Rapid and Ultrasensitive Detection of H. aduncum via the RPA-CRISPR/Cas12a Platform.

Hysterothylacium aduncum is one of six pathogens responsible for human anisakiasis. Infection with H. aduncum can cause acute abdominal symptoms and allergic reactions and is prone to misdiagnosis in clinical practice. This study aims to enhance the efficiency and accuracy of detecting H. aduncum in food ingredients. We targeted the internal transcribed spacer 1 (ITS 1) regions of Anisakis to develop a visual screening method for detecting H. aduncum using recombinase polymerase amplification (RPA) combined with the CRISPR/Cas12a system. By comparing the ITS 1 region sequences of eight nematode species, we designed specific primers and CRISPR RNA (crRNA). The specificity of RPA primers was screened and evaluated, and the CRISPR system was optimized. We assessed its specificity and sensitivity and performed testing on commercial samples. The results indicated that the alternative primer ADU 1 was the most effective. The final optimized concentrations were 250 nM for Cas12a, 500 nM for crRNA, and 500 nM for ssDNA. The complete test procedure was achievable within 45 min at 37 °C, with a limit of detection (LOD) of 1.27 pg/µL. The amplified product could be directly observed using a fluorescence microscope or ultraviolet lamp. Detection results for 15 Anisakis samples were entirely consistent with those obtained via Sanger sequencing, demonstrating the higher efficacy of this method for detecting and identifying H. aduncum. This visual detection method, characterized by simple operation, visual results, high sensitivity, and specificity, meets the requirements for food safety testing and enhances monitoring efficiency.

Genetic analyses of Anisakis pegreffii (Nematoda: Anisakidae) from the East Asian finless porpoise Neophocaena asiaeorientalis sunameri (Cetacea: Phocoenidae) in Korean waters.

The East Asian finless porpoise, Neophocaena asiaeorientalis sunameri, is an endangered species that inhabits the coastal marine environments of East Asia. In the present study, we investigated the overall infection status of anisakid nematodes in East Asian finless porpoises from three sea sectors off the Korean Peninsula. The genetic diversity and population genetic structure of the identified nematode species were evaluated. The prevalence of all stages of anisakid nematodes collected from the stomach was 57.55% (61 among the 106 porpoises examined), and 16 of the hosts were found to have adult worms. The mean number of infected adults was 211 (± 419.54, 5-1455 per host). Only one species of anisakids, Anisakis pegreffii, was identified from randomly selected worms by molecular approaches. Analysis of the mitochondrial (mt) cox2 partial gene in 50 newly generated sequences of A. pegreffii revealed 24 haplotypes, including 14 new haplotypes. We observed below-average levels of nucleotide diversity and haplotype diversity compared to other seas around the world. The mtDNA cox2 haplotypes of the species in the three Korean sea areas showed no genetic structure, suggesting well-connected gene flow within these areas. This study represents the first record of a definitive host of A. pegreffii in Korean waters, providing important information regarding anisakids genetic diversity in the cetacean species inhabiting limited regions.

Anisakid parasite diversity in a pygmy sperm whale, Kogia breviceps (Cetacea: Kogiidae) stranded at the edge of its distribution range in the Northeast Atlantic Ocean.

Anisakid nematodes are a globally distributed group of marine mammal parasites. Kogiid whales, including the pygmy sperm whale Kogia breviceps, host an assemblage of specific anisakid species. Currently, three species are known to be specific to kogiid hosts, i.e., Skrjabinisakis paggiae, S. brevispiculata, and the less studied Pseudoterranova ceticola. The aim of this study was to investigate the species diversity of anisakid nematodes sampled from a pygmy sperm whale stranded in 2013 at the edge of its distribution range in the Northeast Atlantic, specifically in the North of Scotland. Nematodes were assigned to genus level based on morphology and identified by sequence analysis of the mtDNA cox2 gene and the rDNA ITS region. The present finding represents the first observation of syntopic occurrence of adult stages of S. brevispiculata, S. paggiae, and P. ceticola in a pygmy sperm whale in the Northeast Atlantic, and represent the northernmost record of these species in this area. Skrjabinisakis brevispiculata was the most abundant species, accounting for 55% of the identified nematodes, predominantly in the adult stage. Anisakis simplex (s.s.) was also abundant, with most specimens in the preadult stage, followed by S. paggiae and P. ceticola. The pygmy sperm whale is rarely documented in Scottish waters, and its occurrence in the area could suggest expansion of its geographic range. The presence of S. brevispiculata, S. paggiae, and P. ceticola in this whale species in this region may indicate a shift in the whole host community involved in the life cycle of these parasites in northern waters. However, it is also plausible that these parasites were acquired while the whale was feeding in more southern regions, before migrating northbound.

