First Insight into the Degradome of Aspergillus ochraceus: Novel Secreted Peptidases and Their Inhibitors.

Aspergillus fungi constitute a pivotal element within ecosystems, serving as both contributors of biologically active compounds and harboring the potential to cause various diseases across living organisms. The organism's proteolytic enzyme complex, termed the degradome, acts as an intermediary in its dynamic interaction with the surrounding environment. Using techniques such as genome and transcriptome sequencing, alongside protein prediction methodologies, we identified putative extracellular peptidases within Aspergillus ochraceus VKM-F4104D. Following manual annotation procedures, a total of 11 aspartic, 2 cysteine, 2 glutamic, 21 serine, 1 threonine, and 21 metallopeptidases were attributed to the extracellular degradome of A. ochraceus VKM-F4104D. Among them are enzymes with promising applications in biotechnology, potential targets and agents for antifungal therapy, and microbial antagonism factors. Thus, additional functionalities of the extracellular degradome, extending beyond mere protein substrate digestion for nutritional purposes, were demonstrated.

Glucose and HODEs regulate Aspergillus ochraceus quorum sensing through the GprC-AcyA pathway.

Aspergillus ochraceus is the traditional ochratoxin A (OTA)-producing fungus with density-dependent behaviors, which is known as quorum sensing (QS) that is mediated by signaling molecules. Individual cells trend to adapt environmental changes in a "whole" flora through communications, allowing fungus to occupy an important ecological niche. Signals perception, transmission, and feedback are all rely on a signal network that constituted by membrane receptors and intracellular effectors. However, the interference of density information in signal transduction, which regulates most life activities of Aspergillus, have yet to be elucidated. Here we show that the G protein-coupled receptor (GPCR) to cAMP pathway is responsible for transmitting density information, and regulates the key point in life cycle of A. ochraceus. Firstly, the quorum sensing phenomenon of A. ochraceus is confirmed, and identified the density threshold is 103 spores/mL, which represents the low density that produces the most OTA in a series quorum density. Moreover, the GprC that classified as sugar sensor, and intracellular adenylate cyclase (AcyA)-cAMP-PKA pathway that in response to ligands glucose and HODEs are verified. Furthermore, GprC and AcyA regulate the primary metabolism as well as secondary metabolism, and further affects the growth of A. ochraceus during the entire life cycle. These studies highlight a crucial G protein signaling pathway for cell communication that is mediated by carbohydrate and oxylipins, and clarified a comprehensive effect of fungal development, which include the direct gene regulation and indirect substrate or energy supply. Our work revealed more signal molecules that mediated density information and connected effects on important adaptive behaviors of Aspergillus ochraceus, hoping to achieve comprehensive prevention and control of mycotoxin pollution from interrupting cell communication.

Effects of Light on the Ochratoxigenic Fungi Aspergillus ochraceus and A. carbonarius.

Ochratoxin A (OTA) usually contaminates agricultural products such as grapes, oatmeal, coffee and spices. Light was reported as an effective strategy to control spoilage fungi and mycotoxins. This research investigated the effects of light with different wavelengths on the growth and the production of OTA in Aspergillus ochraceus and Aspergillus carbonarius. The results showed that the growth of both fungi were extremely inhibited by UV-B. Short-wavelength (blue, violet) significantly inhibited the production of OTA in both fungi, while the inhibitory effect of white was only demonstrated on A. ochraceus. These results were supported by the expression profiles of OTA biosynthetic genes of A. ochraceus and A. carbonarius. To clarify, the decrease in OTA production is induced by inhibition or degradation; therefore, the degradation of OTA under different wavelengths of light was tested. Under UV-B, the degradation rate of 10 µg/mL OTA standard pure-solution samples could reach 96.50% in 15 days, and the degradation effect of blue light was relatively weak. Furthermore, infection experiments of pears showed that the pathogenicity of both fungi was significantly decreased under UV-B radiation. Thus, these results suggested that light could be used as a potential target for strategies in the prevention and control of ochratoxigenic fungi.

iTRAQ proteome analysis of the antifungal mechanism of citral on mycelial growth and OTA production in Aspergillus ochraceus.

