Development of a species-specific PCR assay for authentication of Agkistrodon acutus based on mitochondrial cytochrome b gene

BACKGROUND: Agkistrodon acutus, a traditional Chinese medicine, clinically used in the treatment of rheumatism, tumor, and cardiovascular and cerebrovascular diseases. Due to the unique medicinal value and the difficulty of artificial breeding of Agkistrodon acutus, the supply of Agkistrodon acutus on the market exceeds the demand, and a large number of its adulterants are found on the market. In this study, the cytb gene sequences of Agkistrodon acutus and 9 snakes were compared and analyzed, specific primers were designed, and specific PCR methods were established to detect Agkistrodon acutus medicinal samples on the market. RESULTS: This method was successfully applied to distinguish the snake from other adulterated species, and tested 18 Agkistrodon acutus samples randomly purchased from six cities. Twelve samples were counterfeit and six were genuine. The standard reference material of Agkistrodon acutus was cloned by molecular cloning and sequencing, and the gene sequence difference with other species was significant. It shows that the region could be used as the fingerprint region of the target species. CONCLUSIONS: The proposed method can be used as a species-specific marker and can be highly distinguished from other adulterated snake species, which is helpful to effectively avoid the problem of false sale of Agkistrodon acutus.

A spatial genomic approach identifies time lags and historical barriers to gene flow in a rapidly fragmenting Appalachian landscape.

The resolution offered by genomic data sets coupled with recently developed spatially informed analyses are allowing researchers to quantify population structure at increasingly fine temporal and spatial scales. However, both empirical research and conservation measures have been limited by questions regarding the impacts of data set size, data quality thresholds and the timescale at which barriers to gene flow become detectable. Here, we used restriction site associated DNA sequencing to generate a 2,140 single nucleotide polymorphism (SNP) data set for the copperhead snake (Agkistrodon contortrix) and address the population genomic impacts of recent and widespread landscape modification across an ~1,000-km2 region of eastern Kentucky, USA. Nonspatial population-based assignment and clustering methods supported little to no population structure. However, using individual-based spatial autocorrelation approaches we found evidence for genetic structuring which closely follows the path of a historically important highway which experienced high traffic volumes from c. 1920 to 1970 before losing most traffic to a newly constructed alternative route. We found no similar spatial genomic signatures associated with more recently constructed highways or surface mining activity, although a time lag effect may be responsible for the lack of any emergent spatial genetic patterns. Subsampling of our SNP data set suggested that similar results could be obtained with as few as 250 SNPs, and a range of thresholds for missing data exhibited limited impacts on the spatial patterns we detected. While we were not able to estimate relative effects of land uses or precise time lags, our findings highlight the importance of temporal factors in landscape genetics approaches, and suggest the potential advantages of genomic data sets and fine-scale, spatially informed approaches for quantifying subtle genetic patterns in temporally complex landscapes.

[Transcriptome analysis of venom gland and identification of functional genes for snake venom protein in Agkistrodon acutus].

Agkistrodon acutus is a traditional Chinese herb medicine which has immunological regulation,anti-tumor,anti-inflammatory and analgesic effects,which is mainly used for the treatment of rheumatoid arthritis,ankylosing spondylitis,sjogren's syndrome and tumors. In order to excavate more important functional genes from A. acutus,the transcriptome of the venom gland was sequenced by the Illumina Hi Seq 4000,and 32 862 unigenes were assembled. Among them,26 589 unigenes were mapped to least one public database. 2 695 unigenes were annotated and assigned to 62 TF families,and 5 920 SSR loci were identified. The majority of mapped unigenes was from Protobothrops mucrosquamatus in the NR database,which revealed their closest homology. Three secretory phospholipase A_2 with different amino acid sequences showed similar spatial structures and all had well-conserved active sites. The 3 D structural models of C-type lectin showed conserved glycosylation binding sites( Asn45). This study will lay the foundation for the further study of the function of snake venom protein,and promoting the development and utilization of genome resources from A. acutus.

Tipping the Scales: The Migration-Selection Balance Leans toward Selection in Snake Venoms.

