A packing for A-form DNA in an icosahedral virus.

Studies on viruses infecting archaea living in the most extreme environments continue to show a remarkable diversity of structures, suggesting that the sampling continues to be very sparse. We have used electron cryo-microscopy to study at 3.7-Å resolution the structure of the Sulfolobus polyhedral virus 1 (SPV1), which was originally isolated from a hot, acidic spring in Beppu, Japan. The 2 capsid proteins with variant single jelly-roll folds form pentamers and hexamers which assemble into a T = 43 icosahedral shell. In contrast to tailed icosahedral double-stranded DNA (dsDNA) viruses infecting bacteria and archaea, and herpesviruses infecting animals and humans, where naked DNA is packed under very high pressure due to the repulsion between adjacent layers of DNA, the circular dsDNA in SPV1 is fully covered with a viral protein forming a nucleoprotein filament with attractive interactions between layers. Most strikingly, we have been able to show that the DNA is in an A-form, as it is in the filamentous viruses infecting hyperthermophilic acidophiles. Previous studies have suggested that DNA is in the B-form in bacteriophages, and our study is a direct visualization of the structure of DNA in an icosahedral virus.

Shedding Light on the Hydrolysis Mechanism of cis, trans-[Ru(dmso)4Cl2] Complexes and Their Interactions with DNA-A Computational Perspective.

Using several computational tools such as density functional theory analysis, docking, and MD simulations, we performed a study on cis, trans-[Ru(II)(dmso)4Cl2] complexes, which have therapeutic potential as antimetastatic agents, and their association with DNA. Kohn-Sham energy decomposition analysis reveals that dmso ligands have much smaller interaction energies compared to the chlorido ligands, and their substitution by aquo ligands induces an extra stabilization of the other metal-ligand bonds. Once the complex is hydrolyzed, the aquo ligands have the weakest interactions to the metallic center and therefore are more labile for substitution by a DNA atom. Molecular docking and molecular dynamics were employed to understand the complex preassociation to DNA, pointing to a higher affinity of the hydrolyzed complexes, as well as showing spontaneous binding events during the simulations. Our results are consistent with the experimentally available data that suggest a mechanism in which the complexes are quickly hydrolyzed in solution, before forming cross-links with the DNA molecule. We present a set of methods that could be used to optimize these complexes computationally, aiding in the development of new drugs based on transition metals.

Temperature-Induced Replacement of Phosphate Proton with Metal Ion Captured in Neutron Structures of A-DNA.

Nucleic acids can fold into well-defined 3D structures that help determine their function. Knowing precise nucleic acid structures can also be used for the design of nucleic acid-based therapeutics. However, locations of hydrogen atoms, which are key players of nucleic acid function, are normally not determined with X-ray crystallography. Accurate determination of hydrogen atom positions can provide indispensable information on protonation states, hydrogen bonding, and water architecture in nucleic acids. Here, we used neutron crystallography in combination with X-ray diffraction to obtain joint X-ray/neutron structures at both room and cryo temperatures of a self-complementary A-DNA oligonucleotide d[GTGG(CSe)CAC]2 containing 2'-SeCH3 modification on Cyt5 (CSe) at pH 5.6. We directly observed protonation of a backbone phosphate oxygen of Ade7 at room temperature. The proton is replaced with hydrated Mg2+ upon cooling the crystal to 100 K, indicating that metal binding is favored at low temperature, whereas proton binding is dominant at room temperature.

Kinetics of the B-A transition of DNA: analysis of potential contributions to a reaction barrier.

Because of open problems in the relation between results obtained by relaxation experiments and molecular dynamics simulations on the B-A transition of DNA, relaxation measurements of the B-A dynamics have been extended to a wider range of conditions. Field-induced reaction effects are measured selectively by the magic angle technique using a novel cell construction preventing perturbations from cell window anisotropy. The kinetics was recorded for the case of poly[d(AT)] up to the salt concentration limit of 4.4 mM, where aggregation does not yet interfere. Now experimental data on the B-A dynamics are available for poly[d(AT)] at salt concentrations of 0.18, 0.73, 2.44 and 4.4 mM. In all cases, a spectrum of time constants is found, ranging from ~ 10 µs up to components approaching ~ 1 ms. The relatively small dependence of these data on the salt concentration indicates that electrostatic effects on the kinetics are not as strong as may be expected. The ethanol content at the transition center is a linear function of the logarithm of the salt concentration, and the slope is close to that expected from polyelectrolyte theory. The B-A transition dynamics was also measured in D2O at a salt concentration of 2.4 mM: the center of the transition is found at 20.0 mol/l H2O and at 20.1 mol/l D2O with an estimated accuracy of ± 0.1 mol/l; the spectrum of time constants at the respective transition centers is very similar. The experimental results are discussed regarding the data obtained by molecular dynamics simulations.

