Ephedrine and cocaine cause developmental neurotoxicity and abnormal behavior in zebrafish.

Ephedrine (EPH) and cocaine (COC) are illegal stimulant drugs, and have been frequently detected in aquatic environments. EPH and COC have negative effects on the nervous system and cause abnormal behaviors in mammals and fish at high concentrations, but their mechanisms of neurotoxicity remain unclear in larvae fish at low concentrations. To address this issue, zebrafish embryos were exposed to EPH and COC for 14 days post-fertilization (dpf) at 10, 100, and 1000 ng L-1. The bioaccumulation, development, behavior, cell neurotransmitter levels and apoptosis were detected to investigate the developmental neurotoxicity (DNT) of EPH and COC. The results showed that EPH decreased heart rate, while COC increased heart rate. EPH caused cell apoptosis in the brain by AO staining. In addition, behavior analysis indicated that EPH and COC affected spontaneous movement, touch-response, swimming activity and anxiety-like behaviors. EPH and COC altered the levels of the neurotransmitters dopamine (DA) and γ-aminobutyric acid (GABA) with changes of the transcription of genes related to the DA and GABA pathways. These findings indicated that EPH and COC had noticeable DNT in the early stage of zebrafish at environmentally relevant concentrations.

The composition characteristics of endophytic communities and their relationship with metabolites profile in Ephedra sinica under wild and cultivated conditions.

Ephedra sinica is one of the most famous Chinese medicinal plants. The insufficient supply of wild resources has led to the increased use of cultivated products. However, the related medicinal quality differs significantly. Although the influence of external environment on the quality of E. sinica has been studied, the impact of endophytic microbes on it remains vague. This study characterized differential metabolites and microbial community compositions in wild and cultivated E. sinica by combining metabolomics with microbiomics, and explored the effect of endophytes on the formation of differential metabolites further. The results showed that the difference in quality between wild and cultivated E. sinica was mainly in the productions of alkaloids, flavonoids, and terpenoids. The associated endophytes had special compositional characteristics. For instance, the distribution and abundance of dominant endophytes varied between wild and cultivated E. sinica. Several endophytes had significant or highly significant correlations with the formations of ephedrine, pseudoephedrine, D-cathinone, methcathinone, coumarin, kaempferol, rhamnetin, or phenylacetic acid. This study will deepen our understanding of the plant-endophyte interactions and provide a strategy for the quality control of E. sinica products.

Biochemical and immunohistochemical examination of the effects of ephedrine in rat ovary tissue.

PURPOSE: It was aimed to investigate the biochemical and immunohistochemical effects of ephedrine (EPH) in bilateral ovariectomized rats. METHODS: Twenty-four Sprague Dawley female rats were divided into three groups: control group: The abdomen was opened and closed without any treatment; ischemia-reperfusion (IR) group: 2 h of ischemia followed by 2 h of reperfusion were allowed to cause IR injury; IR+EPH group: oral EPH solution (5 mg/kg) was administered for 28 days. RESULTS: Biochemical parameters were statistically significant in group comparisons. Increased interleukin-6 (IL-6) expression, degenerative preantral and antral follicle cells and inflammatory cells around blood vessels were seen in IR group. Negative IL-6 expression was observed in seminal epithelial cells, preantral and antral follicle cells in IR+EPH group. While caspase-3 activity increased in granulosa cells and stromal cells in IR group, caspase-3 expression was negative in preantral and antral follicle cells in the germinal epithelium and cortex in IR+EPH group. CONCLUSIONS: The effect of apoptosis, which occurs with the signaling that starts in the cell nucleus, caused the cessation of the stimulating effect at the nuclear level after EPH administration, and a decrease in the antioxidative effect in IR damage and inflammation in the apoptotic process.

Ephedrine Alkaloid-Independent High-Affinity Immunoglobulin-E Receptor (FcεRI) Internalization Results in CCL2 Production without Inducing Mast Cell Degranulation.

