In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor.

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

QSAR-based virtual screening of traditional Chinese medicine for the identification of mitotic kinesin Eg5 inhibitors.

Cell division is a crucial process for the growth and development of all living organisms. Unfortunately, uncontrolled cell division and growth is a hallmark of cancer, leading to the formation of tumors. The Human Eg5 protein, also known as the mitotic kinesin Eg5, plays a vital role in the regulation of cell division and its dysfunction has been linked to cancer development. This study aimed to identify new inhibitors of the Human Eg5 protein. Over 2000 Traditional Chinese Medicine (TCM) compounds were screened through a combination of virtual and structure-based screening methods. The top five compounds (Compounds 1-5) showed improved binding affinity to Human Eg5 compared to the standard drug Monastrol, as demonstrated by docking and MMGBSA scores, as well as interactions with key amino acids GLY 116 and GLY 118. The potential absorption and bioactivity of these compounds were also predicted through ADMET properties and a QSAR model, respectively, and showed improved results compared to the standard. Further quantum mechanics docking confirmed the better binding affinity of the lead compound, Compound 1. Our findings highlight Compound 1-5 as promising hits for inhibiting Human Eg5 and the need for experimental validation of their potential in treating cancer.

Tuning the Biological Activity of PI3Kδ Inhibitor by the Introduction of a Fluorine Atom Using the Computational Workflow.

As a member of the class I PI3K family, phosphoinositide 3-kinase δ (PI3Kδ) is an important signaling biomolecule that controls immune cell differentiation, proliferation, migration, and survival. It also represents a potential and promising therapeutic approach for the management of numerous inflammatory and autoimmune diseases. We designed and assessed the biological activity of new fluorinated analogues of CPL302415, taking into account the therapeutic potential of our selective PI3K inhibitor and fluorine introduction as one of the most frequently used modifications of a lead compound to further improve its biological activity. In this paper, we compare and evaluate the accuracy of our previously described and validated in silico workflow with that of the standard (rigid) molecular docking approach. The findings demonstrated that a properly fitted catalytic (binding) pocket for our chemical cores at the induced-fit docking (IFD) and molecular dynamics (MD) stages, along with QM-derived atomic charges, can be used for activity prediction to better distinguish between active and inactive molecules. Moreover, the standard approach seems to be insufficient to score the halogenated derivatives due to the fixed atomic charges, which do not consider the response and indictive effects caused by fluorine. The proposed computational workflow provides a computational tool for the rational design of novel halogenated drugs.

Isomeric Activity Cliffs-A Case Study for Fluorine Substitution of Aminergic G Protein-Coupled Receptor Ligands.

Currently, G protein-coupled receptors (GPCRs) constitute a significant group of membrane-bound receptors representing more than 30% of therapeutic targets. Fluorine is commonly used in designing highly active biological compounds, as evidenced by the steadily increasing number of drugs by the Food and Drug Administration (FDA). Herein, we identified and analyzed 898 target-based F-containing isomeric analog sets for SAR analysis in the ChEMBL database-FiSAR sets active against 33 different aminergic GPCRs comprising a total of 2163 fluorinated (1201 unique) compounds. We found 30 FiSAR sets contain activity cliffs (ACs), defined as pairs of structurally similar compounds showing significant differences in affinity (≥50-fold change), where the change of fluorine position may lead up to a 1300-fold change in potency. The analysis of matched molecular pair (MMP) networks indicated that the fluorination of aromatic rings showed no clear trend toward a positive or negative effect on affinity. Additionally, we propose an in silico workflow (including induced-fit docking, molecular dynamics, quantum polarized ligand docking, and binding free energy calculations based on the Generalized-Born Surface-Area (GBSA) model) to score the fluorine positions in the molecule.

Identification of novel efflux pump inhibitors for Neisseria gonorrhoeae via multiple ligand-based pharmacophores, e-pharmacophore, molecular docking, density functional theory, and molecular dynamics approaches.