The migration-selection interaction is the strongest determinant of whether a beneficial allele increases in frequency within a population. Results of empirical studies examining the role of gene flow in an adaptive context, however, have largely been equivocal, with examples of opposing outcomes being repeatedly documented (e.g., local adaptation with high levels of gene flow vs. gene swamping). We compared neutral genomic and venom expression divergence for three sympatric pit vipers with differing ecologies to determine if and how migration-selection disequilibria result in local adaptation. We specifically tested whether neutral differentiation predicted phenotypic differentiation within an isolation-by-distance framework. The decoupling of neutral and phenotypic differentiation would indicate selection led to adaptive divergence irrespective of migration, whereas a significant relationship between neutral and venom expression differentiation would provide evidence in favor of the constraining force of gene flow. Neutral differentiation and geographic distance predicted phenotypic differentiation only in the generalist species, indicating that selection was the predominant mechanism in the migration-selection balance underlying adaptive venom evolution in both specialists. Dispersal is thought to be a stronger influence on genetic differentiation than specialization, but our results suggest the opposite. Greater specialization may lead to greater diversification rates, and extreme spatial and temporal variation in selective pressures can favor generalist phenotypes evolving under strong stabilizing selection. Our results are consistent with these expectations, suggesting that the equivocal findings of studies examining the role of gene flow in an adaptive context may be explained by ecological specialization theory.

Phylogenetic origins for severe acetaminophen toxicity in snake species compared to other vertebrate taxa.

While it has been known for a while that some snake species are extremely sensitive to acetaminophen, the underlying mechanism for this toxicity has not been reported. To investigate if essential detoxification enzymes are missing in snake species that are responsible for biotransformation of acetaminophen in other vertebrate species, livers were collected from a variety of snake species, together with samples from alligator, snapping turtle, cat, rat, and cattle. Subcellular fractions were analyzed for enzymatic activities of phenol-type sulfotransferase and UDP­glucuronosyltransferase, total glutathione S­transferase, and N­acetyltransferase. The results showed that none of the snake species, together with the cat samples, had any phenol-type glucuronidation activity, and that this activity was much lower in alligator and turtle samples than in the mammalian species. Combined with the lack of N­acetyltransferase activity in snakes and cats, this would explain the accumulation of the aminophenol metabolite, which induces methemoglobinemia and subsequent suffocation of snakes and cats after acetaminophen exposure. While previous investigations have concluded that in cats the gene for the phenol-type glucuronosyltransferase isoform has turned into a pseudogene because of several point mutations, evaluation of genomic information for snake species revealed that they have only 2 genes that may code for glucuronosyltransferase isoforms. Similarity of these genes with mammalian genes is <50%, and suggests that the expressed enzymes may act on other types of substrates than aromatic amines. This indicates that the extreme sensitivity for acetaminophen in snakes is based on a different phylogenetic origin than the sensitivity observed in cats.

The Alapahoochee watershed microgeographic structure and its potential influence on metal concentrations and genetic structure in the Florida cottonmouth, Agkistrodon piscivorus conanti, within the watershed.

This study examines the microgeographic structure of the Alapahoochee watershed, part of the Suwannee River basin, south-central GA, USA, and relates it to variations in liver metal concentrations and genetic structure of the Florida cottonmouth, Agkistrodon piscivorus conanti. One objective was to determine if liver metal concentrations in A. piscivorus differ between Grand Bay and Mud creeks, which form the watershed's upper portion. Grand Bay Creek is relatively pristine, whereas Mud Creek is polluted with various metals. Genetic analyses were used to assess possible migration patterns between the creeks indicating whether the basin possesses a single population or two populations. Collections occurred in 2008 and 2009. Specimens were captured, euthanized, or collected as road kills, and liver metal concentrations were analyzed and DNA extracted. No differences in metal concentrations were detected between the creeks, except for nickel in females. Metal concentrations in A. piscivorus were not significantly different between males and females nor show a relationship to body size. Genetic analyses were limited to three primer sets, which amplified informative loci. Locus, CH4B, was highly divergent between the putative populations and particularly informative. Genetic structure indicates potential population isolation within the two creeks. Results suggest that two distinct A. piscivorus populations were present and those populations did not differ in their liver metal concentrations (exception being nickel), despite the differences in environmental metal concentrations in the areas. These findings provide new insight into metal accumulation and detoxification in these animals.