BACKGROUND: Aspergillus ochraceus causes food spoilage and produces mycotoxin ochratoxin A (OTA) during storage of agricultural commodities. In this study, citral was used to inhibit A. ochraceus growth and OTA accumulation, proteomic analysis was employed to verify the mechanism of citral. RESULTS: Citral was found to significantly inhibit fungal growth and mycotoxin production in A. ochraceus. Specifically, 75, 125, 150 and 200 µL L-1 citral suppressed mycelial growth by 33%, 46%, 50% and 100%, respectively. Additionally, 75 µL L-1 citral inhibited OTA accumulation by 25%. Proteomic analysis was performed to elucidate the inhibitory mechanism of citral on mycelial growth and OTA production at subinhibitory concentrations (75 µL L-1 ). Proteomics analysis identified 2646 proteins in A. ochraceus fc-1, of which 218 were differentially expressed between control and 75 µL L-1 citral treatment samples. Differentially expressed proteins were identified by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses of biological process, cellular component and molecular function terms. Potential factors affecting mycelial growth and OTA production were analysed, and OTA production was revealed to be a complex process involving many associated factors related to various processes including nutrient intake, sterol biosynthesis, ribosome biogenesis, energy metabolism, oxidative stress and amino acid metabolism. In addition, citral at 75 µL L-1 down-regulated OTA biosynthetic genes including pks and nrps, but slightly up-regulated the global regulatory factors veA, velB and laeA. CONCLUSION: The findings further demonstrate the potential of citral for the preservation of grains and other agricultural products, and provide new insight into its antifungal mechanisms at subinhibitory concentrations. © 2021 Society of Chemical Industry.

Improved 11α-hydroxycanrenone production by modification of cytochrome P450 monooxygenase gene in Aspergillus ochraceus.

Eplerenone is a drug that protects the cardiovascular system. 11α-Hydroxycanrenone is a key intermediate in eplerenone synthesis. We found that although the cytochrome P450 (CYP) enzyme system in Aspergillus ochraceus strain MF018 could catalyse the conversion of canrenone to 11α-hydroxycanrenone, its biocatalytic efficiency is low. To improve the efficiency of 11α-hydroxycanrenone production, the CYP monooxygenase-coding gene of MF018 was predicted and cloned based on whole-genome sequencing results. A recombinant A. ochraceus strain MF010 with the high expression of CYP monooxygenase was then obtained through homologous recombination. The biocatalytic rate of this recombinant strain reached 93 % at 60 h without the addition of organic solvents or surfactants and was 17-18 % higher than that of the MF018 strain. Moreover, the biocatalytic time of the MF010 strain was reduced by more than 30 h compared with that of the MF018 strain. These results show that the recombinant A. ochraceus strain MF010 can overcome the limitation of substrate biocatalytic efficiency and thus holds a high poten tial for application in the industrial production of eplerenone.

Carbon Catabolite Repression Gene AoCreA Regulates Morphological Development and Ochratoxin A Biosynthesis Responding to Carbon Sources in Aspergillus ochraceus.

Carbon is one of the most important nutrients for the development and secondary metabolism in fungi. CreA is the major transcriptional factor mediating carbon catabolite repression, which is employed in the utilization of carbon sources. Aspergillus ochraceus contaminates various food and feed containing different carbon sources by producing ochratoxin A (OTA). However, little is known about the function of AoCreA in regulating the morphology and OTA production of A. ochraceus. To give an insight into the mechanism of the carbon sources regulating development of A. ochraceus and OTA production, we have identified AoCreA in A. ochraceus. The homologous recombination strategy was used to generate the AoCreA deletion mutant (ΔAoCreA). We have investigated the morphology and OTA production of the wild type (WT) and ΔAoCreA of A. ochraceus with media containing different carbon sources (glucose, fructose, maltose, D-xylose, D-mannose, acetate, D-galactose, D-mannitol and lactose). ΔAoCreA showed a significant growth and conidiation defect on all media as compared with WT. Glucose and maltose were the most inducing media for OTA production by A. ochraceus, followed by sucrose and the nutrient-rich Yeast Extract Sucrose (YES) and Potato Dextrose Agar (PDA). The deletion of AoCreA led to a drastic reduction of OTA production on all kinds of media except PDA, which was supported by the expression profile of OTA biosynthetic genes. Furthermore, infection studies of ΔAoCreA on oats and pears showed the involvement of AoCreA in the pathogenicity of A. ochraceus. Thus, these results suggest that AoCreA regulates morphological development and OTA biosynthesis in response to carbon sources in A. ochraceus.

