Rubella vaccine-induced granulomas are a novel phenotype with incomplete penetrance of genetic defects in cytotoxicity.

BACKGROUND: Rubella virus-induced granulomas have been described in patients with various inborn errors of immunity. Most defects impair T-cell immunity, suggesting a critical role of T cells in rubella elimination. However, the molecular mechanism of virus control remains elusive. OBJECTIVE: This study sought to understand the defective effector mechanism allowing rubella vaccine virus persistence in granulomas. METHODS: Starting from an index case with Griscelli syndrome type 2 and rubella skin granulomas, this study combined an international survey with a literature search to identify patients with cytotoxicity defects and granuloma. The investigators performed rubella virus immunohistochemistry and PCR and T-cell migration assays. RESULTS: This study identified 21 patients with various genetically confirmed cytotoxicity defects, who presented with skin and visceral granulomas. Rubella virus was demonstrated in all 12 accessible biopsies. Granuloma onset was typically before 2 years of age and lesions persisted from months to years. Granulomas were particularly frequent in MUNC13-4 and RAB27A deficiency, where 50% of patients at risk were affected. Although these proteins have also been implicated in lymphocyte migration, 3-dimensional migration assays revealed no evidence of impaired migration of patient T cells. Notably, patients showed no evidence of reduced control of concomitantly given measles, mumps, or varicella live-attenuated vaccine or severe infections with other viruses. CONCLUSIONS: This study identified lymphocyte cytotoxicity as a key effector mechanism for control of rubella vaccine virus, without evidence for its need in control of live measles, mumps, or varicella vaccines. Rubella vaccine-induced granulomas are a novel phenotype with incomplete penetrance of genetic disorders of cytotoxicity.

Rubella Virus-Associated Cutaneous Granulomatous Disease: a Unique Complication in Immune-Deficient Patients, Not Limited to DNA Repair Disorders.

The association of immunodeficiency-related vaccine-derived rubella virus (iVDRV) with cutaneous and visceral granulomatous disease has been reported in patients with primary immunodeficiency disorders (PIDs). The majority of these PID patients with rubella-positive granulomas had DNA repair disorders. To support this line of inquiry, we provide additional descriptive data on seven previously reported patients with Nijmegen breakage syndrome (NBS) (n = 3) and ataxia telangiectasia (AT) (n = 4) as well as eight previously unreported patients with iVDRV-induced cutaneous granulomas and DNA repair disorders including NBS (n = 1), AT (n = 5), DNA ligase 4 deficiency (n = 1), and Artemis deficiency (n = 1). We also provide descriptive data on several previously unreported PID patients with iVDRV-induced cutaneous granulomas including cartilage hair hypoplasia (n = 1), warts, hypogammaglobulinemia, immunodeficiency, myelokathexis (WHIM) syndrome (n = 1), MHC class II deficiency (n = 1), Coronin-1A deficiency (n = 1), X-linked severe combined immunodeficiency (X-SCID) (n = 1), and combined immunodeficiency without a molecular diagnosis (n = 1). At the time of this report, the median age of the patients with skin granulomas and DNA repair disorders was 9 years (range 3-18). Cutaneous granulomas have been documented in all, while visceral granulomas were observed in six cases (40%). All patients had received rubella virus vaccine. The median duration of time elapsed from vaccination to the development of cutaneous granulomas was 48 months (range 2-152). Hematopoietic cell transplantation was reported to result in scarring resolution of cutaneous granulomas in two patients with NBS, one patient with AT, one patient with Artemis deficiency, one patient with DNA Ligase 4 deficiency, one patient with MHC class II deficiency, and one patient with combined immunodeficiency without a known molecular etiology. Of the previously reported and unreported cases, the majority share the diagnosis of a DNA repair disorder. Analysis of additional patients with this complication may clarify determinants of rubella pathogenesis, identify specific immune defects resulting in chronic infection, and may lead to defect-specific therapies.

Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.