Hydration forces between aligned DNA helices undergoing B to A conformational change: In-situ X-ray fiber diffraction studies in a humidity and temperature controlled environment.

Hydration forces between DNA molecules in the A- and B-Form were studied using a newly developed technique enabling simultaneous in situ control of temperature and relative humidity. X-ray diffraction data were collected from oriented calf-thymus DNA fibers in the relative humidity range of 98%-70%, during which DNA undergoes the B- to A-form transition. Coexistence of both forms was observed over a finite humidity range at the transition. The change in DNA separation in response to variation in humidity, i.e. change of chemical potential, led to the derivation of a force-distance curve with a characteristic exponential decay constant of∼2Å for both A- and B-DNA. While previous osmotic stress measurements had yielded similar force-decay constants, they were limited to B-DNA with a surface separation (wall-to-wall distance) typically>5Å. The current investigation confirms that the hydration force remains dominant even in the dry A-DNA state and at surface separation down to∼1.5Å, within the first hydration shell. It is shown that the observed chemical potential difference between the A and B states could be attributed to the water layer inside the major and minor grooves of the A-DNA double helices, which can partially interpenetrate each other in the tightly packed A phase. The humidity-controlled X-ray diffraction method described here can be employed to perform direct force measurements on a broad range of biological structures such as membranes and filamentous protein networks.

Transitions of Double-Stranded DNA Between the A- and B-Forms.

The structure of double-stranded DNA (dsDNA) is sensitive to solvent conditions. In solution, B-DNA is the favored conformation under physiological conditions, while A-DNA is the form found under low water activity. The A-form is induced locally in some protein-DNA complexes, and repeated transitions between the B- and A-forms have been proposed to generate the forces used to drive dsDNA into viral capsids during genome packaging. Here, we report analyses on previous molecular dynamics (MD) simulations on B-DNA, along with new MD simulations on the transition from A-DNA to B-DNA in solution. We introduce the A-B Index (ABI), a new metric along the A-B continuum, to quantify our results. When A-DNA is placed in an equilibrated solution at physiological ionic strength, there is no energy barrier to the transition to the B-form, which begins within about 1 ns. The transition is essentially complete within 5 ns, although occasionally a stretch of a few base pairs will remain A-like for up to ∼10 ns. A comparison of four sequences with a range of predicted A-phobicities shows that more A-phobic sequences make the transition more rapidly than less A-phobic sequences. Simulations on dsDNA with a region of roughly one turn locked in the A-form allow us to characterize the A/B junction, which has an average bend angle of 20-30°. Fluctuations in this angle occur with characteristic times of about 10 ns.

Premeltons in DNA.

Premeltons are examples of emergent-structures (i.e., structural-solitons) that arise spontaneously in DNA due to the presence of nonlinear-excitations in its structure. They are of two kinds: B-B (or A-A) premeltons form at specific DNA-regions to nucleate site-specific DNA melting. These are stationary and, being globally-nontopological, undergo breather-motions that allow drugs and dyes to intercalate into DNA. B-A (or A-B) premeltons, on the other hand, are mobile, and being globally-topological, act as phase-boundaries transforming B- into A-DNA during the structural phase-transition. They are not expected to undergo breather motions. A key feature of both types of premeltons is the presence of an intermediate structural-form in their central regions (proposed as being a transition-state intermediate in DNA-melting and in the B- to A-transition), which differs from either A- or B-DNA. Called beta-DNA, this is both metastable and hyperflexible--and contains an alternating sugar-puckering pattern along the polymer backbone combined with the partial unstacking (in its lower energy-forms) of every-other base-pair. Beta-DNA is connected to either B- or to A-DNA on either side by boundaries possessing a gradation of nonlinear structural-change, these being called the kink and the antikink regions. The presence of premeltons in DNA leads to a unifying theory to understand much of DNA physical chemistry and molecular biology. In particular, premeltons are predicted to define the 5' and 3' ends of genes in naked-DNA and DNA in active-chromatin, this having important implications for understanding physical aspects of the initiation, elongation and termination of RNA-synthesis during transcription. For these and other reasons, the model will be of broader interest to the general-audience working in these areas. The model explains a wide variety of data, and carries with it a number of experimental predictions--all readily testable--as will be described in this review.