Venomics of New World pit vipers: genus-wide comparisons of venom proteomes across Agkistrodon.

We report a genus-wide comparison of venom proteome variation across New World pit vipers in the genus Agkistrodon. Despite the wide variety of habitats occupied by this genus and that all its taxa feed on diverse species of vertebrates and invertebrate prey, the venom proteomes of copperheads, cottonmouths, and cantils are remarkably similar, both in the type and relative abundance of their different toxin families. The venoms from all the eleven species and subspecies sampled showed relatively similar proteolytic and PLA2 activities. In contrast, quantitative differences were observed in hemorrhagic and myotoxic activities in mice. The highest myotoxic activity was observed with the venoms of A. b. bilineatus, followed by A. p. piscivorus, whereas the venoms of A. c. contortrix and A. p. leucostoma induced the lowest myotoxic activity. The venoms of Agkistrodon bilineatus subspecies showed the highest hemorrhagic activity and A. c. contortrix the lowest. Compositional and toxicological analyses agree with clinical observations of envenomations by Agkistrodon in the USA and Central America. A comparative analysis of Agkistrodon shows that venom divergence tracks phylogeny of this genus to a greater extent than in Sistrurus rattlesnakes, suggesting that the distinct natural histories of Agkistrodon and Sistrurus clades may have played a key role in molding the patterns of evolution of their venom protein genes. BIOLOGICAL SIGNIFICANCE: A deep understanding of the structural and functional profiles of venoms and of the principles governing the evolution of venomous systems is a goal of venomics. Isolated proteomics analyses have been conducted on venoms from many species of vipers and pit vipers. However, making sense of these large inventories of data requires the integration of this information across multiple species to identify evolutionary and ecological trends. Our genus-wide venomics study provides a comprehensive overview of the toxic arsenal across Agkistrodon and a ground for understanding the natural histories of, and clinical observations of envenomations by, species of this genus.

Discovery of highly divergent repeat landscapes in snake genomes using high-throughput sequencing.

We conducted a comprehensive assessment of genomic repeat content in two snake genomes, the venomous copperhead (Agkistrodon contortrix) and the Burmese python (Python molurus bivittatus). These two genomes are both relatively small (∼1.4 Gb) but have surprisingly extensive differences in the abundance and expansion histories of their repeat elements. In the python, the readily identifiable repeat element content is low (21%), similar to bird genomes, whereas that of the copperhead is higher (45%), similar to mammalian genomes. The copperhead's greater repeat content arises from the recent expansion of many different microsatellites and transposable element (TE) families, and the copperhead had 23-fold greater levels of TE-related transcripts than the python. This suggests the possibility that greater TE activity in the copperhead is ongoing. Expansion of CR1 LINEs in the copperhead genome has resulted in TE-mediated microsatellite expansion ("microsatellite seeding") at a scale several orders of magnitude greater than previously observed in vertebrates. Snakes also appear to be prone to horizontal transfer of TEs, particularly in the copperhead lineage. The reason that the copperhead has such a small genome in the face of so much recent expansion of repeat elements remains an open question, although selective pressure related to extreme metabolic performance is an obvious candidate. TE activity can affect gene regulation as well as rates of recombination and gene duplication, and it is therefore possible that TE activity played a role in the evolution of major adaptations in snakes; some evidence suggests this may include the evolution of venom repertoires.

Modular design, expression and characterization of novel bifunctional mutants of fibrolase with combined platelet aggregation-inhibition and fibrinolytic activity.

Fibrolase is a non-hemorrhagic zinc metalloproteinase found in southern copperhead snake (Agkistrodon contortrix contortrix) venom that acts directly on fibrin clots and does not require plasminogen or any other blood-borne intermediate for activity. Chimeras of fibrolase with RGD peptides conferring antiplatelet activity have been synthesized covalently, but we describe a simpler, cheaper and less toxic method, using site-directed mutagensis. Fibrolase variants that constitute the arginine-glycine-aspartic acid (Arg-Gly-Asp, RGD) motif were constructed using site-directed mutagenesis. Chimeric genes of fibrolase were expressed in Escherichia coli to obtain the bifunctional chimeric molecule of fibrolase that can inhibit platelet aggregation. After refolding and purification, platelet-targeted thrombolysis and antiplatelet aggregation of the target chimeric protein were determined. The mutant RGD-F2, using the GPRGDWRMLG peptide to replace the TSVSHD sequence between sites 69 and 72, not only had almost the same catalytic ability as wild-type fibrolase but also a strong ability to inhibit platelet aggregation.