Infectious diseases have a profound impact on our health and many studies suggest that host genetics play a major role in the pathogenesis of most of them. We perform 23 genome-wide association studies for common infections and infection-associated procedures, including chickenpox, shingles, cold sores, mononucleosis, mumps, hepatitis B, plantar warts, positive tuberculosis test results, strep throat, scarlet fever, pneumonia, bacterial meningitis, yeast infections, urinary tract infections, tonsillectomy, childhood ear infections, myringotomy, measles, hepatitis A, rheumatic fever, common colds, rubella and chronic sinus infection, in over 200,000 individuals of European ancestry. We detect 59 genome-wide significant (P < 5 × 10-8) associations in genes with key roles in immunity and embryonic development. We apply fine-mapping analysis to dissect associations in the human leukocyte antigen region, which suggests important roles of specific amino acid polymorphisms in the antigen-binding clefts. Our findings provide an important step toward dissecting the host genetic architecture of response to common infections.Susceptibility to infectious diseases is, among others, influenced by the genetic landscape of the host. Here, Tian and colleagues perform genome-wide association studies for 23 common infections and find 59 risk loci for 17 of these, both within the HLA region and non-HLA loci.

Analysis of complete genomes of the rubella virus genotypes 1E and 2B which circulated in China, 2000-2013.

Rubella viruses of genotypes 1E and 2B are currently the most frequently detected wild-type viruses in the world. Genotype 1E viruses from China have been genetically distinct from genotype 1E viruses found elsewhere, while genotype 2B viruses found in China are not distinguishable from genotype 2B viruses from other areas. Genetic clusters of viruses of both genotypes were defined previously using sequences of the 739-nt genotyping window. Here we report phylogenic analysis using whole genomic sequences from seven genotype 1E and three genotype 2B viruses which were isolated in China between 2000 and 2013 and confirm the subgrouping of current circulating genotypes 1E and 2B viruses. In addition, the whole genomic characterization of Chinese rubella viruses was clarified. The results indicated that the Chinese rubella viruses were highly conserved at the genomic level, and no predicted amino acid variations were found at positions where functional domains of the proteins were identified. Therefore, it gives us the idea that the rubella control and elimination goal should be achieved if vaccine immunization coverage continues maintaining at the high level.

Frequency of viral infections and environmental factors in multiple sclerosis.

OBJECTIVES: Multiple sclerosis (MS) is a complicated disease which occurs due to relationship between genes and environmental factors that causes tissue damage by autoimmune mechanisms.We investigated and illustrated the hypotheses correlated to the evidence of several putative environmental risk factors for MS onset and progression in this part of Iran. MATERIALS AND METHODS: Univariate logistic regression was used to detect the effects of environmental factors on the risk of MS. Data were analyzed using SPSS version 16. RESULTS: The childhood history of patients with rubella, measles and chickenpox increased the risk of MS significantly. Moreover, low consumption of dairy products, avoidance of seafood consumption, cigarette smoking and exposure to tobacco smoke, stress, anxiety disorders, depress and disturbing thoughts, negative and disturbing thoughts, developing a sudden shock upon hearing bad news, having obsessive-compulsive and being depressed increased the risk of MS significantly. CONCLUSIONS: The results of the current research partially solved the puzzling question of complex interplay between environmental factors and MS disease in this part of Iran. Incorporating these factors enables more powerful and accurate detection of novel risk factors with diagnostic and prognostic methods.

Gene expression profiling of rubella virus infected primary endothelial cells of fetal and adult origin.

BACKGROUND: Rubella virus (RV) infection is usually a mild illness in children and adults. However, maternal infection during the first trimester of pregnancy can lead to congenital rubella syndrome (CRS) in the infant. Fetuses with CRS show damage to the endothelium of the heart and blood vessels; thus, it has been speculated that the clinical manifestations associated with CRS may be a result of endothelial cells persistently infected with RV. Here, we compared the effects of RV infection on gene expression in primary endothelial cells of fetal (HUVEC) and of adult (HSaVEC) origin by transcriptional profiling. RESULTS: More than 75 % of the genes differentially regulated following RV infection were identical in both cell types. Gene Ontology (GO) analysis of these commonly regulated genes showed an enrichment of terms involved in cytokine production and cytokine regulation. Increased accumulation of inflammatory cytokines following RV infection was verified by protein microarray. Interestingly, the chemokine CCL14, which is implicated in supporting embryo implantation at the fetal-maternal interface, was down-regulated following RV infection only in HUVEC. Most noticeably, when analyzing the uniquely regulated transcripts for each cell type, GO term-based cluster analysis of the down-regulated genes of HUVEC revealed an enrichment of the GO terms "sensory organ development", "ear development" and "eye development". CONCLUSION: Since impairment in vision and hearing are the most prominent clinical manifestations observed in CRS patients, the here detected down-regulated genes involved in the development of sensory organs sheds light on the molecular mechanisms that may contribute to the teratogenic effect of RV.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Rubella.