Title: Diversité des parasites Anisakidae chez un cachalot pygmée, Kogia breviceps (Cetacea : Kogiidae) échoué à la limite de son aire de répartition dans l'Atlantique Nord-Est. Abstract: Les nématodes Anisakidae sont un groupe de parasites de mammifères marins réparti dans le monde entier. Les cétacés Kogiidae, y compris le cachalot pygmée Kogia breviceps, hébergent un assemblage d'espèces d'Anisakidae spécifiques. Actuellement, trois espèces sont connues pour être spécifiques aux hôtes Kogiidae, à savoir Skrjabinisakis paggiae, S. brevispiculata et Pseudoterranova ceticola, la moins étudiée. Le but de cette étude était d'étudier la diversité des espèces de nématodes Anisakidae échantillonnés sur un cachalot pygmée échoué en 2013 à la limite de son aire de répartition dans l'Atlantique Nord-Est, plus précisément au nord de l'Écosse. Les nématodes ont été attribués au niveau du genre en fonction de la morphologie et identifiés par analyse de séquence du gène cox2 de l'ADNmt et de la région ITS de l'ADNr. La présente découverte représente la première observation de l'apparition syntopique de stades adultes de S. brevispiculata, S. paggiae et P. ceticola chez un cachalot pygmée dans l'océan Atlantique Nord-Est, et représente le signalement le plus septentrional de ces espèces dans cette zone. Skrjabinisakis brevispiculata était l'espèce la plus abondante, représentant 55% des nématodes identifiés, principalement au stade adulte. Anisakis simplex (s.s.) était également abondant, la plupart des spécimens étant au stade préadulte, suivi par S. paggiae et P. ceticola. Le cachalot pygmée est rarement documenté dans les eaux écossaises et sa présence dans la région pourrait suggérer une expansion de son aire de répartition géographique. La présence de S. brevispiculata, S. paggiae et P. ceticola chez cette espèce de cachalot dans cette région peut indiquer un changement dans l'ensemble de la communauté hôte impliquée dans le cycle de vie de ces parasites dans les eaux nordiques. Cependant, il est également plausible que ces parasites aient été acquis alors que le cachalot se nourrissait dans des régions plus au sud, avant de migrer vers le nord.

Anisakid larvae in the skipjack tuna Katsuwonus pelamis captured in Japanese waters: Two-year monitoring of infection levels after the outbreak of human anisakiasis in 2018.

In 2018, human anisakiasis caused by the ingestion of the skipjack tuna Katsuwonus pelamis occurred frequently in Japan. This may be attributable to a heavy infection of A. simplex (s.s.) in the host's muscle tissue. In this study, we investigate infection levels of anisakid L3 larvae in skipjack tuna captured in Japanese waters afterward (2019-2020) to contribute to predict and prevent the outbreak of human anisakiasis. A total of 476 larvae were detected from 78 out of 85 skipjack tuna captured at 14 stations of the Pacific and East China Sea. The present parasitological survey suggests that infection levels in 2019-2020 were low, comparing that in 2018; in total only seven larvae were found from the host's muscle tissue. The collected larvae were identified by molecular methods to Anisakis berlandi, A. pegreffii, A. simplex (s.s.), A. typica and Skrjabinisakis physeteris (s.l.). Not only larvae of A. simplex (s.s.) but also those of A. berlandi were found from the muscle tissue and thus the latter species may also be a causative agent of human anisakiasis. In addition, this study confirmed the geographic distribution pattern that A. simplex (s.s.) is abundant in the Pacific, while A. pegreffii is dominant in the East China Sea. Our results contribute to understanding the risk of food poisoning and stock delimitation of host animals.

As the Worm Turns-A Rare Cause of Intestinal Obstruction.