Cloning and characterisation of novel cystatins from elapid snake venom glands.

Snake venoms contain a complex mixture of polypeptides that modulate prey homeostatic mechanisms through highly specific and targeted interactions. In this study we have identified and characterised cystatin-like cysteine-protease inhibitors from elapid snake venoms for the first time. Novel cystatin sequences were cloned from 12 of 13 elapid snake venom glands and the protein was detected, albeit at very low levels, in a total of 22 venoms. One highly conserved isoform, which displayed close sequence identity with family 2 cystatins, was detected in each elapid snake. Crude Austrelaps superbus (Australian lowland copperhead) snake venom inhibited papain, and a recombinant form of A. superbus cystatin inhibited cathepsin L â‰… papain > cathepsin B, with no inhibition observed for calpain or legumain. While snake venom cystatins have truncated N-termini, sequence alignment and structural modelling suggested that the evolutionarily conserved Gly-11 of family 2 cystatins, essential for cysteine protease inhibition, is conserved in snake venom cystatins as Gly-3. This was confirmed by mutagenesis at the Gly-3 site, which increased the dissociation constant for papain by 10(4)-fold. These data demonstrate that elapid snake venom cystatins are novel members of the type 2 family. The widespread, low level expression of type 2 cystatins in snake venom, as well as the presence of only one highly conserved isoform in each species, imply essential housekeeping or regulatory roles for these proteins.

Recombinant expression and affinity purification of snake venom gland parvalbumin in Escherichia coli.

Parvalbumins (PV) are small, acidic, water soluble and calcium-binding proteins generally present in muscular and nervous tissues. In the present study, we identified and characterized a cDNA clone encoding PV, named AplPV, from a snake (Agkistrodon piscivorus leucostoma) venom gland cDNA library. AplPV belongs to EF-hand proteins with six alpha-helices constituting three EF-hand domains. The deduced amino acid sequence of AplPV is 91% and 68% identical to the previously characterized PVs of Boa constrictor and Cyprinus carpio, respectively. The full-length cDNA was subcloned into the expression vector pGEX and transformed into Escherichia coli (E.coli) to produce recombinant protein. The bacterially expressed GST-AplPV fusion protein was highly expressed, and effectively purified by Glutathione-Sepharose affinity chromatography. A high concentration of thrombin protease specifically cleaved and removed the GST tag from fusion protein, and further purified by Benzamidine column for removal of thrombin protease. As a result, the 12 kDa AplPV recombinant protein alone was purified. To investigate the tissue-specific biological occurrence of AplPV, a polyclonal antibody (anti-AplPV-antibody) was raised against GST-AplPV fusion protein in rabbit. Western blot analysis revealed that immunoreactive bands were exhibited in both recombinant protein and samples of venom glands, but not in any crude venom. This specific occurrence indicates a specialized function of AplPV in snake venom glands.

Novel recombinant fibrinogenase of Agkistrodon acutus venom protects against LPS-induced DIC.

INTRODUCTION: Disseminated intravascular coagulation (DIC) is an acquired syndrome characterized by the widespread activation of coagulation. This leads to failure of multiple organs in the body and finally death. Because there is no effective therapy for DIC, the clinical prognosis is poor and the mortality is high. MATERIALS AND METHODS: The animals were intravenously injected with Lipopolysaccharide (LPS) for 6 hours and simultaneously infected three doses of recombinant fibrinogenase II (rFII) for 2 hour. Activated partial thromboplastin time (APTT), prothrombin time (PT), platelets count, fibrinogen and fibrin-fibrinogen degradation products (FDP) were determined. The plasma levels of alanine aminotransferase (ALT), creatinine (Cr) and tumor necrosis factor-alpha (TNF-alpha) were detected. Liver and kidney samples were stained with hematoxylin-eosin and kidney sections were stained with phosphotungstic acid-hematoxylin. RESULTS: We observed that rFII increased survival rate in LPS-induced DIC rabbits as well as heparin did. Administration of rFII as well as heparin attenuated the increased plasma levels of APTT, PT and FDP and the decreased plasma level of fibrinogen at 6 h. rFII reduced hepatic and renal damages and decreased the levels of ALT and Cr as well as heparin did. rFII also significantly reduced the increased plasma levels of TNF-alpha. rFII significantly reduced the kidney fibrin deposits with respect to LPS treated animals. CONCLUSIONS: Our findings suggest that rFII from Agkistrodon acutus venom could have protective effect on DIC via reducing liver and renal damages and direct degradation of microthrombi.