Rubella remains an important pathogen worldwide, with roughly 100,000 cases of congenital rubella syndrome estimated to occur every year. Rubella-containing vaccine is highly effective and safe and, as a result, endemic rubella transmission has been interrupted in the Americas since 2009. Incomplete rubella vaccination programmes result in continued disease transmission, as evidenced by recent large outbreaks in Japan and elsewhere. In this Seminar, we provide present results regarding rubella control, elimination, and eradication policies, and a brief review of new laboratory diagnostics. Additionally, we provide novel information about rubella-containing vaccine immunogenetics and review the emerging evidence of interindividual variability in humoral and cell-mediated innate and adaptive immune responses to rubella-containing vaccine and their association with haplotypes and single-nucleotide polymorphisms across the human genome.

Rubella virus: first calcium-requiring viral fusion protein.

Rubella virus (RuV) infection of pregnant women can cause fetal death, miscarriage, or severe fetal malformations, and remains a significant health problem in much of the underdeveloped world. RuV is a small enveloped RNA virus that infects target cells by receptor-mediated endocytosis and low pH-dependent membrane fusion. The structure of the RuV E1 fusion protein was recently solved in its postfusion conformation. RuV E1 is a member of the class II fusion proteins and is structurally related to the alphavirus and flavivirus fusion proteins. Unlike the other known class II fusion proteins, however, RuV E1 contains two fusion loops, with a metal ion complexed between them by the polar residues N88 and D136. Here we demonstrated that RuV infection specifically requires Ca(2+) during virus entry. Other tested cations did not substitute. Ca(2+) was not required for virus binding to cell surface receptors, endocytic uptake, or formation of the low pH-dependent E1 homotrimer. However, Ca(2+) was required for low pH-triggered E1 liposome insertion, virus fusion and infection. Alanine substitution of N88 or D136 was lethal. While the mutant viruses were efficiently assembled and endocytosed by host cells, E1-membrane insertion and fusion were specifically blocked. Together our data indicate that RuV E1 is the first example of a Ca(2+)-dependent viral fusion protein and has a unique membrane interaction mechanism.

Single-nucleotide polymorphism associations in common with immune responses to measles and rubella vaccines.

Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.

Genome-wide characterization of transcriptional patterns in high and low antibody responders to rubella vaccination.

Immune responses to current rubella vaccines demonstrate significant inter-individual variability. We performed mRNA-Seq profiling on PBMCs from high and low antibody responders to rubella vaccination to delineate transcriptional differences upon viral stimulation. Generalized linear models were used to assess the per gene fold change (FC) for stimulated versus unstimulated samples or the interaction between outcome and stimulation. Model results were evaluated by both FC and p-value. Pathway analysis and self-contained gene set tests were performed for assessment of gene group effects. Of 17,566 detected genes, we identified 1,080 highly significant differentially expressed genes upon viral stimulation (p<1.00E(-15), FDR<1.00E(-14)), including various immune function and inflammation-related genes, genes involved in cell signaling, cell regulation and transcription, and genes with unknown function. Analysis by immune outcome and stimulation status identified 27 genes (p≤0.0006 and FDR≤0.30) that responded differently to viral stimulation in high vs. low antibody responders, including major histocompatibility complex (MHC) class I genes (HLA-A, HLA-B and B2M with p = 0.0001, p = 0.0005 and p = 0.0002, respectively), and two genes related to innate immunity and inflammation (EMR3 and MEFV with p = 1.46E(-08) and p = 0.0004, respectively). Pathway and gene set analysis also revealed transcriptional differences in antigen presentation and innate/inflammatory gene sets and pathways between high and low responders. Using mRNA-Seq genome-wide transcriptional profiling, we identified antigen presentation and innate/inflammatory genes that may assist in explaining rubella vaccine-induced immune response variations. Such information may provide new scientific insights into vaccine-induced immunity useful in rational vaccine development and immune response monitoring.