Neisseria gonorrhoeae have progressively developed resistance to almost all antibiotics, and it has become imperative to develop novel approaches to combat its multi-drug resistance. Overexpression of the MtrCDE, an RND family efflux pump, is one of the primary causes of antibiotic resistance in the gonococcus and is considered an important target for combating anti-microbial resistance. PaßN, D13-9001, and other EPIs are identified to target the RND efflux pumps, but due to their cytotoxicity, they have failed in clinical trials. Herein, an extensive pharmacophore-based approach was performed to identify novel EPI inhibitors with improved pharmacology/safety profiles. An integrated computational framework comprising pharmacophore generation, virtual screening using HTVS, SP and XP Glide methodology, MM-GBSA analysis, Induced fit docking, QPLD, DFT, ADMET properties calculation, Molecular Dynamics, and MM-PBSA analysis was performed. The comprehensive study leads to the identification of five non-toxic bioactive compounds, namely - ZINC000008764610, ZINC000030879142, ZINC000030879358, ZINC000253414904, and ZINC000225394671, as potential EPIs for RND efflux pump of Neisseria gonorrhoeae. The five compounds were selected based on the pharmacophore mapping, higher dock score than the known EPIs, binding stability, molecular interactions with the critical residues of MtrD protein, higher ADMET properties, non-toxicity, and free energy estimations. In summary, the analysis led to the identification of five top hits from the natural compound subset of the ZINC database that has a higher binding affinity to the MtrD and adequate physiochemical/pharmacokinetic profile that can be used for the generation of novel EPIs against Neisseria gonorrhoeae.

Phenanthridine Sulfonamide Derivatives as Potential DPP-IV Inhibitors: Design, Synthesis and Biological Evaluation.

BACKGROUND: Diabetes mellitus is a chronic metabolic disorder, characterized by hyperglycemia over a prolonged period, disturbance of fat, protein, and carbohydrate metabolism, resulting from defective insulin secretion, insulin action or both. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are relatively a new class of oral hypoglycemic agents that reduce the deterioration of gutderived endogenous incretin hormones secreted in response to food ingestion to stimulate the secretion of insulin from beta cells of the pancreas. OBJECTIVE: In this study, synthesis, characterization, and biological assessment of twelve novel phenanthridine sulfonamide derivatives 3a-3l as potential DPP-IV inhibitors were carried out. The target compounds were docked to study the molecular interactions and binding affinities against the DPP-IV enzyme. METHODS: The synthesized molecules were characterized using 1H-NMR, 13C-NMR, IR, and MS. Quantum-polarized ligand docking (QPLD) was also performed. RESULTS: In vitro biological evaluation of compounds 3a-3l reveals comparable DPP-IV inhibitory activities ranging from 10%-46% at 100 µM concentration, where compound 3d harboring ortho- fluoro moiety exhibited the highest inhibitory activity. QPLD study shows that compounds 3a-3l accommodate DPP-IV binding site and form H-bonding with the R125, E205, E206, S209, F357, R358, K554, W629, S630, Y631, Y662, R669, and Y752 backbones Conclusion: In conclusion, phenanthridine sulfonamides could serve as potential DPP-IV inhibitors that require further structural optimization in order to enhance their inhibitory activity.

Synthesis, Biological Evaluation, and QPLD Studies of Piperazine Derivatives as Potential DPP-IV Inhibitors.

BACKGROUND: Diabetes mellitus is a serious global health issue, currently affecting 425 million people and is set to affect over 690 million people by 2045. It is a chronic disease characterized by hyperglycemia due to relative or absolute insulin hormone deficiency. Dipeptidyl peptidase- IV (DPP-IV) inhibitors are hypoglycemic agents augmenting the action of the incretin hormones that stimulate insulin secretion from the pancreatic beta cells. OBJECTIVE: In this study, synthesis and biological evaluation of seven piperazine derivatives 3a-g was carried out. METHODS: The synthesized molecules were characterized using proton-nuclear magnetic resonance, carbon-nuclear magnetic resonance, infrared spectroscopy and mass spectrometry. RESULTS: In vitro biological evaluation study showed comparable DPP-IV inhibitory activity for the targeted compounds ranging from 19%-30% at 100 µM concentration. Furthermore, the in vivo hypoglycemic activity of 3d was evaluated using streptozotocin-induced diabetic mice. It was found that compound 3d significantly decreased the blood glucose level when the diabetic group treated with 3d was compared to the control diabetic group. Quantum-Polarized Ligand Docking (QPLD) studies demonstrate that 3a-g fit the binding site of DPP-IV enzyme and form H-bonding with the backbones of R125, E205, E206, K554, W629, Y631, Y662, R669, and Y752. CONCLUSION: Piperazine derivatives were successfully found to be new scaffolds as potential DPP-IV inhibitors.