Unzipping of A-Form DNA-RNA, A-Form DNA-PNA, and B-Form DNA-DNA in the α-Hemolysin Nanopore.

Unzipping of double-stranded nucleic acids by an electric field applied across a wild-type α-hemolysin (αHL) nanopore provides structural information about different duplex forms. In this work, comparative studies on A-form DNA-RNA duplexes and B-form DNA-DNA duplexes with a single-stranded tail identified significant differences in the blockage current and the unzipping duration between the two helical forms. We observed that the B-form duplex blocks the channel 1.9 ± 0.2 pA more and unzips ∼15-fold more slowly than an A-form duplex at 120 mV. We developed a model to describe the dependence of duplex unzipping on structure. We demonstrate that the wider A-form duplex (d = 2.4 nm) is unable to enter the vestibule opening of αHL on the cis side, leading to unzipping outside of the nanopore with higher residual current and faster unzipping times. In contrast, the smaller B-form duplexes (d = 2.0 nm) enter the vestibule of αHL, resulting in decreased current blockages and slower unzipping. We investigated the effects of varying the length of the single-stranded overhang, and studied A-form DNA-PNA duplexes to provide additional support for the proposed model. This study identifies key differences between A- and B-form duplex unzipping that will be important in the design of future probe-based methods for detecting DNA or RNA.

Characterization of the structural and protein recognition properties of hybrid PNA-DNA four-way junctions.

The objective of this study is to evaluate the structure and protein recognition properties of hybrid four-way junctions (4WJs) composed of DNA and peptide nucleic acid (PNA) strands. We compare a classic immobile DNA junction, J1, vs. six PNA-DNA junctions, including a number with blunt DNA ends and multiple PNA strands. Circular dichroism (CD) analysis reveals that hybrid 4WJs are composed of helices that possess structures intermediate between A- and B-form DNA, the apparent level of A-form structure correlates with the PNA content. The structure of hybrids that contain one PNA strand is sensitive to Mg(+2). For these constructs, the apparent B-form structure and conformational stability (Tm) increase in high Mg(+2). The blunt-ended junction, b4WJ-PNA3, possesses the highest B-form CD signals and Tm (40.1 °C) values vs. all hybrids and J1. Protein recognition studies are carried out using the recombinant DNA-binding protein, HMGB1b. HMGB1b binds the blunt ended single-PNA hybrids, b4WJ-PNA1 and b4WJ-PNA3, with high affinity. HMGB1b binds the multi-PNA hybrids, 4WJ-PNA1,3 and b4WJ-PNA1,3, but does not form stable protein-nucleic acid complexes. Protein interactions with hybrid 4WJs are influenced by the ratio of A- to B-form helices: hybrids with helices composed of higher levels of B-form structure preferentially associate with HMGB1b.

Virology. A virus that infects a hyperthermophile encapsidates A-form DNA.

Extremophiles, microorganisms thriving in extreme environmental conditions, must have proteins and nucleic acids that are stable at extremes of temperature and pH. The nonenveloped, rod-shaped virus SIRV2 (Sulfolobus islandicus rod-shaped virus 2) infects the hyperthermophilic acidophile Sulfolobus islandicus, which lives at 80°C and pH 3. We have used cryo-electron microscopy to generate a three-dimensional reconstruction of the SIRV2 virion at ~4 angstrom resolution, which revealed a previously unknown form of virion organization. Although almost half of the capsid protein is unstructured in solution, this unstructured region folds in the virion into a single extended α helix that wraps around the DNA. The DNA is entirely in the A-form, which suggests a common mechanism with bacterial spores for protecting DNA in the most adverse environments.

The scrunchworm hypothesis: transitions between A-DNA and B-DNA provide the driving force for genome packaging in double-stranded DNA bacteriophages.