Differentiation and quantification of the ochratoxin A producers Aspergillus ochraceus and Aspergillus westerdijkiae using PCR-DGGE.

Ochratoxin A (OTA) is a nephrotoxic, teratogenic, immunotoxic, and carcinogenic mycotoxin which is produced in tropical zones mainly by Aspergillus carbonarius, A. niger, A. ochraceus, and A. westerdijkiae. A. ochraceus and A. westerdijkiae species are phenotypically and genomically very close but A. westerdijkiae produce OTA at a very higher level than A. ochraceus. These species have been differentiated recently. The DNA primer pairs which were drawn so far are not specific and a genomic region of the same size is amplified for both species or they are too specific, and in this case, the DNA of a single species is amplified. To help preventing OTA contamination of foodstuffs, the PCR-DGGE (Denaturing Gradient Gel Electrophoresis) method was used to discriminate between A. ochraceus and A. westerdijkiae DNA fragments of the same size but with different sequences and thus faster access to a diagnosis of the toxigenic potential of the fungal microflora. The proposed methodology was able to differentiate A. westerdijkiae from A. ochraceus with only one primer pairs in a single run. A calibration based on initial DNA content was obtained from image analysis of the DGGE gels and a method of quantification of the two strains was proposed.

Antifungal Activity of Essential Oil Compounds (Geraniol and Citral) and Inhibitory Mechanisms on Grain Pathogens (Aspergillus flavus and Aspergillus ochraceus).

The grain contamination by Aspergillus spp. has been a serious issue. This study exhibited the excellent antifungal effects of the essential oil compounds (EOCs) geraniol and citral against common grain pathogens (A. flavus and A. ochraceus) in vitro and in situ. The inhibitory mechanisms were also evaluated from the perspective of cell membrane permeability, reactive oxygen species (ROS) generation, and Aspergillus spp. growth-related gene expression. Meanwhile, the combined effects of EOCs in the vapor phase and modified atmosphere packaging (MAP) were examined to find an alternative preservation method for controlling Aspergillus spp. The results indicated that citral exhibited the antifungal activity mainly by downregulating the sporulation- and growth-related genes for both pathogens. Geraniol displayed inhibitory effectiveness against A. flavus predominantly by inducing the intracellular ROS accumulation and showed toxicity against A. ochraceus principally by changing cell membrane permeability. Furthermore, the synthetic effects of EOCs and MAP (75% CO2 and 25% N2) induced better grain quality than the current commercial fumigant AlP. These findings reveal that EOCs have potential to be a novel grain preservative for further application.

Effect of Cinnamaldehyde on Morphological Alterations of Aspergillus ochraceus and Expression of Key Genes Involved in Ochratoxin A Biosynthesis.

Ochratoxin A (OTA) is a potent nephrotoxic, hepatotoxic, and teratogenic compound which is a significant mycotoxin contaminates cereals during storage. Aspergillus ochraceus is the most common producer of OTA in cereals and cereal-derived products. Cinnamaldehyde is a natural substance derived from plant cinnamon playing an important role in the reduction of OTA contamination. In this study, the antifungal and antitoxigenic effect of cinnamaldehyde was investigated with its mechanisms of inhibition of fungal growth at the morphological and ultrastructural levels, and inhibition of OTA biosynthesis at the transcriptional level. Significant A. ochraceus growth was inhibited at 0.4⁻1.6 mmol/L with fumigation. A. ochraceus exposed to 0.4 mmol/L of cinnamaldehyde indicated irreversible harmful morphological and ultrastructural modifications such as the folding of the cell, the loss of integrity of the cell wall, the disruption of plasma membrane, the destruction of the mitochondria, and the absence of intracellular organelles. These alterations may be attributed to its inhibition of enzymatic reactions that regulate cell wall synthesis, thus disturbing the morphogenesis and growth of A. ochraceus. In the presence of cinnamaldehyde, the tested biosynthetic and regulatory genes like pks, nrps, veA, laeA and velB were highly downregulated. Moreover, the downregulation effect of cinnamaldehyde increased proportionally with the concentrations. These results suggest that the decrease of OTA production by cinnamaldehyde is attributed to the downregulation of the transcriptional levels of OTA biosynthetic and regulatory genes besides the inhibition of fungal growth. The study reveals the mechanisms of the antifungal and antitoxigenic activities of cinnamaldehyde against A. ochraceus, and further emphasizes that cinnamaldehyde could be a safe and effective natural agents against OTA contamination during cereals storage.