Mast cells (MCs) play an important role in allergies, leading to the development of MC-targeted therapies. Ephedra herb (Mao) has potent anti-allergic activity, but contains ephedrine alkaloids (EAs); therefore, its hazardous effects are taken into consideration during its clinical use. We previously reported that Mao attenuates robust MC degranulation by an allergen through high-affinity immunoglobulin E (IgE) receptor (FcεRI) internalization, in which an EA-independent mechanism was suggested to be at play. This study aimed to deepen our understanding of the potential of Mao against FcεRI internalization using two strains with different EA contents. Mao extracts were administered to bone marrow-derived MCs (BMMCs), and their cellular responses, including FcεRI internalization, were analyzed. In addition, physiological events were evaluated using a passive cutaneous anaphylactic (PCA) reaction mouse model. BMMCs mediate the production of diverse inflammatory mediators. Among these, the potent chemokine CCL2 is thought to be differentially regulated from other pro-inflammatory mediators. We found that Mao significantly induces CCL2 expression in BMMCs despite suppressing robust degranulation through FcεRI internalization. Importantly, this was a distinctly EAs-independent response. In the PCA reaction, local MC activation following allergen challenge was suppressed by Mao treatment, which strengthened the view that Mao sufficiently decreased the rapid activation of MCs and promoted CCL2 secretion. Collectively, these observations provide additional insights into the mechanism of Mao-induced silent FcεRI internalization in MCs and the complex and heterogeneous secretory responses operating in MCs.

Characterization of binding properties of ephedrine derivatives to human alpha-1-acid glycoprotein.

Most drugs, especially those with acidic or neutral moieties, are bound to the plasma protein albumin, whereas basic drugs are preferentially bound to human alpha-1-acid glycoprotein (AGP). The protein binding of the long-established drugs ephedrine and pseudoephedrine, which are used in the treatment of hypotension and colds, has so far only been studied with albumin. Since in a previous study a stereoselective binding of ephedrine and pseudoephedrine to serum but not to albumin was observed, the aim of this study was to check whether the enantioselective binding behavior of ephedrine and pseudoephedrine, in addition to the derivatives methylephedrine and norephedrine, is due to AGP and to investigate the influence of their different substituents and steric arrangement. Discontinuous ultrafiltration was used for the determination of protein binding. Characterization of ligand-protein interactions of the drugs was obtained by saturation transfer difference nuclear magnetic resonance spectroscopy. Docking experiments were performed to analyze possible ligand-protein interactions. The more basic the ephedrine derivative is, the higher is the affinity to AGP. There was no significant difference in the binding properties between the individual enantiomers and the diastereomers of ephedrine and pseudoephedrine.

Ephedra herb reduces adriamycin-induced testicular toxicity by upregulating the gonadotropin-releasing hormone signalling pathway.

OBJECTIVE: We investigated the protective effects of ephedra herb (HEPH) on adriamycin-induced testicular toxicity in rats and explored the potential mechanisms underlying these effects. METHODS: A rat model of adriamycin injury was established, and sperm motility-related indicator and oxidative stress levels in the testis were evaluated. Serum levels of sex hormones and levels of testicular cell apoptosis were detected by enzyme-linked immunosorbent assay and flow cytometry, respectively. Western blotting (WB), immunofluorescence analyses, and reverse transcription-polymerase chain reaction (RT-PCR) were performed to evaluate the gonadotropin-releasing hormone (GnRH) signalling pathway- and meiosis-related genes and proteins. In subsequent in vitro experiments, adriamycin was used to stimulate GC-1 cells, which were treated with HEPH, ephedrine, or pseudoephedrine. Cell viability was assessed using flow cytometry to detect apoptosis and reactive oxygen species, whereas the GnRH signalling pathway and levels of meiosis-related genes and proteins were evaluated by InCell WB, a high-content imaging system, and RT-PCR. RESULTS: Per in vivo experiments, HEPH restored testicular weight and function, sperm characteristics, serum and tissue hormonal levels, and antioxidant defences and significantly activated the GnRH signalling pathway- and meiosis-related protein levels. All protective effects of HEPH against adriamycin-induced injury were antagonised by the GnRH antagonist cetrorelix. In vitro, HEPH, ephedrine, and pseudoephedrine significantly reduced adriamycin-induced GC-1 cell apoptosis and reactive oxygen species levels and increased the expression of GnRH signalling pathway- and meiosis-related proteins. The effect of pseudoephedrine was greater than that of ephedrine, and these findings may be an important basis for understanding the effects of HEPH.