Double-stranded DNA bacteriophages have motors that drive the genome into preformed capsids, using the energy released by hydrolysis of ATP to overcome the forces opposing DNA packaging. Viral packaging motors are the strongest of all biological motors, but it is not known how they generate these forces. Several models for the process of mechanochemical force generation have been put forward, but there is no consensus on which, if any, of these is correct. All the existing models assume that protein-generated forces drive the DNA forward. The scrunchworm hypothesis proposes that the DNA molecule is the active force-generating core of the motor, not simply a substrate on which the motor operates. The protein components of the motor dehydrate a section of the DNA, converting it from the B form to the A form and shortening it by about 23%. The proteins then rehydrate the DNA, which converts back to the B form. Other regions of the motor grip and release the DNA to capture the shortening-lengthening motions of the B→A→B cycle ("scrunching"), so that DNA is pulled into the motor and pushed forward into the capsid. This DNA-centric mechanism provides a quantitative physical explanation for the magnitude of the forces generated by viral packaging motors. It also provides a simple explanation for the fact that each of the steps in the burst cycle advances the DNA by 2.5 base pairs. The scrunchworm hypothesis is consistent with a large body of published data, and it makes four experimentally testable predictions.

Chemical inhibitor targeting the replication protein A-DNA interaction increases the efficacy of Pt-based chemotherapy in lung and ovarian cancer.

Platinum-based chemotherapeutics exert their therapeutic efficacy via the formation of DNA adducts which interfere with DNA replication, transcription and cell division and ultimately induce cell death. Repair and tolerance of these Pt-DNA lesions by nucleotide excision repair (NER) and homologous recombination (HR) can substantially reduce the effectiveness of therapy. Inhibition of these repair pathways, therefore, holds the potential to sensitize cancer cells to Pt treatment and increase clinical efficacy. Replication Protein A (RPA) plays essential roles in both NER and HR, along with its role in DNA replication and DNA damage checkpoint activation. Each of these functions is, in part, mediated by RPA binding to single-stranded DNA (ssDNA). Here we report the synthesis and characterization of novel derivatives of RPA small molecule inhibitors and their activity in models of epithelial ovarian cancer (EOC) and non-small cell lung cancer (NSCLC). We have synthesized analogs of our previously reported RPA inhibitor TDRL-505 and determined the structure-activity relationships. These data led us to the identification of TDRL-551, which exhibited a greater than 2-fold increase in in vitro activity. TDRL-551 showed synergy with Pt in tissue culture models of EOC and in vivo efficacy, as a single agent and in combination with platinum, in a NSCLC xenograft model. These data demonstrate the utility of RPA inhibition in EOC and NSCLC and the potential in developing novel anticancer therapeutics that target RPA-DNA interactions.

APTE: identification of indirect read-out A-DNA promoter elements in genomes.

BACKGROUND: Transcriptional regulation is normally based on the recognition by a transcription factor of a defined base sequence in a process of direct read-out. However, the nucleic acid secondary and tertiary structure can also act as a recognition site for the transcription factor in a process known as indirect read-out, although this is much less understood. We have previously identified such a transcriptional control mechanism in early Xenopus development where the interaction of the transcription factor ilf3 and the gata2 promoter requires the presence of both an unusual A-form DNA structure and a CCAAT sequence. Rapid identification of such promoters elsewhere in the Xenopus and other genomes would provide insight into a less studied area of gene regulation, although currently there are few tools to analyse genomes in such ways. RESULTS: In this paper we report the implementation of a novel bioinformatics approach that has identified 86 such putative promoters in the Xenopus genome. We have shown that five of these sites are A-form in solution, bind to transcription factors and fully validated one of these newly identified promoters as interacting with the ilf3 containing complex CBTF. This interaction regulates the transcription of a previously uncharacterised downstream gene that is active in early development. CONCLUSIONS: A Perl program (APTE) has located a number of potential A-form DNA promotor elements in the Xenopus genome, five of these putative targets have been experimentally validated as A-form and as targets for specific DNA binding proteins; one has also been shown to interact with the A-form binding transcription factor ilf3. APTE is available from http://www.port.ac.uk/research/cmd/software/ under the terms of the GNU General Public License.

Conformational preferences of DNA in reduced dielectric environments.

The effect of reduced dielectric environments on the conformational sampling of DNA was examined through molecular dynamics simulations. Different dielectric environments were used to model one aspect of cellular environments. Implicit solvent based on the Generalized Born methodology was used to reflect different dielectric environments in the simulations. The simulation results show a tendency of DNA structures to favor noncanonical A-like conformations rather than canonical A- and B-forms as a result of the reduced dielectric environments. The results suggest that the reduced dielectric response in cellular environments may be sufficient to enhance the sampling of A-like DNA structures compared to dilute solvent conditions.

Melting of DNA nonoriented fibers: a wide-angle X-ray diffraction study.