BACKGROUND: Anisakiasis, a zoonotic disease caused by the nematode Anisakis, poses a significant concern for public health, particularly in regions with high consumption of raw or undercooked fish. CASE PRESENTATION: We present a case report of a 41-year-old woman who developed severe abdominal symptoms, ultimately diagnosed with intestinal obstruction due to Anisakis infestation, requiring surgery. Despite the absence of prominent eosinophilia or specific radiological findings, the diagnosis was confirmed through histological examination, highlighting the importance of considering anisakiasis in patients with a history of raw seafood consumption. CONCLUSION: The case underscores the diagnostic challenges associated with anisakiasis, emphasizing the need for increased awareness among healthcare professionals and the public regarding the risks of consuming raw or undercooked seafood. Effective management requires a multidisciplinary approach, including clinical assessment, imaging studies, and histological evaluation, to ensure timely diagnosis and appropriate treatment.

Ingestion of fishing gear and Anisakis sp. infection in a beached Indo-Pacific finless porpoise (Neophocaena phocaenoides) in the Jeju Island, Republic of Korea: findings from post-mortem computed tomography and necropsy.

BACKGROUND: Human fishing activities have significantly affect environmental concern for marine ecosystems, conservation of marine mammals, and human health. Coastal cetaceans are highly vulnerable to ingestion of fishing gear, bycatching, or entanglement, all of which can be fatal for these animals. In particular, certain coastal dolphins and porpoises are heavily impacted by fishing gear such as angling gear or stownet, as their food often overlap with the target fish species of human fisheries. CASE PRESENTATION: This study presents a case of an Indo-Pacific finless porpoise (Neophocaena phocaenoides) beached on the coast of Jeju Island, Republic of Korea, with ingestion of fishing gear and severe Anisakis infection. Although this species inhabits waters ranging from the Persian Gulf to Taiwan, several stranded carcasses have been reported on Jeju Island in recent years. Post-mortem computed tomography revealed a bundle of four fishing hooks in the forestomach, along with nylon lines and steel lines with connectors, which were assumed to be angling gear for Jeju hairtail (Trichiurus lepturus). Further necroscopic investigation revealed that the forestomach contained a large number of Anisakis spp. (Nematoda: Anisakidae). Histological examination revealed a thickened forestomach wall with pinpoint and volcanic ulcerations, a thickened layer of stratified squamous epithelium, and infiltrated stroma in the squamous epithelium. CONCLUSIONS: This study emphasizes the urgent need to address the impact of fishing activities on marine mammals, marine litter pollution, and the bycatch problem in Korean seawater. In addition, the occurrence of N. phocaenoides in seawater around Jeju Island should be raised in future geographical ecology or veterinary pathology studies and when its distribution is updated.

Sensitivity of candling as routine method for the detection and recovery of ascaridoids in commercial fish fillets.

Ascaridoids are one of the main parasitic hazards in commercial fish. Candling is the current industrial screening method whereby visible ascaridoid larvae are detected on a light table and manually removed. The aim of this study was to assess the sensitivity (Se) and negative predictive value (NPV) of this method. To make targeted recommendations to the fish industry, the Se was calculated per fish part, larval genus, and fish species. All fish parts (n = 615) were first candled, and larvae were collected, followed by enzymatic digestion to recover the remaining larvae. A fish part was considered positive if at least one larva was detected using candling and/or enzymatic digestion, with both methods combined as reference standard. The overall Se of candling was 31% (95% CI 23-41%) and NPV was 87% (95% CI 85-90%). The Se increased with higher numbers of larvae/100 g infected muscle. A low NPV was found for the belly flaps, therefore we either advise the removal or proper freezing of this part. Lastly, the Se and larval recovery was the highest for the darker and larger Pseudoterranova spp. larvae. Due to the low overall efficacy of candling, further assessment of its cost-benefit and impact on consumers' health risk should be conducted.

The occurrence of Anisakis spp. in Australian waters: past, present, and future trends.