Enzymatic activities and functional characterization of a novel recombinant snake venom proteinase from Agkistrodon acutus.

Snake venom from Agkistrodon acutus consists of a number of compounds which may potentially be used as drugs. However, it is hard to obtain enough pure protein for drug development. Recently, we reported expression and purification of a novel recombinant fibrinogenase which was named rFII. Here we reported for the first time the enzymatic activities and functional characterization of rFII. Circular dichroism spectra showed the gross conformation of FIIa and rFII to be notably similar. It is an alkaline proteinase and the amino acid sequence exhibits a high degree of sequence identity with other snake venom metalloproteinases. rFII also exhibits amidase activity against N-(p-Tosyl)-Gly-Pro-Lys-p-nitroanilide, which is specified synthetic substrate for plasmin. Functional characterization showed that rFII possesses both fibronectin and type IV collagen cleaving activities. In addition, rFII preferentially cleaved the Aalpha-chain of fibrinogen, followed by the Bbeta-chain and finally, the gamma(gamma) chain was affected. Furthermore, rFII was also capable of cleaving fibrin without plasminogen activation and suppressing ADP-induced platelet aggregation. The proteolytic activity of rFII was inhibited completely by PMSF and mostly by EDTA. The cations Ca(2+), Mg(2+), Na(+), K(+) didn't affect its proteolytic activity, while Cu(2+) and Zn(2+) slightly inhibited this activity. Study of hydrolysis of oxidized insulin B-chain reveals that rFII preferentially cleaved oxidized insulin B-chain at the site of Val(12)-Glu(13), Leu(15)-Tyr(16), and Phe(24)-Phe(25).

Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

Unusual accelerated rate of deletions and insertions in toxin genes in the venom glands of the pygmy copperhead (Austrelaps labialis) from Kangaroo island.

BACKGROUND: Toxin profiling helps in cataloguing the toxin present in the venom as well as in searching for novel toxins. The former helps in understanding potential pharmacological profile of the venom and evolution of toxins, while the latter contributes to understanding of novel mechanisms of toxicity and provide new research tools or prototypes of therapeutic agents. RESULTS: The pygmy copperhead (Austrelaps labialis) is one of the less studied species. In this present study, an attempt has been made to describe the toxin profile of A. labialis from Kangaroo Island using the cDNA library of its venom glands. We sequenced 658 clones which represent the common families of toxin genes present in snake venom. They include (a) putative long-chain and short-chain neurotoxins, (b) phospholipase A2, (c) Kunitz-type protease inhibitor, (d) CRISPs, (e) C-type lectins and (f) Metalloproteases. In addition, we have also identified a novel protein with two Kunitz-type domains in tandem similar to bikunin. CONCLUSION: Interestingly, the cDNA library reveals that most of the toxin families (17 out of 43 toxin genes; approximately 40%) have truncated transcripts due to insertion or deletion of nucleotides. These truncated products might not be functionally active proteins. However, cellular transcripts from the same venom glands are not affected. This unusual higher rate of deletion and insertion of nucleotide in toxin genes may be responsible for the lower toxicity of A. labialis venom of Kangroo Island and have significant effect on evolution of toxin genes.

Expression of soluble and functional snake venom fibrinolytic enzyme fibrolase via the co-expression of DsbC in Escherichia coli.