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products.

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

Validity of Selection Breeding for High Ephedrine-Alkaloid Content in E. sinica under Different Environments in Japan.

Dried terrestrial stems of Ephedra sinica are called 'Ephedra herb,' whose pharmacological effects are due mainly to two major ingredients, (-)-ephedrine and (+)-pseudoephedrine (total alkaloids which are defined in Japanese Pharmacopoeia (TA)). Ephedra herb is an important crude drug in Japan. However, E. sinica is widely distributed in arid areas of northeastern China and Mongolia. Recently, E. sinica has started to be cultivated in Japan. This study aimed to assess the validity of selection breeding on TA content of E. sinica in several locations in Japan. In this experiment, we grew approximately 350 seedlings and divided them randomly into seven groups. Nearly fifty plants were cultivated at each of seven locations. In Ibaraki, Yamanashi, and Shizuoka, average TA content of whole samples satisfied the criteria for Ephedra herb defined in Japanese Pharmacopoeia (7.0 mg/g of dry weight (DW)). Plants with high and intermediate TA content at four locations were selected and transplanted to Ibaraki. There were significant differences in TA content between selected plants with high and intermediate TA content before and after transplanting (p < 0.05). TA content of high-TA plants was significantly higher than that of control plants cultivated continuously at Ibaraki (p < 0.05). These results suggest that the selection on content of ephedrine alkaloids in E. sinica under various locations in Japan is valid, and high- TA E. sinica plants can be selected at various locations.

Localization of Major Ephedra Alkaloids in Whole Aerial Parts of Ephedrae Herba Using Direct Analysis in Real Time-Time of Flight-Mass Spectrometry.

Mass spectrometry-based molecular imaging has been utilized to map the spatial distribution of target metabolites in various matrixes. Among the diverse mass spectrometry techniques, matrix-assisted laser desorption/ionization-mass spectrometry (MALDI-MS) is the most popular for molecular imaging due to its powerful spatial resolution. This unparalleled high resolution, however, can paradoxically act as a bottleneck when the bio-imaging of large areas, such as a whole plant, is required. To address this issue and provide a more versatile tool for large scale bio-imaging, direct analysis in real-time-time of flight-mass spectrometry (DART-TOF-MS), an ambient ionization MS, was applied to whole plant bio-imaging of a medicinal plant, Ephedrae Herba. The whole aerial part of the plant was cut into 10-20 cm long pieces, and each part was further cut longitudinally to compare the contents of major ephedra alkaloids between the outer surface and inner part of the stem. Using optimized DART-TOF-MS conditions, molecular imaging of major ephedra alkaloids of the whole aerial part of a single plant was successfully achieved. The concentration of alkaloids analyzed in this study was found to be higher on the inner section than the outer surface of stems. Moreover, side branches, which are used in traditional medicine, represented a far higher concentration of alkaloids than the main stem. In terms of the spatial metabolic distribution, the contents of alkaloids gradually decreased towards the end of branch tips. In this study, a fast and simple macro-scale MS imaging of the whole plant was successfully developed using DART-TOF-MS. This application on the localization of secondary metabolites in whole plants can provide an area of new research using ambient ionization mass spectroscopy and an unprecedented macro-scale view of the biosynthesis and distribution of active components in medicinal plants.

Biodegradation of Ephedrine Isomers by Arthrobacter sp. Strain TS-15: Discovery of Novel Ephedrine and Pseudoephedrine Dehydrogenases.

The Gram-positive soil bacterium Arthrobacter sp. strain TS-15 (DSM 32400), which is capable of metabolizing ephedrine as a sole source of carbon and energy, was isolated. According to 16S rRNA gene sequences and comparative genomic analysis, Arthrobacter sp. TS-15 is closely related to Arthrobacter aurescens Distinct from all known physiological paths, ephedrine metabolism by Arthrobacter sp. TS-15 is initiated by the selective oxidation of the hydroxyl function at the α-C atom, yielding methcathinone as the primary degradation product. Rational genome mining revealed a gene cluster potentially encoding the novel pathway. Two genes from the cluster, which encoded putative short-chain dehydrogenases, were cloned and expressed in Escherichia coli The obtained enzymes were strictly NAD+ dependent and catalyzed the oxidation of ephedrine to methcathinone. Pseudoephedrine dehydrogenase (PseDH) selectively converted (S,S)-(+)-pseudoephedrine and (S,R)-(+)-ephedrine to (S)- and (R)-methcathinone, respectively. Ephedrine dehydrogenase (EDH) exhibited strict selectivity for the oxidation of the diastereomers (R,S)-(-)-ephedrine and (R,R)-(-)-pseudoephedrine.IMPORTANCEArthrobacter sp. TS-15 is a newly isolated bacterium with the unique ability to degrade ephedrine isomers. The initiating steps of the novel metabolic pathway are described. Arthrobacter sp. TS-15 and its isolated ephedrine-oxidizing enzymes have potential for use in decontamination and synthetic applications.

Identification and Phylogenetic Analysis of the Complete Chloroplast Genomes of Three Ephedra Herbs Containing Ephedrine.

Ephedrae Herba and Ephedrae Radix et Rhizoma (Mahuang) have been used as Chinese herbal medicines. Ephedra plants mainly live in deserts and have good governance of desertification. Despite their important medicinal and environmental protection value, dietary supplements containing ephedrine from Ephedra species may threaten the health of people. Morphological resemblance amongst species causes difficulty in identifying the original species of Ephedra herbs. Chloroplast (CP) genome shows good prospects in identification and phylogenetic analysis. This study introduced the structures of the CP genomes of three Ephedra species and analysed their phylogenetic relationships. Three complete CP genomes of Ephedra showed four-part annular structures, namely, two single-copy regions and two inverted repeat regions. The entire CP genomes of three Ephedra species in terms of size were 109,550 bp (E. sinica), 109,667 bp (E. intermedia), and 109,558 bp (E. equisetina). Each CP genome of the three Ephedra species encoded 118 genes, including 73 protein-coding genes, 37 tRNA genes and 8 ribosomal RNA genes. Eleven high-variation regions were screened through mVISTA to be potential specific DNA barcodes for identifying Ephedra species. Maximum likelihood and maximum parsimony trees showed that CP genomes could be used to identify Ephedra species. The Ephedra species had a close phylogenetic relationship with Gnetum species and Welwitschia mirabilis. This research provided valuable information for the identification and phylogenetic analysis of gymnosperms and drug safety of Ephedra.

Determination of plasma protein binding for sympathomimetic drugs by means of ultrafiltration.

Ephedrine and its diastereomer pseudoephedrine have long been used in therapy and are part of over-the-counter combination drugs against colds or allergies. Nonetheless, there is scarcely any information on their plasma protein binding in literature. Plasma protein binding is an important parameter from a pharmacokinetic and pharmacodynamic point of view and can play a crucial role in therapy. The aim of this study was to determine the extent of plasma protein binding using ultrafiltration and different types of plasma proteins like human (HSA) and bovine serum albumin (BSA) and human serum. Two orthogonal methods - continuous and discontinuous ultrafiltration - were used to confirm our findings. To get some structural and stereochemical insights into binding affinity towards plasma proteins, all four stereoisomers of ephedrine and pseudoephedrine were included in this study. Since all four stereoisomers exhibit a low affinity towards albumin, other sympathomimetic drugs of structural similarity were tested to investigate the influence of the basic character of the Ephedra alkaloids in their binding to plasma proteins.

An N-methyltransferase from Ephedra sinica catalyzing the formation of ephedrine and pseudoephedrine enables microbial phenylalkylamine production.

Phenylalkylamines, such as the plant compounds ephedrine and pseudoephedrine and the animal neurotransmitters dopamine and adrenaline, compose a large class of natural and synthetic molecules with important physiological functions and pharmaceutically valuable bioactivities. The final steps of ephedrine and pseudoephedrine biosynthesis in members of the plant genus Ephedra involve N-methylation of norephedrine and norpseudoephedrine, respectively. Here, using a plant transcriptome screen, we report the isolation and characterization of an N-methyltransferase (NMT) from Ephedra sinica able to catalyze the formation of (pseudo)ephedrine and other naturally occurring phenylalkylamines, including N-methylcathinone and N-methyl(pseudo)ephedrine. Phenylalkylamine N-methyltransferase (PaNMT) shares substantial amino acid sequence identity with enzymes of the NMT family involved in benzylisoquinoline alkaloid (BIA) metabolism in members of the higher plant order Ranunculales, which includes opium poppy (Papaver somniferum). PaNMT accepted a broad range of substrates with phenylalkylamine, tryptamine, ß-carboline, tetrahydroisoquinoline, and BIA structural scaffolds, which is in contrast to the specificity for BIA substrates of NMT enzymes within the Ranunculales. PaNMT transcript levels were highest in young shoots of E. sinica, which corresponded to the location of NMT activity yielding (pseudo)ephedrine, N-methylcathinone, and N-methyl(pseudo)ephedrine, and with in planta accumulation of phenylalkylamines. Co-expression of recombinant genes encoding PaNMT and an ω-transaminase (PP2799) from Pseudomonas putida in Escherichia coli enabled the conversion of exogenous (R)-phenylacetylcarbinol (PAC) and (S)-PAC to ephedrine and pseudoephedrine, respectively. Our work further demonstrates the utility of plant biochemical genomics for the isolation of key enzymes that facilitate microbial engineering for the production of medicinally important metabolites.

Ephedrine as a lead compound for the development of new DPP-IV inhibitors.

AIM: Extracts from Ephedra species have been reported to be effective as antidiabetics. A previous in silico study predicted that ephedrine and five ephedrine derivatives could contribute to the described antidiabetic effect of Ephedra extracts by inhibiting dipeptidyl peptidase IV (DPP-IV). Finding selective DPP-IV inhibitors is a current therapeutic strategy for Type 2 diabetes mellitus management. Therefore, the main aim of this work is to experimentally determine whether these alkaloids are DPP-IV inhibitors. Materials & methods: The DPP-IV inhibition of Ephedra's alkaloids was determined via a competitive-binding assay. Then, computational analyses were used in order to find out the protein-ligand interactions and to perform a lead optimization. RESULTS: Our results show that all six molecules are DPP-IV inhibitors, with IC50 ranging from 124 µM for ephedrine to 28 mM for N-methylpseudoephedrine. CONCLUSION: Further computational analysis shows how Ephedra's alkaloids could be used as promising lead molecules for designing more potent and selective DPP-IV inhibitors.

Studies on Para-Methoxymethamphetamine (PMMA) Metabolite Pattern and Influence of CYP2D6 Genetics in Human Liver Microsomes and Authentic Samples from Fatal PMMA Intoxications.

Para-methoxymethamphetamine (PMMA) has caused numerous fatal poisonings worldwide and appears to be more toxic than other ring-substituted amphetamines. Systemic metabolism is suggested to be important for PMMA neurotoxicity, possibly through activation of minor catechol metabolites to neurotoxic conjugates. The aim of this study was to examine the metabolism of PMMA in humans; for this purpose, we used human liver microsomes (HLMs) and blood samples from three cases of fatal PMMA intoxication. We also examined the impact of CYP2D6 genetics on PMMA metabolism by using genotyped HLMs isolated from CYP2D6 poor, population-average, and ultrarapid metabolizers. In HLMs, PMMA was metabolized mainly to 4-hydroxymethamphetamine (OH-MA), whereas low concentrations of para-methoxyamphetamine (PMA), 4-hydroxyamphetamine (OH-A), dihydroxymethamphetamine (di-OH-MA), and oxilofrine were formed. The metabolite profile in the fatal PMMA intoxications were in accordance with the HLM study, with OH-MA and PMA being the major metabolites, whereas OH-A, oxilofrine, HM-MA and HM-A were detected in low concentrations. A significant influence of CYP2D6 genetics on PMMA metabolism in HLMs was found. The catechol metabolite di-OH-MA has previously been suggested to be involved in PMMA toxicity. Our studies show that the formation of di-OH-MA from PMMA was two to seven times lower than from an equimolar dose of the less toxic drug MDMA, and do not support the hypothesis of catechol metabolites as major determinants of fatal PMMA toxicity. The present study revealed the metabolite pattern of PMMA in humans and demonstrated a great impact of CYP2D6 genetics on human PMMA metabolism.

Aggregated N-of-1 trials for unlicensed medicines for small populations: an assessment of a trial with ephedrine for myasthenia gravis.

BACKGROUND: Inexpensive medicines with a long history of use may currently be prescribed off-label for rare indications. Reimbursement is at the discretion of health insurance companies, and may be unpredictable. The example addressed was ephedrine as add-on treatment for myasthenia gravis. Stakeholders from academia, a patient organization, the Dutch National Health Care Institute (NHCI) and Dutch Medicines Evaluation Board (MEB) advised on the trial design. The NHCI and MEB agreed to provide scientific advice on the suitability of the evidence generated by the trial, for regulatory decisions. This paper describes the feasibility of the trial and the utility of its aggregated results. RESULTS: The trialists experienced the trial as feasible. Retrospective interviews showed that the trial as performed was acceptable to patients. The treatment effect in the primary outcome measure, muscle strength, was statistically significant when inferred to the population level, though the effect size was modest. Secondary outcomes were statistically significant in a preplanned, fixed effects analysis within the four patients. The NHCI advised that it could potentially make reimbursement decisions based on the Fitting Evidence framework, should the trialists decide to apply for reimbursement. The MEB advised that for a licensing decision, the N-of-1 design is a last-resort option for demonstrating treatment benefit in a rare disease. N-of-1 trials alone do not provide enough evidence on potential risk. The MEB found the current trial inconclusive. It suggested doing a 2-armed trial of longer duration, possibly with a different outcome measure (postponement of corticosteroid use). It suggested engaging a consultancy or commercial sponsor, should the trialists decide to seek market authorization of the drug. CONCLUSIONS: In theory, evidence from aggregated N-of-1 trials is suitable for use in licensing and reimbursement decisions. The current example illustrates differences in interpretation of N-of-1 results by health authorities. In the era of personalized medicine, consensus is required on the interpretation of data from study designs geared to small groups. Demonstrating effectiveness of inexpensive medicines in small populations may require involvement of non-commercial parties, to preserve affordability.

Stabilization of Ephedrine Alkaloid Content in Ephedra sinica by Selective Breeding and Stolon Propagation.

The Ephedra herb, which has been used in Kampo medicines, originates from terrestrial stems of Ephedra species. It is important to establish cultivation methods and cultivars to secure a stable supply of the Ephedra herb that would meet the quality standards for the ephedrine alkaloids content. In this study, we first grew Ephedra sinica plants derived from seeds in the field for 5 years. Then, for selective breeding of cultivars that could meet the quality standards for the ephedrine alkaloids content, we measured the content of total alkaloids (TAs), ephedrine (Eph), and pseudoephedrine (PEph) in individual plants derived from seedlings and grown for 4 years in the field. The range of the TA content in each individual plant was narrower than that among individual plants grown in the field. Therefore, individual plants were selected according to their TA content, Eph/PEph ratio, and stolon-formation capability. The selected individuals were propagated using stolons, and their TA content was studied for 2 years. In the second year, the TA content in terrestrial stems derived from stolons of the selected individuals was as high as that of their parents. Therefore, it was confirmed that the selected individuals that were propagated using stolons could produce TA reproducibly. This study suggested that selective breeding using stolon propagation is effective for stabilizing Ephedra herb TA content.

Determination of the Metabolite of Ephedrine, 4-Hydroxyephedrine, by LC-MS-MS in Rat Urine and Its Application in Excretion Profiles After Oral Administration of Ephedra sinica Stapf and Processing Ephedra sinica Stapf.

This study aims to study the changes of metabolism of Ephedra sinica Stapf caused by processing. A sensitive and rapid high-performance liquid chromatographic tandem mass spectrometry (LC-MS-MS) method was developed for the quantitation of the major metabolite of ephedrine, 4-hydroxyephedrine, utilizing lidocaine as the internal standard in rat urine. Urine samples were precipitated with acetonitrile. Chromatographic separation was achieved on an Ultimate C18 analytical column. Detection was performed by a multiple reaction monitoring mode via an electrospray ionization source operating in the positive ionization mode. The method was linear over the concentration range of 0.05-1.0c for all components. The intra- and inter-day precision values were <13.2% and the deviations ranged from -8.4% to 7.5%. The recoveries at three levels were more than 66.2%. The fully validated method was used to study the pharmacokinetic profile of 4-hydroxyephedrine in rat urine to investigate the effects caused by processing.

Solid-Phase and Oscillating Solution Crystallization Behavior of (+)- and (-)-N-Methylephedrine.

This work involves the study of the solid-phase and solution crystallization behavior of the N-methylephedrine enantiomers. A systematic investigation of the melt phase diagram of the enantiomeric N-methylephedrine system was performed considering polymorphism. Two monotropically related modifications of the enantiomer were found. Solubilities and the ternary solubility phase diagrams of N-methylephedrine enantiomers in 2 solvents [isopropanol:water, 1:3 (Vol) and (2R, 3R)-diethyl tartrate] were determined in the temperature ranges between 15°C and 25°C, and 25°C and 40°C, respectively. Preferential nucleation and crystallization experiments at higher supersaturation leading to an unusual oscillatory crystallization behavior as well as a successful preferential crystallization experiment at lower supersaturation are presented and discussed.

Characterization of aromatic aminotransferases from Ephedra sinica Stapf.

Ephedra sinica Stapf (Ephedraceae) is a broom-like shrub cultivated in arid regions of China, Korea and Japan. This plant accumulates large amounts of the ephedrine alkaloids in its aerial tissues. These analogs of amphetamine mimic the actions of adrenaline and stimulate the sympathetic nervous system. While much is known about their pharmacological properties, the mechanisms by which they are synthesized remain largely unknown. A functional genomics platform was established to investigate their biosynthesis. Candidate enzymes were obtained from an expressed sequence tag collection based on similarity to characterized enzymes with similar functions. Two aromatic aminotransferases, EsAroAT1 and EsAroAT2, were characterized. The results of quantitative reverse transcription-polymerase chain reaction indicated that both genes are expressed in young stem tissue, where ephedrine alkaloids are synthesized, and in mature stem tissue. Nickel affinity-purified recombinant EsAroAT1 exhibited higher catalytic activity and was more homogeneous than EsAroAT2 as determined by size-exclusion chromatography. EsAroAT1 was highly active as a tyrosine aminotransferase with α-ketoglutarate followed by α-ketomethylthiobutyrate and very low activity with phenylpyruvate. In the reverse direction, catalytic efficiency was similar for the formation of all three aromatic amino acids using L-glutamate. Neither enzyme accepted putative intermediates in the ephedrine alkaloid biosynthetic pathway, S-phenylacetylcarbinol or 1-phenylpropane-1,2-dione, as substrates.