As one of the world's megadiverse countries, Australian biodiversity is vital for global biodiversity. Nematodes belonging to the genus Anisakis (family Anisakidae) are an important part of this biodiversity due to their ability to be repeatedly transmitted among their intermediate hosts before reaching the top of the food pyramid. Therefore, they have a significant impact on the community structures of various ecosystems. In addition, globally, they are known to be of medical and veterinary significance. The aim of this article is to provide an update on the current knowledge about these important parasites in Australia. Since 1916, a total of 234 records of Anisakis spp. from various hosts and localities have been found in Australia. It is estimated that the occurrence of Anisakis spp. and their health impacts in at least 84, 98.5, and 95% of Australian marine mammals, fish, and water birds, respectively, have not been documented yet. The results of this study suggest Australia is perhaps home to the most diverse Anisakis fauna. Available information is dominated by reports of these parasites in fish hosts, many of them among edible fish. Given the popularity of seafood in Australia and the occurrence of infectious stages of Anisakis spp. in edible fish, all stakeholders should be made aware of the occurrence, prevalence, and survival of Anisakis spp. in seafood. Also, as more pet owners feed their pets with a variety of fish and seafood products, it is important for veterinarians to be aware of seafood transmitted Anisakis spp. in pet animals. This study also highlights several important knowledge gaps: (i) The detailed life cycle of Anisakis spp. in Australia is not known. Detecting their first intermediate hosts is important for better management of crustacean zooplankton populations in our waters. (ii) Research on Anisakis spp. in Australia has been restricted to limited taxonomical studies and should extend to other aspects of these important parasites. (iii) The capacity to identify parasite taxa to species is especially important for resolving biological diversity around Australia; however, opportunities to formally train in parasite taxonomy are rare and diminishing. There is a need to train researchers with taxonomy skills. (iv) Given the vast range of biodiversity in Australia and the broad host-specificity of Anisakis spp., particularly in the larval stages, the full range of their intermediate hosts remains unknown. (v) The health impacts of the infection of the intermediate/definitive hosts with Anisakis spp. are not fully understood. Thus, one of the important areas for future studies is investigating the pathogenicity of Anisakis spp. in affected animals. This is a crucial yet unknown factor for the conservation of some endangered species in Australia.

Prevalence and identification of Anisakis nematodes in fish consumed in Marrakesh, Morocco.

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

Species composition and infection levels of Anisakis (Nematoda: Anisakidae) in the skipjack tuna Katsuwonus pelamis (Linnaeus) in the Northwest Pacific.

Parasites can be used as biological tags to assess stock structures in various marine fish species. In the present study, the species composition and infection levels of parasitic nematodes of the genus Anisakis in the skipjack tuna Katsuwonus pelamis were examined in the Northwest Pacific and adjacent seas. A total of 867 third-stage larvae of Anisakis were collected from 112 skipjack tunas captured around Japan and in other subtropical localities. All larvae were identified as A. berlandi, A. pegreffii, A. simplex (s.s.), A. typica, and A. physeteris (s.l.) by the direct sequencing of the mitochondrial cox2 gene and real-time PCR assays targeting the nuclear ITS region. Anisakis species composition differed among northeastern Japan, the Sea of Japan, and other areas (central Japan, the Nansei Islands, and subtropical region), which is largely concordant with previous stock discrimination of skipjack tuna. Molecular phylogenetic analysis resulted in two intraspecific genetic groups in A. simplex (s.s.), one of which occurred almost exclusively in northeastern Japan. This could be a useful indicator for stock discrimination. Skipjack tunas from northeastern Japan were also characterized by a remarkable variety in the intensity of A. simplex (s.s.), suggesting the commingling of individuals with different migration patterns. This idea might be further justified by the geographic distribution of two genetically distinct groups of A. physeteris (s.l.).

Increasing intensities of Anisakis simplex (Rudolphi, 1809 det. Krabbe, 1878) larvae with weight and sea age in returning adult Atlantic salmon, Salmo salar L., of coastal waters of Norway.

Ninety wild Atlantic salmon, Salmo salar L., (1.5-10.3 kg) were caught in the Namsen Fjord near the mouth of River Namsen, mid-Norway, and examined for the presence and distribution of Anisakis simplex (Rudolphi, 1809 det. Krabbe, 1878) larvae by digestion of the viscera and muscles in a pepsin/HCl solution. All salmon were migrating spawners after 1-4 years of feeding in the Atlantic Ocean. All 90 Atlantic salmon had A. simplex larvae in the viscera, and all, except two, had A. simplex larvae in the musculature. The number of A. simplex larvae in each fish varied between 3 and 181, and the total mean number of nematode larvae was 44.5. The intensity of A. simplex larvae was positively correlated with increasing weight and sea age of the host. However, the proportion of larvae in the muscle fillets decreased with increasing host weight and sea age. Atlantic salmon females had more A. simplex larvae than males. In all the fish examined, 70.2% of the A. simplex larvae were found in the viscera and 29.8% in the musculature. The majority (93%) of the larvae in the musculature occurred in the hypaxial sections anterior to the anus. As A. simplex larvae commonly occur in the musculature of wild Atlantic salmon, consumption of unfrozen, raw or semi-raw musculature represents a risk for humans developing anisakiasis.