Chlorine substituents and linker topology as factors of 5-HT6R activity for novel highly active 1,3,5-triazine derivatives with procognitive properties in vivo.

In the light of recent lines of evidence, 5-HT6R ligands are a promising tool for future treatment of memory impairment. Hence, this study has supplied highly potent 5-HT6R agents with procognitive effects, which represent an original chemical class of 1,3,5-triazines, different from widely studied sulfone and indole-like 5-HT6R ligands. The new compounds were rationally designed as modifications of lead, 4-(1-(2-chlorophenoxy)ethyl)-6-(4-methylpiperazin-1-yl)-1,3,5-triazin-2-amine (1), involving an introduction of: (i) two chlorines at benzene ring and (ii) varied linkers joining the triazine ring to aromatic ethers. Synthesis, in vitro and in vivo biological tests and computer-aided SAR analysis for 19 new compounds were carried out. Most of the new triazines displayed high affinity (Ki < 100 nM) and selectivity towards 5-HT6R, with respect to 5-HT2AR, 5-HT7R and D2R. The crystallography-supported docking studies, including quantum-polarized ligand docking (QPLD), indicated that chlorine atoms may be involved in different type of halogen bonding, however, the linker properties seem to predominately affect the 5-HT6R affinity. 4-[1-(2,5-Dichlorophenoxy)propyl]-6-(4-methylpiperazin-1-yl)-1,3,5-triazin-2-amine (9), which displayed: the highest affinity (Ki = 6 nM), very strong 5-HT6R antagonistic action (KB = 27 pM), procognitive effects in vivo in novel object recognition (NOR) test in rats, a very good permeability in PAMPA model and satisfying safety in vitro, was identified as the most potent 1,3,5-triazine agent so far, useful as a new lead for further research.

DPP-IV Inhibitory Phenanthridines: Ligand, Structure-Based Design and Synthesis.

BACKGROUND: Lately, diabetes has become the main health concern for millions of people around the world. Dipeptidyl peptidase-IV (DPP-IV) inhibitors have emerged as a new class of oral antidiabetic agents. Formerly, acridines, N4-sulfonamido-succinamic, phthalamic, acrylic and benzoyl acetic acid derivatives, and sulfamoyl-phenyl acid esters were designed and developed as new DPP-IV inhibitors. OBJECTIVE: This study aims to develop a pharmacophore model of DPP-IV inhibitors and to evaluate phenanthridines as a novel scaffold for inhibiting DPP-IV enzyme. In addition, to assess their binding interactions with the enzyme through docking in the binding site of 4A5S (PDB). METHODS: Herein, Quantum-Polarized Ligand Docking (QPLD) and ligand-based pharmacophore modeling investigations were performed. Three novel 3,8-disubstituted-6-phenyl phenanthridine derivatives 3-5 have been designed, synthesized and characterized. In vitro biological testing against DPP-IV was carried out using fluorometric assay kit. RESULTS: QPLD study demonstrates that compounds 3-5 forms H-bond with Lys554, Trp629, and Tyr631, besides charge transfer interaction between their aromatic rings and the aromatic rings of Tyr547 and Tyr666. Moreover, they fit the three pharmacophoric point features of DPP-IV inhibitors and were proven to have in vitro DPP-IV inhibitory activity where compound 5 displayed a % inhibition of 45.4 at 100 µM concentration. CONCLUSION: Phenanthridines may serve as a potential lead compound for developing new DPP-IV inhibitors as a promising antidiabetic agent. Computational results suggest future structural simplification.

Phosphorus versus Sulfur: Discovery of Benzenephosphonamidates as Versatile Sulfonamide-Mimic Chemotypes Acting as Carbonic Anhydrase Inhibitors.

