized gene modification across multiple systems.

primerJinn: a tool for rationally designing multiplex PCR primer sets for amplicon sequencing and performing in silico PCR.

BACKGROUND: Multiplex PCR amplifies numerous targets in a single tube reaction and is essential in molecular biology and clinical diagnostics. One of its most important applications is in the targeted sequencing of pathogens. Despite this importance, few tools are available for designing multiplex primers. RESULTS: We developed primerJinn, a tool that designs a set of multiplex primers and allows for the in silico PCR evaluation of primer sets against numerous input genomes. We used primerJinn to create a multiplex PCR for the sequencing of drug resistance-conferring gene regions from Mycobacterium tuberculosis, which were then successfully sequenced. CONCLUSIONS: primerJinn provides a user-friendly, efficient, and accurate method for designing multiplex PCR primers for targeted sequencing and performing in silico PCR. It can be used for various applications in molecular biology and bioinformatics research, including the design of assays for amplifying and sequencing drug-resistance-conferring regions in important pathogens.

V-primer: software for the efficient design of genome-wide InDel and SNP markers from multi-sample variant call format (VCF) genotyping data.

DNA markers are indispensable tools in genetics and genomics research as well as in crop breeding, particularly for marker-assisted selection. Recent advances in next-generation sequencing technology have made it easier to obtain genome sequences for various crop species, enabling the large-scale identification of DNA polymorphisms among varieties, which in turn has made DNA marker design more accessible. However, existing primer design software is not suitable for designing many types of genome-wide DNA markers from next-generation sequencing data. Here, we describe the development of V-primer, high-throughput software for designing insertion/deletion, cleaved amplified polymorphic sequence, and single-nucleotide polymorphism (SNP) markers. We validated the applicability of these markers in different crops. In addition, we performed multiplex PCR targeted amplicon sequencing using SNP markers designed with V-primer. Our results demonstrate that V-primer facilitates the efficient and accurate design of primers and is thus a useful tool for genetics, genomics, and crop breeding. V-primer is freely available at https://github.com/ncod3/vprimer.

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence.

BACKGROUND: The COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC). RESULT: The results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500-5,000, 6,500-7,500, and 23,300-25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests. CONCLUSION: This study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.

UPrimer: A Clade-Specific Primer Design Program Based on Nested-PCR Strategy and Its Applications in Amplicon Capture Phylogenomics.

Amplicon capture is a promising target sequence capture approach for phylogenomic analyses, and the design of clade-specific nuclear protein-coding locus (NPCL) amplification primers is crucial for its successful application. In this study, we developed a primer design program called UPrimer that can quickly design clade-specific NPCL amplification primers based on genome data, without requiring manual intervention. Unlike other available primer design programs, UPrimer uses a nested-PCR strategy that greatly improves the amplification success rate of the designed primers. We examined all available metazoan genome data deposited in NCBI and developed NPCL primer sets for 21 metazoan groups with UPrimer, covering a wide range of taxa, including arthropods, mollusks, cnidarians, echinoderms, and vertebrates. On average, each clade-specific NPCL primer set comprises ∼1,000 NPCLs. PCR amplification tests were performed in 6 metazoan groups, and the developed primers showed a PCR success rate exceeding 95%. Furthermore, we demonstrated a phylogenetic case study in Lepidoptera, showing how NPCL primers can be used for phylogenomic analyses with amplicon capture. Our results indicated that using 100 NPCL probes recovered robust high-level phylogenetic relationships among butterflies, highlighting the utility of the newly designed NPCL primer sets for phylogenetic studies. We anticipate that the automated tool UPrimer and the developed NPCL primer sets for 21 metazoan groups will enable researchers to obtain phylogenomic data more efficiently and cost-effectively and accelerate the resolution of various parts of the Tree of Life.

Developing a genetic approach to target cyanobacterial producers of heterocyte glycolipids in the environment.

Heterocytous cyanobacteria are important players in the carbon and nitrogen cycle. They can fix dinitrogen by using heterocytes, specialized cells containing the oxygen-sensitive nitrogenase enzyme surrounded by a thick polysaccharide and glycolipid layer which prevents oxygen diffusion and nitrogenase inactivation. Heterocyte glycolipids can be used to detect the presence of heterocytous cyanobacteria in present-day and past environments, providing insight into the functioning of the studied ecosystems. However, due to their good preservation throughout time, heterocyte glycolipids are not ideal to detect and study living communities, instead methods based on DNA are preferred. Currently cyanobacteria can be detected using untargeted genomic approaches such as metagenomics, or they can be specifically targeted by, for example, the use of primers that preferentially amplify their 16S rRNA gene or their nifH gene in the case of nitrogen fixing cyanobacteria. However, since not all cyanobacterial nitrogen fixers are heterocytous, there is currently no fast gene-based method to specifically detect and distinguish heterocytous cyanobacteria. Here, we developed a PCR-based method to specifically detect heterocytous cyanobacteria by designing primers targeting the gene (hglT) encoding the enzyme responsible for the last step in the biosynthesis of heterocyte glycolipid (i.e., a glycosyltransferase). We designed several primer sets using the publicly available sequences of 23 heterocytous cyanobacteria, after testing them on DNA extracts of 21 heterocyte-forming and 7 non-heterocyte forming freshwater cyanobacteria. The best primer set was chosen and successfully used to confirm the presence of heterocytous cyanobacteria in a marine environmental sample.

Weakly mutually uncorrelated codes with maximum run length constraint for DNA storage.

DNA storage systems have begun to attract considerable attention as next-generation storage technologies due to their high densities and longevity. However, efficient primer design for random-access in synthesized DNA strands is still an issue that needs to be solved. Although previous studies have explored various constraints for primer design in DNA storage systems, there is no attention paid to the combination of weakly mutually uncorrelated codes with the maximum run length constraint. In this paper, we first propose a code design by combining weakly mutually uncorrelated codes with the maximum run length constraint. Moreover, we also explore the weakly mutually uncorrelated codes to satisfy combinations of maximum run length constraint with more constraints such as being almost-balanced and having large Hamming distance, which are also efficient constraints for random-access in DNA storage systems. To guarantee that the proposed codes can be adapted to primer design with variable length, we present modified code construction methods to achieve different lengths of the code. Then, we provide an analysis of the size of the proposed codes, which indicates the capacity to support primer design. Finally, we compare the codes with those of previous works to show that the proposed codes can always guarantee the maximum run length constraint, which is helpful for random-access for DNA storage.

Gene Replacement by a Selectable Marker in the Filamentous FungusMagnaporthe oryzae.

Magnaporthe oryzaeis a filamentous fungus responsible for the detrimental rice blast disease afflicting rice crops worldwide. For years, M. oryzae has served as an excellent model organism to study plant pathogen interactions due to its sequenced genome, its amenability to functional genetics, and its capacity to be tracked in laboratory settings. As such, techniques to genetically manipulate M. oryzae for gene deletion range from genome editing via CRISPR-Cas9 to gene replacement through homologous recombination. This protocol focuses on detailing how to perform gene replacement in the model organism, M. oryzae, through a split marker method. This technique relies on replacing the open reading frame of a gene of interest with a gene conferring resistance to a specific selectable chemical, disrupting the transcription of the gene of interest and generating a knockout mutant M. oryzae strain. Key features Comprehensive overview of primer design, PEG-mediated protoplast transformation, and fungal DNA extraction for screening.