Fibrolase is a non-hemorrhagic zinc metalloproteinase found in southern copperhead snake venom (Agkistrodon contortrix contortrix). It is capable of degrading fibrin clots that result from purified fibrinogen or blood plasma. The DNA of fibrolase was amplified by recursive PCR, and cloned into the pET25b(+) expression vector. The effect of co-expression of signalless versions of catalysts or molecular chaperones FkpA, Skp and DsbC in cytoplasm was examined. When co-expressed with DsbC, compared to the totally insoluble inclusion bodies of fibrolase expressed separately, more than 90 % of recombinant fibrolase was soluble, according to denaturing polyacrylamide gel electrophoresis analysis. We also determined that FkpA and Skp had no effects on the solubility of target protein when co-expressed with fibrolase in Escherichia coli. Fibrolase was successfully purified using metal ion affinity chromatography and hydrophobic chromatography, and a maximum yield of 20 mg/L fibrolase was obtained. Fibrinolytic activity of recombinant fibrolase was demonstrated using fibrin plate assays and fibrinogen hydrolysis.

Genetic variation of a disintegrin gene found in the American copperhead snake (Agkistrodon contortrix).

Disintegrins are small, non-enzymatic proteins produced in snake venom. PCR and DNA sequencing analysis of genomic DNA for all subspecies of the copperhead snake (Agkistrodon contortrix) were analyzed for the presence of a disintegrin gene. Four samples each of the subspecies: A. c. contortrix, A. c. laticinctus, A. c. mokasen, A. c. phaeogaster, and A. c. pictigaster were collected from different locations across their geographic range and analyzed. A single PCR fragment from each sample was obtained, containing exon and intron sequences. The disintegrins identified in this study shared the highest amino acid identity to contortrostatin and acostatin b chain. Neighbor joining analysis of the disintegrin haplotypes and bootstrap tests of significance grouped the A. contortrix subspecies into two clades. The A. c. mokasen samples collected in Kentucky were grouped in one clade, while the A. c. contortrix, A. c. laticinctus, A. c. phaeogaster, and A. c. pictigaster samples collected in Texas, Louisiana, and Missouri were grouped in a different clade. Analysis of molecular variance (AMOVA) and PhiST pairwise comparisons showed significant genetic variation between subspecies. Nucleotide substitution analysis suggests the rapid evolution of disintegrin genes in A. contortrix subspecies.

Expression of a recombinant anticoagulant C-type lectin-like protein ACFI in Pichia pastoris: heterodimerization of two subunits is required for its function.

ACFI is an anticoagulant C-type lectin-like protein (CLP) isolated from Agkistrodon acutus venom. To investigate the function of ACFI and its subunits, the cDNAs of two subunits were transformed and expressed in Pichia pastoris separately or together by a novel strategy using two vectors with different selectable markers. The results showed that recombinant homodimers were secreted when the subunits were expressed alone, while heterodimers (rACFI) were secreted when two subunits were co-expressed. The secreted proteins were purified from culture supernatants in one step by metal-chelating affinity chromatography with the yields of 1-4 mg/L. PAGE and ELISA showed that rACFI competed the binding of native ACFI for human factor X and IX with affinities of 1.6 and 30 nM, respectively. In addition, rACFI prolonged the activated partial thromboplastin time (APTT) in a concentration dependent manner as same as native ACFI. However, recombinant alpha or beta homodimers completely lost these activities, indicating the heterodimerization of two subunits is required for its function. It also suggests that P. pastoris is a promising system for structure-function studies of snake CLPs.

[Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus].

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.

Thrombomodulin-independent activation of protein C and specificity of hemostatically active snake venom serine proteinases: crystal structures of native and inhibited Agkistrodon contortrix contortrix protein C activator.

Protein C activation initiated by the thrombin-thrombomodulin complex forms the major physiological anticoagulant pathway. Agkistrodon contortrix contortrix protein C activator, a glycosylated single-chain serine proteinase, activates protein C without relying on thrombomodulin. The crystal structures of native and inhibited Agkistrodon contortrix contortrix protein C activator determined at 1.65 and 1.54 A resolutions, respectively, indicate the pivotal roles played by the positively charged belt and the strategic positioning of the three carbohydrate moieties surrounding the catalytic site in protein C recognition, binding, and activation. Structural changes in the benzamidine-inhibited enzyme suggest a probable function in allosteric regulation for the anion-binding site located in the C-terminal extension, which is fully conserved in snake venom serine proteinases, that preferentially binds Cl(1-) instead of SO(4)(2-).