Genetic identification of Anisakis spp. (Nematoda: Anisakidae) from cetaceans of the Southwestern Atlantic Ocean: ecological and zoogeographical implications.

Adult Anisakis Dujardin, 1845 were found in two specimens of killer whale Orcinus orca and one specimen of franciscana Pontoporia blainvillei stranded from off the coast of Buenos Aires Province, Argentina. Genetic identification of the nematodes (N = 144) was performed by sequence analysis of the mitochondrial (mtDNA cox2) and the nuclear (nas 10 nDNA) gene loci. Anisakis pegreffii and Anisakis berlandi were detected in the two individuals of O. orca, while Anisakis typica and A. pegreffii were identified in P. blainvillei. Morphological and morphometric analysis also carried out on adult specimens of A. pegreffii and A. berlandi has allowed to underlining the usefulness of genetic/molecular markers in their recognition. This represents the first record of A. pegreffii in O. orca and P. blainvillei and of A. berlandi in O. orca. This is also the first sympatric and syntopic occurrence, as adults, of A. pegreffii and A. berlandi from the Austral Region of the Atlantic Ocean waters. These results provide insights into the knowledge of the host ranges and geographical distribution of these parasites in the basin waters of the region. Pontoporia blainvillei showed low abundance values of infection with Anisakis spp., which is the general pattern for coastal dolphins in the area, whereas O. orca harboured higher abundance of Anisakis spp. than those previously recorded among cetacean species in the Argentine Sea. Differences in the Anisakis spp. distribution and their parasitic loads, observed among the three host specimens, are discussed in relation to the oceanographic parameters, as well as to the host ecology. The usefulness of genetic/molecular markers in the recognition of adults of the sibling species A. pegreffii and A. berlandi with considerable overlapping in morphometric and morphological characters was underlined. The distribution of Anisakis species from Southwestern Atlantic waters is discussed in relation to their value as indicators for studies on the zoogeography of their hosts at a regional-scale level.

Intrinsic properties of anisakid nematode larvae as a potential tool for the detection in fish products.

Anisakid nematode larvae (NL) in fish products comprise a risk to human health and, if visible, lead to the rejection of these products by consumers. Therefore, great efforts are being made for the identification of these anisakid larvae to estimate the potential consumer health risk as well as to develop effective detection methods in order to prevent the introduction of heavily infected fish products into the market. The tasks of national reference laboratories include the improvement of detection methods and to promote their further development. As a prerequisite for improved detection, it is important to understand the structural properties of anisakid NL and compounds produced during host-parasite interactions. This review provides an overview of the intrinsic properties of anisakid NL and reports the latest detection methods in published literature. First, in order to define the potentially interesting intrinsic properties of anisakid nematodes for their detection, anatomy and compounds involved in host-parasite interactions are summarised. These can be used for various detection approaches, such as in the medical field or for allergen detection in fish products. In addition, fluorescence characteristics and their use as both established and promising candidates for detection methods, especially in the field of optical sensing technologies, are presented. Finally, different detection and identification methods applied by the fish processing industries and by control laboratories are listed. The review intends to highlight trends and provide suggestions for the development of improved detection and identification methods of anisakid NL in fish products.

Severe laryngeal edema caused by Pseudoterranova species: A case report.

RATIONALE: Severe laryngeal edema can cause upper airway obstruction, which is fatal. Pseudoterranova, an uncommon nematode of the family Anisakidae, predominantly invades the stomach after ingestion of the nematodes in raw or undercooked marine fish. There have been a few reports of development of severe laryngeal edema caused by the nematode invading the base of the tongue. PATIENT CONCERNS: A 69-year-old Japanese woman complained of stuffy and scratchy throat for 8 hours and reported eating sashimi, fresh slices of raw jacopever, 4 days before the first visit. DIAGNOSIS: Endoscopy revealed a white-yellowish wriggling worm at the left side of the base of the tongue and severe edema of the larynx. INTERVENTIONS: The worm was extracted using endoscopic forceps. The patient was hospitalized and treated with intravenous injection of an antibiotic and steroid. OUTCOMES: The symptoms and laryngeal edema disappeared the next day. The worm was identified as a 4th-stage larva of Pseudoterranova spp based on morphologic features. The serum Anisakis-specific IgE antibody level was high, at 38.6 UA/mL. LESSONS: Clinicians should be aware of the possibility of severe laryngeal edema due to invasion by anisakid nematodes in the pharyngolaryngeal area in cases involving previous ingestion of raw or uncooked marine fish.

Analysis of the Prevalence and Species of Anisakis nematode in Sekisaba, Scomber japonicus Caught in Coastal Waters off Saganoseki, Oita in Japan.

Anisakidosis is developed by ingesting Anisakis in marine fish, including the chub mackerel, Scomber japonicus, without proper pre-treatment such as cooking or freezing. Two sibling species of Anisakis are found in S. japonicus from Japanese waters, and the prevalence and species of Anisakis in the fish depend on the sea area. For example, Anisakis simplex sensu stricto (s.s.) is found in the Pacific stock of S. japonicus, whereas A. pegreffii is found in the Tsushima Warm Current stock. S.japonicus caught in the Bungo Channel, off the coast of Saganoseki in Oita Prefecture, which is branded as Sekisaba, inhabits a very limited area; however, the infection states of Anisakis found in Sekisaba remain unclear. In this study, we compared the infection states of Anisakis in Sekisaba with those in S. japonicus caught in the South Oita area and Nagasaki Prefecture. All Anisakis from the Nagasaki Prefecture were A. pegreffii, while most of them found in Sekisaba and fish from the South Oita area were A. simplex s.s. Interestingly, the prevalence of Anisakis in Sekisaba was significantly lower than that in the other two areas. This may reflect the fact that Sekisaba might belong to a distinct stock of S. japonicus, varying from other stocks.

Anisakis simplex (s.s.) larvae (Nematoda: Anisakidae) hidden in the mantle of European flying squid Todarodes sagittatus (Cephalopoda: Ommastrephidae) in NE Atlantic Ocean: Food safety implications.

Few reports exist upon the occurrence and localization of zoonotic anisakid nematodes in T. sagittatus, especially in the mantle of the squid. The occurrence and site of infection of larval anisakids in 98 T. sagittatus caught West off St. Kilda, NE Atlantic Ocean, were investigated. Squids were examined for anisakids using the UV-Press method. In total, 689 nematodes were detected in the viscera and mantle. According to morphology, all the larvae (L3) were assigned to genus Anisakis. Diagnostic allozymes and mtDNA cox2 sequence analysis permitted to genetically identify all larvae as Anisakis simplex (s.s.) (N = 100). Overall prevalence (P = 81%) and mean intensity (mI = 8.6) of infection with A. simplex are provided. Most of the larvae present in the mantle cavity were embedded in the stomach wall or attached in the outer layer of the stomach and caecum (49%). Over a third of squids (37%) hosted A. simplex (s.s.) larvae in the mantle. A novel schematized representation of larvae distribution in the mantle is provided, showing where they were mostly located. According to the results obtained, the risk of anisakiasis associated with consumption of raw or undercooked T. sagittatus should be considered.

Estimation of the number of Anisakis larvae in commercial fish using a descriptive model based on real-time PCR.

BACKGROUND: Seafood parasitation by Anisakis (Anisakidae) larvae has been reported in most of the oceans and seas worldwide. The presence of these nematodes in commonly consumed fish represents a potential hazard for consumers as they can provoke gastrointestinal symptoms and allergic reactions. In the present work, the capacity of a SYBR Green qPCR protocol to quantify Anisakis larvae in commercial fish was evaluated using experimentally spiked samples with different numbers (0-50) of A. simplex third-stage larvae (L3). To verify the agreement of the obtained results, 25 naturally infected fish specimens of Atlantic blue whiting underwent a parallel visual inspection. RESULTS: The logarithmic behavior of the Cq data obtained from the experimentally spiked samples allowed the development of a descriptive mathematical model that correlates the Cq value with the number of Anisakis larvae (R2 = 0.9908, CV = 2.37%). In the commercial blue whiting specimens there was a high correlation between the results of the molecular technique and the visual inspection (R2 = 0.9912); the Bland-Altman analysis showed that 94% of the differences were within the limits of agreement (-4.98 and 6.68), indicating the reliability of the descriptive mathematical model based on the SYBR Green qPCR technique. CONCLUSION: The descriptive function presented based on the SYBR Green qPCR assay is promising as a sensitive and accurate tool for measuring the Anisakis larval load in commercial fish, with a potential application not only in the food industry but also in prevention programs for public health. © 2020 Society of Chemical Industry.