A Consensus Ochratoxin A Biosynthetic Pathway: Insights from the Genome Sequence of Aspergillus ochraceus and a Comparative Genomic Analysis.

Ochratoxin A (OTA) is a toxic secondary metabolite produced by Aspergillus and Penicillium species that widely contaminates food and feed. We sequenced and assembled the complete ∼37-Mb genome of Aspergillusochraceus fc-1, a well-known producer of OTA. Key genes of the OTA biosynthetic pathway were identified by comparative genomic analyses with five other sequenced OTA-producing fungi: A. carbonarius, A. niger, A. steynii, A. westerdijkiae, and Penicillium nordicum OTA production was completely inhibited in the deletion mutants (ΔotaA, ΔotaB, ΔotaC, ΔotaD, and ΔotaR1), and OTA biosynthesis was restored by feeding a postblock substrate to the corresponding mutant. The OTA biosynthetic pathway was unblocked in the ΔotaD mutant by the addition of heterologously expressed halogenase. OTA biosynthesis begins with a polyketide synthase (PKS), OtaA, utilizing acetyl coenzyme A (acetyl-CoA) and malonyl-CoA to synthesize 7-methylmellein, which is oxidized to OTß by cytochrome P450 monooxygenase (OtaC). OTß and l-ß-phenylalanine are combined by a nonribosomal peptide synthetase (NRPS), OtaB, to form an amide bond to synthesize OTB. Finally, OTB is chlorinated by a halogenase (OtaD) to OTA. The otaABCD genes were expressed at low levels in the ΔotaR1 mutant. A second regulator, otaR2, which is adjacent to the biosynthetic gene, could modulate only the expression of otaA, otaB, and otaD Thus, we have identified a consensus OTA biosynthetic pathway that can be used to prevent and control OTA synthesis and will help us understand the variation and production of the intermediate components in the biosynthetic pathway.IMPORTANCE Ochratoxin A (OTA) is a significant mycotoxin that contaminates cereal products, coffee, grapes, wine, cheese, and meat. OTA is nephrotoxic, carcinogenic, teratogenic, and immunotoxic. OTA contamination is a serious threat to food safety, endangers human health, and can cause huge economic losses. At present, >20 species of the genera Aspergillus and Penicillium are known to produce OTA. Here we demonstrate that a consensus OTA biosynthetic pathway exists in all OTA-producing fungi and is encoded by a gene cluster containing four highly conserved biosynthetic genes and a bZIP transcription factor.

pH-Signaling Transcription Factor AopacC Regulates Ochratoxin A Biosynthesis in Aspergillus ochraceus.

In Aspergillus and Penicillium species, an essential pH-response transcription factor pacC is involved in growth, pathogenicity, and toxigenicity. To investigate the connection between ochratoxin A (OTA) biosynthesis and ambient pH, the AopacC in Aspergillus ochraceus was functionally characterized using a loss-of-function mutant. The mycelium growth was inhibited under pH 4.5 and 10.0, while the sporulation increased under alkaline condition. A reduction of mycelium growth and an elevation of sporulation was observed in Δ AopacC mutant. Compared to neutral condition, OTA contents were respectively reduced by 71.6 and 79.8% under acidic and alkaline conditions. The expression of AopacC increased with the elevated pH, and deleting AopacC dramatically decreased OTA production and biosynthetic genes Aopks expression. Additionally, the Δ AopacC mutant exhibited attenuated infection ability toward pear fruits. These results suggest that AopacC is an alkaline-induced regulator responsible for growth and OTA biosynthesis in A. ochraceus and this regulatory mechanism might be pH-dependent.

Functional Characterization of New Polyketide Synthase Genes Involved in Ochratoxin A Biosynthesis in Aspergillus Ochraceus fc-1.