The first zinc-binding group (ZBG) to have been identified as inhibitor of the metallo-enzymes carbonic anhydrases (CA, EC 4.2.1.1) was the sulfonamide. From then on several classes of zinc-binders have been described. This work reports the benzenephosponamidates as a new chiral aromatic sulfonamide-mimic ZBG able to meet the requirements for effectively binding the enzyme active site. Several low micromolar CA I, II, VII, IX inhibitors were thus detected. Kinetic studies, QM-polarized ligand docking, and MM-GBSA in silico methods were used to characterize this newly identified CA inhibitor chemotype.

Novel amphiphilic pyridinium ionic liquids-supported Schiff bases: ultrasound assisted synthesis, molecular docking and anticancer evaluation.

BACKGROUND: Pyridinium Schiff bases and ionic liquids have attracted increasing interest in medicinal chemistry. RESULTS: A library of 32 cationic fluorinated pyridinium hydrazone-based amphiphiles tethering fluorinated counteranions was synthesized by alkylation of 4-fluoropyridine hydrazone with various long alkyl iodide exploiting lead quaternization and metathesis strategies. All compounds were assessed for their anticancer inhibition activity towards different cancer cell lines and the results revealed that increasing the length of the hydrophobic chain of the synthesized analogues appears to significantly enhance their anticancer activities. Substantial increase in caspase-3 activity was demonstrated upon treatment with the most potent compounds, namely 8, 28, 29 and 32 suggesting an apoptotic cellular death pathway. CONCLUSIONS: Quantum-polarized ligand docking studies against phosphoinositide 3-kinase α displayed that compounds 2-6 bind to the kinase site and form H-bond with S774, K802, H917 and D933.

Development of Potent Inhibitors of the Mycobacterium tuberculosis Virulence Factor Zmp1 and Evaluation of Their Effect on Mycobacterial Survival inside Macrophages.

The enzyme Zmp1 is a zinc-containing peptidase that plays a critical role in the pathogenicity of Mycobacterium tuberculosis. Herein we describe the identification of a small set of Zmp1 inhibitors based on a novel 8-hydroxyquinoline-2-hydroxamate scaffold. Among the synthesized compounds, N-(benzyloxy)-8-hydroxyquinoline-2-carboxamide (1 c) was found to be the most potent Zmp1 inhibitor known to date, and its binding mode was analyzed both by kinetics studies and molecular modeling, identifying critical interactions of 1 c with the zinc ion and residues in the active site. The effect of 1 c on intracellular Mycobacterium survival was assayed in J774 murine macrophages infected with M. tuberculosis H37Rv or M. bovis BCG and human monocyte-derived macrophages infected with M. tuberculosis H37Rv. Cytotoxicity and genotoxicity were also assessed. Overall, inhibitor 1 c displays interesting in vitro antitubercular properties worthy of further investigation.

Structural insights into the binding mode of flavonols with the active site of matrix metalloproteinase-9 through molecular docking and molecular dynamic simulations studies.

Cartilage degradation in rheumatoid arthritis is mediated principally by the collagenases and gelatinases. Gelatinase B (also called matrix metalloproteinase 9 - MMP-9), is a valid target molecule which is known to participate in cartilage degradation as well as angiogenesis associated with the disease and inhibition of its activity shall prevent cartilage damage and angiogenesis. The focus of this study is to investigate the possibilities of MMP-9 inhibition by flavonol class of bioflavonoids by studying their crucial binding interactions at the active site of MMP 9 using molecular docking (Glide XP and QPLD) and further improvisation by post-docking MM-GBSA and molecular dynamic (MD) simulations. The results show that flavonols can convincingly bind to active site of MMP-9 as demonstrated by their stable interactions at the S1' specificity pocket and favourable binding energies. Gossypin has emerged as a promising candidate with a docking score of -14.618 kcal/mol, binding energy of -79.97 kcal/mol and a stable MD pattern over 15 ns. In addition, interaction mechanisms with respect to catalytic site zinc are also discussed. Further, the drug-like characters of the ligands were also analysed using ADME analysis.

Binding affinity models for Falcipain inhibition based on the Linear Interaction Energy method.