The melting transition of A- and B-DNA has been investigated by wide-angle X-ray diffraction. A significant crystalline phase is present in both the systems, even if the fibers have not been artificially aligned. The behavior of the intramolecular Bragg peaks of both A- and B-DNA as a function of the temperature clearly reveals the unfolding structural transition of the double helix. This transition occurs at the same temperature as the melting of the crystalline phase. The trends of the intramolecular correlations and the index of crystallinity are nicely described by the Peyrard-Bishop-Dauxois model for DNA melting. A description of the processes taking place at a microscopic level, i.e., double-helix deformation, crystalline dilation, and collapse, on approaching and during thermal melting is proposed.

The Zα domain of fish PKZ converts DNA hairpin with d(GC)(n) inserts to Z-conformation.

PKZ, protein kinase containing Z-DNA domains, is a novel member of the vertebrate eIF2α kinase family. Containing a catalytic domain in C-terminus and two Z-DNA binding domains (Zα1 and Zα2) in N-terminus, PKZ can be activated through the binding of Zα to Z-DNA. However, the regulatory function of PKZ Zα remains to be established. Here, to understand the impact of PKZ Zα on DNA conformational transition, wild-type Zα1Zα2 and 11 mutant proteins were expressed and purified. At the same time, several different lengths of DNA hairpins-d(GC)nT4(GC)n (n = 2-6) and an RNA hairpin-r(GC)6T4(GC)6 were synthesized. The effects of Zα1Zα2 and mutant proteins on the conformation of these synthetic DNA or RNA hairpins were investigated by using circular dichroism spectrum and gel mobility shift assays. The results showed that DNA hairpins retained a conventional B-DNA conformation in the absence of Zα1Zα2, while some of the DNA hairpins (n≥3) were converted to Z-conformation under Zα1Zα2 induction. The tendency was proportionally associated with the increasing amount of GC repeat. In comparison with Zα1Zα2, Zα1Zα1 rather than Zα2Zα2 displayed a higher ability in converting d(GC)6T4(GC)6 from B- to Z-DNA. These results demonstrated that Zα1 sub-domain played a more essential role in the process of B-Z conformational transition than Zα2 sub-domain did. Mutant proteins (K34A, N38A, R39A, Y42A, P57A, P58A, and W60A) could not convert d(GC)6T4(GC)6 into Z-DNA, whereas S35A or K56A retained some partial activities. Interestingly, Zα1Zα2 was also able to induce r(GC)6T4(GC)6 RNA from A-conformation to Z-conformation under appropriate conditions.

DNA self-assembly: from chirality to evolution.

Transient or long-term DNA self-assembly participates in essential genetic functions. The present review focuses on tight DNA-DNA interactions that have recently been found to play important roles in both controlling DNA higher-order structures and their topology. Due to their chirality, double helices are tightly packed into stable right-handed crossovers. Simple packing rules that are imposed by DNA geometry and sequence dictate the overall architecture of higher order DNA structures. Close DNA-DNA interactions also provide the missing link between local interactions and DNA topology, thus explaining how type II DNA topoisomerases may sense locally the global topology. Finally this paper proposes that through its influence on DNA self-assembled structures, DNA chirality played a critical role during the early steps of evolution.

How a DNA polymerase clamp loader opens a sliding clamp.

Processive chromosomal replication relies on sliding DNA clamps, which are loaded onto DNA by pentameric clamp loader complexes belonging to the AAA+ family of adenosine triphosphatases (ATPases). We present structures for the ATP-bound state of the clamp loader complex from bacteriophage T4, bound to an open clamp and primer-template DNA. The clamp loader traps a spiral conformation of the open clamp so that both the loader and the clamp match the helical symmetry of DNA. One structure reveals that ATP has been hydrolyzed in one subunit and suggests that clamp closure and ejection of the loader involves disruption of the ATP-dependent match in symmetry. The structures explain how synergy among the loader, the clamp, and DNA can trigger ATP hydrolysis and release of the closed clamp on DNA.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Changes in the zero-point energy of the protons as the source of the binding energy of water to A-phase DNA.

The measured changes in the zero-point kinetic energy of the protons are entirely responsible for the binding energy of water molecules to A phase DNA at the concentration of 6 water molecules/base pair. The changes in kinetic energy can be expected to be a significant contribution to the energy balance in intracellular biological processes and the properties of nano-confined water. The shape of the momentum distribution in the dehydrated A phase is consistent with coherent delocalization of some of the protons in a double well potential, with a separation of the wells of 0.2 Å.