Ochratoxin A (OTA), a potentially carcinogenic mycotoxin which contaminates grains, is produced by several Aspergillus species. A comparative sequence analysis of the OTA-producing Aspergillus ochraceus fc-1 strain and other Aspergillus species was performed. Two new OTA-related polyketide synthase (PKS) (AoOTApks) genes were identified. The predicted amino acid sequence of AoOTApks-1 displayed high similarity to previously identified PKSs from OTA-producing A. carbonarius ITEM 5010 (67%; [PI] No. 173482) and A. niger CBS 513.88 (62%; XP_001397313). However, the predicted amino acid sequence of AoOTApks-2 displayed lower homology with A. niger CBS 513.88 (38%) and A. carbonarius ITEM 5010 (28%). A phylogenetic analysis of the ß-ketosynthase and acyl-transferase domains of the AoOTApks proteins indicated that they shared a common origin with other OTA-producing species, such as A. carbonarius, A. niger, and A. westerdijkiae. A real-time reverse-transcription PCR analysis showed that the expression of AoOTApks-1 and -2 was positively correlated with the OTA concentration. The pks gene deleted mutants ∆AoOTApks-1 and ∆AoOTApks-2 produced nil and lesser OTA than the wild-type strain, respectively. Our study suggests that AoOTApks-1 could be involved in OTA biosynthesis, while AoOTApks-2 might be indirectly involved in OTA production.

[Aspergillus ochraceus myxomycetes produce extracellular proteinases--protein C activators of blood plasma].

Natural isolates of Aspergillus ochraceus myxomycetes from soil and plant remains from various regions have been screened. The isolated strains were characterized by similar cultural and morphological features and an identical nucleotide sequence in the ITS1-5,8S-ITS2 region of rDNA. The ability of the extracellular proteinases of A. ochraceus myxomycetes to activate protein C of blood plasma has been established. Differences are revealed in the accumulation of proteinases activating protein C and proteinases with thrombin- and plasmin-like activities in the growth dynamics of producers.

Aoyap1 regulates OTA synthesis by controlling cell redox balance in Aspergillus ochraceus.

Among the various factors correlated with toxin production in fungi, oxidative stress is a crucial one. In relation to this, an important role is played by oxidative stress-related receptors. These receptors can transduce the "oxidative message" to the nucleus and promote a transcriptional change targeted at restoring the correct redox balance in the cell. In Aspergillus parasiticus, the knockout of the ApyapA gene, a homologue of the yeast Yap-1, disables the fungus's capacity to restore the correct redox balance in the cell. As a consequence, the onset of secondary metabolism and aflatoxins synthesis is triggered. Some clues as to the involvement of oxidative stress in the regulation of ochratoxin A (OTA) synthesis in Aspergillus ochraceus have already been provided by the disruption of the oxylipin-producer AoloxA gene. In this paper, we add further evidence that oxidative stress is also involved in the regulation of OTA biosynthesis in A. ochraceus. In fact, the use of certain oxidants and, especially, the deletion of the yap1-homologue Aoyap1 further emphasize the role played by this stress in controlling metabolic and morphological changes in A. ochraceus.

Analysis of the effect of nutritional factors on OTA and OTB biosynthesis and polyketide synthase gene expression in Aspergillus ochraceus.

The effect of a wide variety of nutritional based biotic factors on the production of both OTA and OTB biosynthesis in A. ochraceus was assessed. Different carbon sources including glucose, sucrose, maltose, galactose, xylose and glycerol appear to repress OTA production when the fungus is grown in OTA permissive PDY medium. In contrast lactose appears to induce OTA production, with the addition of lactose and galactose to the OTA restrictive PDC medium resulting in marked increases in OTA levels. The addition of lactose to MCB and PDY media considerably increases OTB production. The addition of both sucrose and galactose to MCB has similar yet less marked effects. Different nitrogen sources also affect OTA production with ammonium chloride significantly reducing OTA production, while organic nitrogen sources such as urea and amino acids including phenylalanine, lysine, glutamine and proline induce OTA production. The induction of otapksAo gene expression under these conditions correlates well with the levels of OTA produced under the same experimental conditions, suggesting that the observed effects appear to be modulated, at least in part, at the level of gene transcription. However while the levels of OTB produced in A. ochraceus also appear to be influenced by these nutritional based biotic factors, this appears to be regulated in a manner which is independent of otapksAo gene expression.