The high rate of drug resistance as well as the complex biochemical process of the parasite reproduction cycle makes development of new drugs for malaria a very important but challenging task. Falcipain 2 (FL2) and Falcipain 3 (FL3) are the major cysteine protease enzymes that play a central role in providing essential amino acids for the parasite's protein biosynthesis through the hemoglobin hydrolysis process. Selective inhibition of these enzymes is considered as a promising chemotherapeutic target. In the present investigation, the highly efficient linear interaction energy (LIE) method has been parameterized for binding affinity predictions and assessed with a set of 244 compounds for FL2 and FL3 inhibition. The results revealed that the van der Waals energy is very important for ligands binding to Falcipain proteins and that, overall, the electrostatic energy contribution is minor. The best models obtained for FL2 and FL3 give root mean square errors (RMSE) of 1.82 and 1.33kcal/mol respectively, for the test set. In this study, we also investigate how the choice of initial protein-ligand confirmation (pose) impacts the overall quality of the LIE models. Moreover, the transferability of LIE parameters is further discussed.

High-affinity selective inhibitor against phospholipase A2 (PLA2): a computational study.

Phospholipase A2 (PLA2) is the most abundant protein found in snake venom. PLA2 induces a variety of pharmacological effects such as neurotoxicity, myotoxicity and cardiotoxicity as well as anticoagulant, hemolytic, anti-platelet, hypertensive, hemorrhagic and edema inducing effects. In this study, the three dimensional structure of PLA2 of Naja sputatrix (Malayan spitting cobra) was modeled by I-TASSER, SWISS-MODEL, PRIME and MODELLER programs. The best model was selected based on overall stereo-chemical quality. Further, molecular dynamics simulation was performed to know the stability of the modeled protein using Gromacs software. Average structure was generated during the simulation period of 10 ns. High throughput virtual screening was employed through different databases (Asinex, Hit finder, Maybridge, TOSLab and ZINC databases) against PLA2. The top seven compounds were selected based on the docking score and free energy binding calculations. These compounds were analyzed by quantum polarized ligand docking, induced fit docking and density functional theory calculation. Furthermore, the stability of lead molecules in the active site of PLA2 was employed by MD simulation. The results show that selected lead molecules were highly stable in the active site of PLA2.

Identification of potent inhibitors against snake venom metalloproteinase (SVMP) using molecular docking and molecular dynamics studies.

Snake venom metalloproteinase (SVMP) (Echis coloratus (Carpet viper) is a multifunctional enzyme that is involved in producing several symptoms that follow a snakebite, such as severe local hemorrhage, nervous system effects and tissue necrosis. Because the three-dimensional (3D) structure of SVMP is not known, models were constructed, and the best model was selected based on its stereo-chemical quality. The stability of the modeled protein was analyzed through molecular dynamics (MD) simulation studies. Structure-based virtual screening was performed, and 15 potential molecules with the highest binding energies were selected. Further analysis was carried out with induced fit docking, Prime/MM-GBSA (ΔGBind calculations), quantum-polarized ligand docking, and density functional theory calculations. Further, the stability of the lead molecules in the SVMP-active site was examined using MD simulation. The results showed that the selected lead molecules were highly stable in the active site of SVMP. Hence, these molecules could potentially be selective inhibitors of SVMP. These lead molecules can be experimentally validated, and their backbone structural scaffold could serve as building blocks in designing drug-like molecules for snake antivenom.

Molecular insights on analogs of HIV PR inhibitors toward HTLV-1 PR through QM/MM interactions and molecular dynamics studies: comparative structure analysis of wild and mutant HTLV-1 PR.

Retroviruses HTLV-1 and HIV-1 are the primary causative agents of fatal adult T-cell leukemia and acquired immune deficiency syndrome (AIDS) disease. Both retroviruses are similar in characteristics mechanism, and it encodes for protease that mainly involved in the viral replication process. On the basis of the therapeutic success of HIV-1 PR inhibitors, the protease of HTLV-1 is mainly considered as a potential target for chemotherapy. At the same time, structural similarities in both enzymes that originate HIV PR inhibitors can also be an HTLV-1 PR inhibitor. But the expectations failed because of rejection of HIV PR inhibitors from the HTLV-1 PR binding pocket. In this present study, the reason for the HIV PR inhibitor rejection from the HTLV-1 binding site was identified through sequence analysis and molecular dynamics simulation method. Functional analysis of M37A mutation in HTLV PR clearly shows that the MET37 specificity and screening of potential inhibitors targeting MET37 is performed by using approved 90% similar HIV PR inhibitor compounds. From this approach, we report few compounds with a tendency to accept/donate electron specifically to an important site residue MET37 in HTLV-1 PR binding pocket.

Combined ligand and structure-based approaches on HIV-1 integrase strand transfer inhibitors.

HIV-1 integrase (IN) is an essential enzyme in the viral replication cycle and represents a promising target for anti-HIV drug design. In the present study, pharmacophore modeling and atom-based 3D-QSAR studies were carried out on a series of compounds belonging to dihydroxy isoindole derivatives as HIV-1 IN strand transfer inhibitors. The best pharmacophore model generated consists of six features AADHRR: two hydrogen bond acceptors (A), a hydrogen bond donor (D), a hydrophobic group (H) and two aromatic rings (R). Based on the best pharmacophore model, a statistically valid atom-based 3D-QSAR model was developed. The obtained atom-based 3D-QSAR model has an excellent correlation coefficient value (R(2)=0.87) and also exhibited good predictive power (Q(2)=0.72). The best pharmacophore model was further validated through enrichment calculations and it shows strong predictive power with a high performance in identifying active ligands from the total hits (actives+decoys). QM-polarized ligand docking and molecular dynamics simulations of selected active compounds in the active site of prototype foamy virus intasome gave important insights into the chemical and structural basis involved in the molecular recognition process. The O,O,O donor atom triad of compounds show metal chelation with divalent Mg(2+) ions bound to the three catalytic amino acids in the enzyme's active site and π-stacking interaction with the viral DNA residue DA17. The results might have implications for rational design of specific HIV-1 integrase strand transfer inhibitors with improved affinity and selectivity.

Molecular modeling studies and comparative analysis on structurally similar HTLV and HIV protease using HIV-PR inhibitors.

Retroviruses are most perilous viral family, which cause much damage to the Homo sapiens. HTLV-1 mechanism found to more similar with HIV-1 and both retroviruses are causative agents of severe and fatal diseases including adult T-cell leukemia (ATL) and the acquired immune deficiency syndrome (AIDS). Both viruses code for a protease (PR) that is essential for replication and therefore represents a key target for drugs interfering with viral infection. In this work, the comparative study of HIV-1 and HTLV-1 PR enzymes through sequence and structural analysis is reported along with approved drugs of HIV-PR. Conformation of each HIV PR drugs have been examined with different parameters of interactions and energy scorings parameters. MD simulations with respect to timescale event of 20 ns favors that, few HIV-PR inhibitors can be more active inside the HTLV-1 PR binding pocket. Overall results suggest that, some of HIV inhibitors like Tipranavir, Indinavir, Darunavir and Amprenavir are having good energy levels with HTLV-1. Due to absence of interactions with MET37, here we report that derivatives of these compounds can be much better inhibitors for targeting HTLV-1 proteolytic activity.

Validation of potential inhibitors for SrtA against Bacillus anthracis by combined approach of ligand-based and molecular dynamics simulation.

The development of SrtA inhibitors targeting the biothreat organism namely Bacillus anthracis was achieved by the combined approach of pharmacophore modeling, binding interactions, electron transferring capacity, ADME, and Molecular dynamics studies. In this study, experimentally reported Ba-SrtA inhibitors (pyridazinone and pyrazolethione derivatives) were considered for the development of enhanced pharmacophoric model. The obtained AAAHR hypothesis was a pure theoretical concept that accounts for common molecular interaction network present in experimentally active pyridazinone and pyrazolethione derivatives. Pharmacophore-based screening of AAAHR hypothesis provides several new compounds, and those compounds were treated with four phases of docking protocols with combined Glide-QPLD docking approach. In this approach, scoring and charge accuracy variations were seen to be dominated by QM/MM approach through the allocation of partial charges. Finally, we reported the best compounds from binding db, Chembridge db, and Toslab based on scoring values, energy parameters, electron transfer reaction, ADME, and cell adhesion inhibition activity. The dynamic state of interaction and binding energy assess that new compounds are more active inside the binding pocket and these compounds on experimental validations will survive as better inhibitors for targeting the cell adhesion mechanism of Ba-SrtA.