[Progress on mechanism of cell apoptosis induced by rubella virus].

Rubella virus (RV), a member of the family Togaviridae, can induce apoptosis of host cells in vitro. Protein kinases of the Ras-Raf-MEK-ERK pathway and PI3K-Akt pathway play essential roles in virus multiplication, cell survival and apoptosis. Proteins p53 and TAp63 that bind to specific DNA sequences stimulate Bax in a manner to produce functional pores that facilitate release of mitochondrial cytochrome c and downstream caspase activation. In this review, the molecular mechanisms of RV-induced cell apoptosis, including RV-infected cell lines, pathological changes in cell components and apoptosis signaling pathways are summarized.

[Studying of molecular mechanisms of rubella virus attenuation evidence from Russian strain C-77].

Live attenuated rubella vaccine is used for vaccination. Temperature-sensitive (ts) phenotype was proved for almost all rubella vaccine strains, and the acquisition of the ts phenotype during cold adaptation was strongly correlated with the attenuation of the wild-type viruses. Nevertheless, the molecular mechanisms of the attenuation have been insufficiently understood for rubella virus. Study ofthese mechanisms, identifying genotypic markers of attenuation, which together with the sequence analyses could be used for genetic stability control of vaccine strains, is still of current interest. In this work, we determined nearly complete genome sequences of attenuated (ca) and the wildtype progenitor (wt) of the rubella virus strain C-77 isolated in Russia. Possible genetic determinants of attenuation were detected. Thus, 13 nucleotide differences leading to 6 amino acid substitutions were found. Four amino acid substitutions were found to be almost unique. Special consideration should be given to Tyr1042Cys substitution in the protease domain of C-77 strain, because it most probably plays the crucial role in acquisition of ts-phenotype.

Microarray profiling analysis uncovers common molecular mechanisms of rubella virus, human cytomegalovirus, and herpes simplex virus type 2 infections in ECV304 cells.

To study the common molecular mechanisms of various viruses infections that might result in congential cardiovascular diseases in perinatal period, changes in mRNA expression levels of ECV304 cells infected by rubella virus (RUBV), human cytomegalovirus (HCMV), and herpes simplex virus type 2 (HSV-2) were analyzed using a microarray system representing 18,716 human genes. 99 genes were found to exhibit differential expression (80 up-regulated and 19 down-regulated). Biological process analysis showed that 33 signaling pathways including 22 genes were relevant significantly to RV, HCMV and HSV-II infections. Of these 33 biological processes, 28 belong to one-gene biological processes and 5 belong to multiple-gene biological processes. Gene annotation indicated that the 5 multiple-gene biological processes including regulation of cell growth, collagen fibril organization, mRNA transport, cell adhesion and regulation of cell shape, and seven down- or up-regulated genes [CRIM1 (cysteine rich transmembrane BMP regulator 1), WISP2 (WNT1 inducible signaling pathway protein 2), COL12A1 (collagen, type XII, alpha 1), COL11A2 (collagen, type XI, alpha 2), CNTN5 (contactin 5), DDR1 (discoidin domain receptor tyrosine kinase 1), VEGF (vascular endothelial growth factor precursor)], are significantly correlated to RUBV, HCMV and HSV-2 infections in ECV304 cells. The results obtained in this study suggested the common molecular mechanisms of viruses infections that might result in congential cardiovascular diseases.

The Rubella virus capsid is an anti-apoptotic protein that attenuates the pore-forming ability of Bax.

Apoptosis is an important mechanism by which virus-infected cells are eliminated from the host. Accordingly, many viruses have evolved strategies to prevent or delay apoptosis in order to provide a window of opportunity in which virus replication, assembly and egress can take place. Interfering with apoptosis may also be important for establishment and/or maintenance of persistent infections. Whereas large DNA viruses have the luxury of encoding accessory proteins whose primary function is to undermine programmed cell death pathways, it is generally thought that most RNA viruses do not encode these types of proteins. Here we report that the multifunctional capsid protein of Rubella virus is a potent inhibitor of apoptosis. The main mechanism of action was specific for Bax as capsid bound Bax and prevented Bax-induced apoptosis but did not bind Bak nor inhibit Bak-induced apoptosis. Intriguingly, interaction with capsid protein resulted in activation of Bax in the absence of apoptotic stimuli, however, release of cytochrome c from mitochondria and concomitant activation of caspase 3 did not occur. Accordingly, we propose that binding of capsid to Bax induces the formation of hetero-oligomers that are incompetent for pore formation. Importantly, data from reverse genetic studies are consistent with a scenario in which the anti-apoptotic activity of capsid protein is important for virus replication. If so, this would be among the first demonstrations showing that blocking apoptosis is important for replication of an RNA virus. Finally, it is tempting to speculate that other slowly replicating RNA viruses employ similar mechanisms to avoid killing infected cells.

Associations between SNPs in candidate immune-relevant genes and rubella antibody levels: a multigenic assessment.

BACKGROUND: The mechanisms of immune response are structured within a highly complex regulatory system. Genetic associations with variation in the immune response to rubella vaccine have typically been assessed one locus at a time. We simultaneously assessed the associations between 726 SNPs tagging 84 candidate immune response genes and rubella-specific antibody levels. Blood samples were obtained from 714 school-aged children who had received two doses of MMR vaccine. Associations between rubella-specific antibody levels and 726 candidate tagSNPs were assessed both one SNP at a time and in a variety of multigenic analyses. RESULTS: Single-SNP assessments identified 4 SNPs that appeared to be univariately associated with rubella antibody levels: rs2844482 (p = 0.0002) and rs2857708 (p = 0.001) in the 5'UTR of the LTA gene, rs7801617 in the 5'UTR of the IL6 gene (p = 0.0005), and rs4787947 in the 5'UTR of the IL4R gene (p = 0.002). While there was not significant evidence in favor of epistatic genetic associations among the candidate SNPs, multigenic analyses identified 29 SNPs significantly associated with rubella antibody levels when selected as a group (p = 0.017). This collection of SNPs included not only those that were significant univariately, but others that would not have been identified if only considered in isolation from the other SNPs. CONCLUSIONS: For the first time, multigenic assessment of associations between candidate SNPs and rubella antibody levels identified a broad number of genetic associations that would not have been deemed important univariately. It is important to consider approaches like those applied here in order to better understand the full genetic complexity of response to vaccination.

Validation and application of normalization factors for gene expression studies in rubella virus-infected cell lines with quantitative real-time PCR.

Reference genes are generally employed in real-time quantitative PCR (RT-qPCR) experiments to normalize variability between different samples. The aim of this study was to identify and validate appropriate reference genes as internal controls for RT-qPCR experiments in rubella virus (RV)-infected Vero and MCF-7 cell lines using SYBR green fluorescence. The software programs geNorm and NormFinder and the DeltaDeltaC(t) calculation were used to determine the expression stability and thus reliability of nine suitable reference genes. HPRT1 and HUEL, and HUEL and TBP were identified to be most suitable for RT-qPCR analysis of RV-infected Vero and MCF-7 cells, respectively. These genes were used as normalizers for transcriptional activity of selected cellular genes. The results confirm previously published microarray and Northern blot data, particularly on the transcriptional activity of the cyclin-dependent kinase inhibitor p21 and the nuclear body protein SP100. Furthermore, the mRNA level of the mitochondrial protein p32 is increased in RV-infected cells. The effect on cellular gene transcription by RV-infection seems to be cell line-specific, but genes of central importance for viral life cycle appear to be altered to a similar degree. This study does not only provide an accurate and flexible tool for the quantitative analysis of gene expression patterns in RV-infected cell lines. It also indicates, that the suitability of a reference gene as normalizer of RT-qPCR data and the host-cell response to RV-infection are strictly cell-line specific.

SNP/haplotype associations in cytokine and cytokine receptor genes and immunity to rubella vaccine.

An effective immune response to vaccination is, in part, a complex interaction of alleles of multiple genes regulating cytokine networks. We conducted a genotyping study of Th1/Th2/inflammatory cytokines/cytokine receptors in healthy children (n = 738, 11-19 years) to determine associations between individual single-nucleotide polymorphisms (SNPs)/haplotypes and immune outcomes after two doses of rubella vaccine. SNPs (n = 501) were selected using the ldSelect-approach and genotyped using Illumina GoldenGate and TaqMan assays. Rubella-IgG levels were measured by immunoassay and secreted cytokines by ELISA. Linear regression and post hoc haplotype analyses were used to determine associations between single SNPs/haplotypes and immune outcomes. Increased carriage of minor alleles for the promoter SNPs (rs2844482 and rs2857708) of the TNFA gene were associated with dose-related increases in rubella antibodies. IL-6 secretion was co-directionally associated (p < or = 0.01) with five intronic SNPs in the TNFRSF1B gene in an allele dose-related manner, while five promoter/intronic SNPs in the IL12B gene were associated with variations in IL-6 secretion. TNFA haplotype AAACGGGGC (t-statistic = 3.32) and IL12B promoter haplotype TAG (t-statistic = 2.66) were associated with higher levels of (p < or = 0.01) rubella-IgG and IL-6 secretion, respectively. We identified individual SNPs/haplotypes in TNFA/TNFRSF1B and IL12B genes that appear to modulate immunity to rubella vaccination. Identification of such "genetic fingerprints" may predict the outcome of vaccine response and inform new vaccine strategies.

Associations between cytokine/cytokine receptor single nucleotide polymorphisms and humoral immunity to measles, mumps and rubella in a Somali population.

We genotyped a Somali population (n = 85; age < or =30 years) for 617 cytokine and cytokine receptor single nucleotide polymorphisms (SNPs) using Illumina GoldenGate genotyping to determine associations with measles, mumps and rubella immunity. Overall, 61 significant associations (P < or = 0.01) were found between SNPs belonging to cytokine receptor genes regulating T helper (Th)1 (IL12RB2, IL2RA and B) and Th2 (IL4R and IL10RB) immunity, and cytokine (IL1B, TNFA, IL6 and IFNB1) and cytokine receptor (IL1RA, IFNAR2, IL18R1, TNFRSF1A and B) genes regulating innate immunity and variations in antibody levels to measles, mumps and/or rubella. SNPs within two major inflammatory cytokine genes, TNFA and interleukin (IL) 6, showed associations with measles-specific antibodies. Specifically, the minor allele variant of rs1799964 (TNFA -1211 C>T) was associated with primarily seronegative values (median enzyme immunoassay index values < or =0.87; P = 0.002; q = 0.23) in response to measles disease and/or vaccination. A heterozygous variant CT for rs2069849 (IL6 +4272C>T; Phe201Phe) was also associated with seronegative values and a lower median level of antibody response to measles disease and/or vaccination (P = 0.004; q = 0.36) or measles vaccination alone (P = 0.008). Several SNPs within the coding and regulatory regions of cytokine and cytokine receptor genes showed associations with mumps and rubella antibody levels but were less informative as strong linkage disequilibrium patterns and lower frequencies for minor alleles were observed among these SNPs. Our study identifies specific SNPs in innate immune response genes that may play a role in modulating antibody responses to measles vaccination and/or infection in Somali subjects.

Rubella virus-induced superinfection exclusion studied in cells with persisting replicons.

For the first time, homologous superinfection exclusion was documented for rubella virus (RUB) by using Vero cells harbouring persisting RUB replicons. Infection with wild-type RUB was reduced by tenfold, whereas Sindbis virus infection was unaffected. Replication following infection with packaged replicons and transfection with replicon transcripts was also restricted in these cells, indicating that restriction occurred after penetration and entry. Translation of such 'supertransfecting' replicon transcripts was not impaired, but no accumulation of supertransfecting replicon RNA could be detected. We tested the hypothesis favoured in the related alphaviruses that superinfection exclusion is mediated by cleavage of the incoming non-structural precursor by the pre-existing non-structural (NS) protease, resulting in an inhibition of minus-strand RNA synthesis. However, cleavage of a precursor translated from a supertransfecting replicon transcript with an NS protease catalytic-site mutation was not detected and the event in the replication cycle at which superinfection exclusion is executed remains to be elucidated.