Characterization of the Aspergillus ochraceoroseus aflatoxin/sterigmatocystin biosynthetic gene cluster.

Production of carcinogenic aflatoxins has been reported from members of Aspergillus section Flavi, Aspergillus section Nidulantes and a newly proposed Aspergillus section Ochraceorosei that consists of Aspergillus ochraceoroseus and A. rambellii. Unlike members of section Flavi, A. ochraceoroseus and A. rambellii have been shown to accumulate both aflatoxin (AF) and the aflatoxin precursor sterigmatocystin (ST). Alhough morphologically distinct from A. nidulans, molecular characterization of A. ochraceoroseus AF/ST genes and physiological characteristics of AF/ST production indicated that A. ochraceoroseus is more closely related to A. nidulans than to A. flavus. Knowing that the A. nidulans ST gene cluster is organized differently from the A. flavus AF gene cluster, we determined the genetic organization of the AF/ST biosynthetic cluster in A. ochraceoroseus. Sequencing of overlapping lambda clones and genomic PCR fragments obtained by gene-walking techniques demonstrated that the A. ochraceoroseus AF/ST gene cluster is organized much like the A. nidulans ST gene cluster except that the region from aflN to aflW is located directly upstream of aflC and in reverse orientation such that aflW represents the distal end and aflY the proximal end of the cluster. The A. ochraceoroseus cluster genes demonstrated 62-76% nucleotide identity to their A. nidulans ST cluster gene homologs. Transformation of an A. nidulans aflR mutant with the A. ochraceoroseus aflR restored ST production in A. nidulans transformants. PCR amplification of A. rambellii genomic DNA demonstrated that the AF/ST gene cluster is organized in the same manner as that of A. ochraceoroseus.

ITS-based detection and quantification of Aspergillus ochraceus and Aspergillus westerdijkiae in grapes and green coffee beans by real-time quantitative PCR.

Aspergillus ochraceus and A. westerdijkiae are considered the most important Ochratoxin A (OTA) producing species included in Aspergillus section Circumdati which contaminate foodstuffs and beverages for human consumption. In this work a real-time quantitative PCR protocol was developed to detect both species using SYBR Green and primers designed on the basis of the multicopy ITS1 region of the rDNA. The assay had high efficiency (94%) and showed no inhibition by host or fungal DNA other than the target species. The lower detection limit of the target DNA was 2.5 pg/reaction. Accuracy of detection and quantification by qPCR were tested with genomic DNA obtained from green coffee beans and grapes artificially contaminated with spore suspensions of known concentrations. Spore concentrations equal or higher than 10(6) spore/ml could be detected by the assay directly without prior incubation of the samples and a positive relationship was observed between incubation time and qPCR values. The assay developed would allow rapid, specific, accurate and sensitive detection and quantification of A. ochraceus and A. westerdijkiae to be directly used in a critical point of the food chain, before harvesting green coffee and grape berries, to predict and control fungal growth and OTA production.

Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of beta-tubulin gene by using real-time PCR.

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.

Mycotoxin contamination of food in Europe: early detection and prevention strategies.

This paper reviews the early detection and prevention strategies which have been employed in Europe for the control of mycotoxin contamination of food in the context of a hazard analysis critical control point (HACCP) framework. The critical control points (CCPs) in the whole food chain where mycotoxins such as trichothecenes and ochratoxins are important have been identified. Ecological studies on the effect of environmental factors which are marginal for growth and mycotoxin production have been identified for Fusarium culmorum and F. graminearum (deoxynivlenol production), and for Penicillium verrucosum and Aspergillus ochraceus (ochratoxin production) in relation to cereal production and for A. carbonarius in relation to grapes and wine production (ochratoxin formation). To minimise the entry of these mycotoxins into the food chain, effective and rapid diagnostic tools are required to monitor the CCPs effectively. To this end the potential use of molecular imprinted polymers, lateral flow devices and molecular-based techniques for the rapid detection and quantification of the mycotoxigenic moulds or their toxins have also been developed.

Amplification and diversity analysis of ketosynthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A.

The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergillus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions.