A high stable sample loading for analysis of adult alpha-thalassemia via the improved microarray isoelectric focusing of Hb species.

The isoelectric focusing has realized various improvements, including the protocols and creation of mIEF (microcolumn isoelectric focusing) instruments with excellent sensitivity for screening of diabetes and beta thalassemia. However, the problem of manual sample loading and hydration for the mIEF limits the operational capacity for stably detecting and quantitating most abnormal hemoglobin (Hb). Herein, we provided a high stable sample loading protocol for analysis of alpha thalassemia and Hb variants. In contrast to the previous volume of 20 µl, a 100 µl blood sample solution in this protocol was optimized with mixture of 6.4-7.5 and 3-10 pH carrier ampholytes, pI markers and loaded for 30 mins IPG microcolumn hydration. The hydrated microcolumn was then automatically loaded onto the mIEF chip array to which CH3COOH and NH4OH act as anodic and cathodic solutions. Lastly, the IEF was run for 9 mins. Hb H, Barts, A1c, F, A2 and CS were simultaneously separated and focused with higher resolution and sensitivity in quantifying H and Barts as low as 0.6 and 0.5 % respectively. Accordingly, there was an enhanced stability and linearity with a rapid assay time of 45 secs per sample. Moreover, analysis showed a fitting linear relationship with conventional technology at R2 = 0.9803 for H and R2 = 0.9728 for Barts thereby indicating greater accuracy confirmed by the AUC. Hence, the developed protocol could simply be employed for high stable and throughput batch sample loading of hydration, and accurate separation and quantitation of Hb variants for alpha and beta thalassemia.

Detection of α-thalassemia South-East Asian deletion based on a fully integrated digital polymerase chain reaction system DropXpert S6.

OBJECTIVES: This study aimed to establish a droplet digital polymerase chain reaction (ddPCR) assay for South-East Asian (SEA) deletion based on a fully integrated digital PCR system DropXpert S6. METHODS: A total of 151 whole blood samples, 10 chorionic villus samples, and 17 amniotic fluid samples were collected, including 106 SEA heterozygotes, 43 normal individuals, 10 Hb Bart's hydrops details, and 19 SEA deletions combined with other genotypes.Genotypes of these samples were determined by the Gap-PCR method. We perform a series of optimizations of the ddPCR system to ensure the performance of the entire ddPCR reaction, such as droplet stability, fluorescence clustering, sensitivity, and accuracy. RESULTS: Our assay exhibited 99.4% (177/178) accuracy compared with the Gap-PCR method, and the minimum detection limit of DNA was 0.1 ng/µL.Both targets have reliable linearity, R2 = 0.9999 for the α-thalassemia SEA deletion allele and R2 = 1 for the wild-type allele. The coefficient of variation for α-thalassemia SEA deletion allele detection at 2 and 10 ng/µL concentrations was 5.42% and 1.91%, respectively. In contrast, the coefficient of variation for wild-type allele detection was 4.06% and 1.83%, demonstrating its high quantitative accuracy. In addition, the DropXpert S6 PCR system showed some advantages over other ddPCR instruments, such as reducing testing costs, simplifying and automating the workflow. CONCLUSIONS: The DropXpert S6 PCR system provided a highly accurate diagnosis for α-thalassemia SEA deletion and can be used to detect α-thalassemia as an alternative method.

Support Vector Machine-Based Formula for Detecting Suspected α Thalassemia Carriers: A Path toward Universal Screening.

The blood counts of α thalassemia carriers (α-thal) are similar to those of ß thalassemia carriers, except for Hemoglobin A2 (Hb A2), which is not elevated. The objective of this study was to determine whether mathematical formulas are effective for detecting suspected α-thal. The data were obtained from the database of the prevention program for detecting couples at risk for having a child with hemoglobinopathy. Red Blood Cells (RBC) indices were analyzed using mathematical formulas, and the sensitivity and negative predictive value (NPV) were calculated. Among 1334 blood counts suspected of α-thal analyzed, only the Shine and Lal and the Support Vector Machine formulas revealed high sensitivity and NPV. Sensitivity was 85.54 and 99.33%, and NPV was 98.93 and 99.93%, respectively. Molecular defects were found in 291, and 81 had normal α genes. Molecular analysis was not performed in 962 of the samples. Based on these results, mathematical formulas incorporating one of these reliable formulas for detecting suspected α or ß thalassemia carriers in the program of the automatic analyzers can flag these results, increase the awareness of the primary physicians about the carrier risk, and send an alert with a recommendation for further testing.

Survival of transfused red blood cells from a donor with alpha-thalassemia trait in a recipient with sickle cell disease.

BACKGROUND: Post-transfusion survival of donor red blood cells (RBCs) is important for effective chronic transfusion therapy in conditions including sickle cell disease (SCD). Biotin labeling RBCs allows direct in vivo measurement of multiple donor RBC units simultaneously post-transfusion. STUDY DESIGN AND METHODS: In an observational trial of patients with SCD receiving monthly chronic transfusion therapy, aliquots of RBCs from one transfusion episode were biotin-labeled and infused along with the unlabeled RBC units. Serial blood samples were obtained to measure RBC survival. Donor units were tested for RBC indices, hemoglobin fractionation, and glucose-6-phosphate dehydrogenase (G6PD) enzyme activity. For microcytic donor RBCs (MCV < 70 fL), HBA1 and HBA2 genetic testing was performed on whole blood. RESULTS: We present one recipient, a pediatric patient with SCD and splenectomy who received two RBC units with aliquots from each unit labeled at distinct biotin densities (2 and 18 µg/mL biotin). One donor unit was identified to have microcytosis (MCV 68.5 fL after biotinylation); whole blood sample obtained at a subsequent donation showed 2-gene deletion alpha-thalassemia trait (ɑ-3.7kb/ɑ-3.7kb) and normal serum ferritin. G6PD activity was >60% of normal mean for both. The RBCs with alpha-thalassemia RBC had accelerated clearance and increased surface phosphatidylserine post-transfusion, as compared with the normocytic RBC (half life 65 vs. 86 days, respectively). DISCUSSION: Post-transfusion RBC survival may be lower for units from donors with alpha-thalassemia trait, although the impact of thalassemia trait donors on transfusion efficacy requires further study.

A clinical update of compound heterozygosity for hemoglobin Hekinan II [a27(B8)Glu-Asp; HBA1: c.84G>T] variant in China.

BACKGROUND: Hemoglobin (Hb) Hekinan II (A27; Glu-Asp) is an α-chain variant, and its interaction with the common Southeast Asian (--SEA/) α-thalassemia (α-thal) deletion is rarely reported. This study provides a clinical update of Hb Hekinan II associated with (--SEA/) α-thal. METHODS: A total of 11 simple heterozygotes and 20 composite heterozygotes for Hb Hekinan II and (--SEA/) α-thal were included based on molecular diagnosis. RESULTS: Hb Hekinan II exhibited a significant increase in hemoglobin, mean corpuscular volume, and mean corpuscular hemoglobin content, but a decrease in red blood cell level compared with α+ thalassemia deletion. Compared with (--SEA/) α-thal, composite heterozygotes for Hb Hekinan II and (--SEA/) α-thal showed similar erythrocyte parameters. Both heterozygotes with and without (--SEA/) α-thal showed low Hb A2 level. Hb Hekinan II showed abnormal performance in high-performance liquid chromatography but not in capillary electrophoresis. CONCLUSION: Hb Hekinan II is a benign Hb variant. The heterozygotes exhibit clinically asymptomatic coinheritance with (--SEA/) α-thal having comparable hematological phenotype to simple (--SEA/) α-thal. The combination of hematological and molecular analysis helped to improve the detection rate of this rare variant.

Clinical experience using peripheral blood parameters to analyse the mutation type of thalassemia carriers in pregnant women.

Thalassaemia is a typically monogenic disease caused by mutations or deletions in the globin gene and has a high prevalence in southern China. Prenatal screening for thalassaemia can be effective in reducing the incidence of thalassaemia. Haematologic parameters of pregnant thalassaemia carriers are diverse and potentially valuable for identifying different types of genotypes. By comparing and evaluating haematological parameters, formulas in the literature, we tried to reveal differences between pregnant women carrying different types of thalassaemia genes. The Mentzer formula (MCV/RBC) showed a strong ability to differentiate thalassaemia genotypes in pregnant women. In addition, combined with haemoglobin electrophoresis HbA2 can further distinguish the -α/αα, αTα/αα, -/αα, ß+/N and ß0/N groups. HbA2 divides them into two groups. Based on the Mentzer formula, we can further decide which type of thalassaemia to screen (α/ß and the subgroups) for genotyping. Therefore, this simpler and more cost-effective workflow has great potential for application in screening pregnant women for thalassaemia carriers.Impact StatementWhat is already known on this subject? Currently, it is known that thalassaemia gene carriers have abnormal blood indicators. Many findings describe their important values in distinguishing thalassaemia and other blood diseases. They combined different metrics as an algorithm to distinguish thalassaemia and iron deficiency anaemia. Prenatal screening is an effective method to reduce the incidence of thalassaemia. The current main method is PCR. Due to technical and financial constraints, many backward places cannot use this technology. The necessity for prenatal screening for thalassaemia has been overlooked.What the results of this study add? Among these algorithms, Mentzer formula revealed differences in haematological parameters during pregnancy between normal individuals and thalassaemia carriers. Combining the HbA2, thalassaemia carriers can be distinguished from normal individuals, including -α/αα, αTα/αα, -/αα, ß0/N and ß+/N.What are the implications of these findings for clinical practice and/or further research? We provide another tool for these hospitals that donot have Hb electrophoresis test and PCR. Then the clinical doctor can get some evidence and suggest women go to another big hospital for essential tests. It is an excellent suggestion. In the future, we will collect more specific gene types and further investigate their potential relationship using these formulas.

Five novel globin gene mutations identified in five Chinese families by next-generation sequencing.

BACKGROUND: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of ß-thalassemia caused by five different mutations in the globin gene. METHODS: Next-generation sequencing (NGS) was used to identify novel α- and ß-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. RESULTS: NGS revealed five novel cases of α- and ß-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed. CONCLUSION: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.

Comparisons of oxygen gradient ektacytometry parameters between sickle cell patients with or without α-thalassaemia.

The present study tested the impact of α-thalassaemia on oxygen gradient ektacytometry in sickle cell anaemia (SCA). Three SCA groups were compared: (i) no α-thalassaemia (four α-genes, n = 62), (ii) silent α-thalassaemia (three α-genes, n = 35) and (iii) homozygous α-thalassaemia (two α-genes, n = 12). Red blood cell (RBC) deformability measured in normoxia was not different between the three groups. The lowest RBC deformability reached at low oxygen partial pressure (pO2 ) was greater and the pO2 at which RBC started to sickle was lower in the two α-genes group compared to the other groups. Our present study showed an effect of α-thalassaemia on oxygen gradient ektacytometry in SCA.

Breakpoint characterization of a rare alpha0 -thalassemia deletion using targeted locus amplification on genomic DNA.

INTRODUCTION: The high-sequence homology of the α-globin-gene cluster is responsible for microhomology-mediated recombination events during meiosis, resulting in a high density of deletion breakpoints within a 10 kb region. Commonly used deletion detection methods, such as multiplex ligation-dependent probe amplification (MLPA) and Southern blot, cannot exactly define the breakpoints. This typically requires long-range PCR, which is not always successful. Targeted locus amplification (TLA) is a targeted enrichment method that can be used to sequence up to 70 kb of neighboring DNA sequences without prior knowledge about the target site. METHODS: Genomic DNA (gDNA) TLA is a technique that folds isolated DNA, ensuring that adjacent loci are in a close spatial proximity. Subsequent digestion and religation form DNA circles that are amplified using fragment-specific inverse primers, creating a library that is suitable for Illumina sequencing. RESULTS: Here, we describe the characterization of a rare 16 771 bp deletion, utilizing gDNA TLA with a single inverse PCR primer set on one end of the breakpoint. Primers for breakpoint PCR were designed to confirm the deletion breakpoints and were consequently used to characterize the same deletion in 10 additional carriers sharing comparable hematologic data and similar MLPA results. CONCLUSIONS: The gDNA TLA technology was successfully used to identify deletion breakpoints within the alpha-globin cluster. The deletion was described only once in an earlier study as the --gb , but as it was not registered correctly in the available databases, it was not initially recognized as such.

The serum ferritin levels and liver iron concentrations in patients with alpha-thalassemia: is there a good correlation?

INTRODUCTION: Liver iron overload is common in patients with thalassemia. In patients with beta-thalassemia, the correlation between serum ferritin and liver iron concentration is well established. The correlation between serum ferritin levels and liver iron concentrations in patients with alpha-thalassemia remains limited. METHODS: This is a cross-sectional study in patients with alpha-thalassemia aged ≥ 18 years old at Srinagarind Hospital, Khon Kaen University, Thailand. Liver iron concentration (LIC) was evaluated by the MRI-T2* technique. Linear logistic regression analysis was used to determine the correlation between serum ferritin levels and liver iron concentrations. RESULTS: One hundred and thirty-one of the MRI-T2* measurements from 65 patients with alpha-thalassemia were evaluated. Patients with non-deletional alpha-thalassemia had higher LIC compared to patients with deletional alpha-thalassemia. The serum ferritin levels were relatively low at the same levels of LIC in patients with non-deletional alpha-thalassemia compared to deletional alpha-thalassemia. CONCLUSIONS: The correlation of serum ferritin levels and LIC was modest and different among alpha-thalassemia genotypes. A different serum ferritin threshold is needed to guide iron chelation therapy in patients with alpha-thalassemia. Evaluation of liver iron concentration is necessary for patients with alpha-thalassemia, especially in patients with non-deletional alpha-thalassemia.

A More Universal Approach to Comprehensive Analysis of Thalassemia Alleles (CATSA).

The aim of the study was to assess the clinical utility of a third-generation sequencing (TGS) approach termed comprehensive analysis of thalassemia alleles (CATSA) for identifying both α and ß thalassemia genetic carrier status. Prospective blood samples (n = 1759) with abnormal hemoglobin parameters were screened for pathogenic thalassemia variants by CATSA on the PacBio TGS platform. In 1159 individuals, a total of 1317 pathogenic thalassemia variants were identified and confirmed by independent PCR-based tests. Of the total thalassemia variants detected, the α-variant --SEA (35.4%) and ß-variant c.126_129delCTTT (15%) were the most common. CATSA was also able to detect three types of rare HBA structural variants as well as five rare HBA2, three HBA1, and 10 HBB single-nucleotide variations/insertions and deletions. Compared with standard thalassemia variant PCR panel testing, CATSA identified all panel variants present, with no false-negative results. Carrier assignment was improved through identification of rare variants missed by the panel test. On the basis of allelic coverage, reliability, and accuracy, TGS with long-range PCR presents a comprehensive approach with the potential to provide a universal solution for thalassemia genetic carrier screening. It is proposed that CATSA has immediate clinical utility as an effective carrier screening approach for at-risk couples.

Fetal Cytokine Balance, Erythropoietin and Thalassemia but Not Placental Malaria Contribute to Fetal Anemia Risk in Tanzania.

Fetal anemia is common in malaria-endemic areas and a risk factor for anemia as well as mortality during infancy. Placental malaria (PM) and red cell abnormalities have been proposed as possible etiologies, but the relationship between PM and fetal anemia has varied in earlier studies, and the role of red cell abnormalities has not been studied in malaria-endemic areas. In a Tanzanian birth cohort study designed to elucidate the pathogenesis of severe malaria in young infants, we performed a cross-sectional analysis of risk factors for fetal anemia. We determined PM status, newborn red cell abnormalities, and maternal and cord blood levels of iron regulatory proteins, erythropoietin (EPO), cytokines and cytokine receptors. We examined the relationship between these factors and fetal anemia. Fetal anemia was present in 46.2% of the neonates but was not related to PM. Maternal iron deficiency was common (81.6%), most frequent in multigravidae, and interacted with parity to modify risk of fetal anemia, but it was not directly related to risk. Among offspring of iron-deficient women, the odds of fetal anemia increased with fetal α+-thalassemia, as well as these patterns of cord blood cytokines: increased cord IL-6, decreased TNF-RI, and decreased sTfR. The EPO response to fetal anemia was low or absent and EPO levels were significantly decreased in newborns with the most severe anemia. This study from an area of high malaria transmission provides evidence that 1) fetal α+-thalassemia and cytokine balance, but not PM at delivery, are related to fetal anemia; 2) maternal iron deficiency increases the risk that other factors may cause fetal anemia; and 3) fetal anemia has a multifactorial etiology that may require a variety of interventions, although measures that reduce maternal iron deficiency may be generally beneficial.

Telomere shortening correlates with disease severity in hemoglobin H disease patients.

Hemoglobin H (Hb H) disease is the most significant health problem of the α-thalassemia syndromes. The Hb disease patients are categorized based on their genotype to deletional and nondeletional, with the latter genotype presents the more severe clinical symptoms. Since telomere length is an indicator of biological aging and health, we hypothesized that telomere length could reflect Hb H disease's severity. In this study, we recruited 48 deletional and 47 nondeletional Hb H disease patients, along with 109 normal controls, for telomere length assessment. The leukocyte telomere length was assessed by monochromatic multiplex real-time PCR and reported as the telomere to single-copy gene (T/S) ratio. When telomere length was adjusted for age, the analysis of covariance between the control and the two Hb H disease groups revealed no significant difference. However, the telomere shortening rate was more rapid in the nondeletional Hb H disease group than those of the control and deletional Hb H disease groups. Gender analysis found that male patients have a significantly lower T/S ratio than females in the nondeletional group but not in the control and deletional groups. In the two disease groups, the T/S ratio was not influenced by ferritin level or transfusion burden but was positively correlated with the absolute reticulocyte count.

Influence of UGT1A1 promoter polymorphism, α-thalassemia and ßs haplotype in bilirubin levels and cholelithiasis in a large sickle cell anemia cohort.

Hyperbilirubinemia in patients with sickle cell anemia (SCA) as a result of enhanced erythrocyte destruction, lead to cholelithiasis development in a subset of patients. Evidence suggests that hyperbilirubinemia may be related to genetic variations, such as the UGT1A1 gene promoter polymorphism, which causes Gilbert syndrome (GS). Here, we aimed to determine the frequencies of UGT1A1 promoter alleles, alpha thalassemia, and ßS haplotypes and analyze their association with cholelithiasis and bilirubin levels. The UGT1A1 alleles, -3.7 kb alpha thalassemia deletion and ßS haplotypes were determined using DNA sequencing and PCR-based assays in 913 patients with SCA. The mean of total and unconjugated bilirubin and the frequency of cholelithiasis in GS patients were higher when compared to those without this condition, regardless of age (P < 0.05). Cumulative analysis demonstrated an early age-at-onset for cholelithiasis in GS genotypes (P < 0.05). Low fetal hemoglobin (HbF) levels and normal alpha thalassemia genotype were related to cholelithiasis development (P > 0.05). However, not cholelithiasis but total and unconjugated bilirubin levels were associated with ßS haplotype. These findings confirm in a large cohort that the UGT1A1 polymorphism influences cholelithiasis and hyperbilirubinemia in SCA. HbF and alpha thalassemia also appear as modulators for cholelithiasis risk.

Alpha thalassemia, but not ßS-globin haplotypes, influence sickle cell anemia clinical outcome in a large, single-center Brazilian cohort.

Alpha thalassemia and beta-globin haplotype are considered classical genetic disease modifiers in sickle cell anemia (SCA) causing clinical heterogeneity. Nevertheless, their functional impact on SCA disease emergence and progression remains elusive. To better understand the role of alpha thalassemia and beta-globin haplotype in SCA, we performed a retrospective study evaluating the clinical manifestations of 614 patients. The univariate analysis showed that the presence of alpha-thalassemia -3.7-kb mutation (αα/-α and -α/-α) decreased the risk of stroke development (p = 0.046), priapism (p = 0.033), and cholelithiasis (p = 0.021). Furthermore, the cumulative incidence of stroke (p = 0.023) and cholelithiasis (p = 0.006) was also significantly lower for patients carrying the alpha thalassemia -3.7-kb mutation. No clinical effects were associated with the beta-globin haplotype analysis, which could be explained by the relatively homogeneous haplotype composition in our cohort. Our results reinforce that alpha thalassemia can provide protective functions against hemolysis-related symptoms in SCA. Although, several genetic modifiers can impact the inflammatory state of SCA patients, the alpha thalassemia mutation remains one of the most recurrent genetic aberration and should therefore always be considered first.

Comparison of cord blood hematological parameters among normal, α-thalassemia, and ß-thalassemia fetuses between 17 and 38 weeks of gestation.

The aim of this study was to retrospectively compare hematological parameters among normal, α-, and ß-thalassemia fetuses between 17 and 38 weeks of gestation. Pregnant women at risk of having fetuses with thalassemia major and underwent cordocentesis for prenatal diagnosis were recruited. Fetal cord blood samples were collected from 249 fetuses for hematological and DNA analysis. Fetuses were divided into subgroups according to thalassemia DNA genotypes. The average and gestational age of subjects were 27.95 ± 5.78 years and 27.78 ± 3.57 weeks, respectively. The distribution of α-thalassemia, ß-thalassemia, and normal cases was 67.87%, 19.68%, and 12.45%, respectively. Significant differences in almost all the hematological parameters (HbF, HbA, Hb, HCT, MCV, MCH, MCHC, RDW, and NBRCs) were observed in three groups (P < 0.001, except for RBC, P = 0.446). These differences were also observed in four α-thalassemia subgroups (P < 0.001) and were associated with the number of defected genes. Similarly, in five ß-thalassemia genotypes, HbF, HbA, RBC, MCV, MCH and NBRCs were presented differently (P < 0.05). Additionally, the trends in RBC, Hb, and HCT changes in three α-thalassemia subgroups (silent carrier, trait, and major) and ß+/ß+ fetuses' MCV, MCH, and RDW levels with gestation age were opposite to those of normal fetuses. We compared the distribution of hematological parameters in fetuses affected by most genotypes of thalassemia, as well as their trends in relation to gestational age for the first time, which is a good reference for future studies and prenatal diagnostic practices. The investigated hematological parameters are also valuable in diagnosing and differentiating thalassemia.

Molecular epidemiological and hematological profile of thalassemia in the Dongguan Region of Guangdong Province, Southern China.

BACKGROUND: Thalassemia is a common inherited hematological disease in tropical and subtropical regions. This study aimed to investigate the mutation spectrum of thalassemia in the Dongguan region of southern China and comprehensively analyze hematologic features of thalassemia carriers with various types of globin mutations. METHODS: A hematological screening including hematological indices such as mean corpuscular volume (MCV), mean corpuscular hemoglobin content (MCH), and mean corpuscular hemoglobin concentration (MCHC) was conducted in 19 442 people from Dongguan region, Guangdong province of China. Then, 4891 suspected thalassemia carriers were further investigated by genetic analysis of combined NGS and gap-PCR. RESULTS: Totally, 2319 (11.9%) cases were diagnosed as carriers of thalassemia, of which 1483 cases (7.6%) were α-thalassemia, 741 cases (3.8%) were ß-thalassemia, and 95 cases (0.5%) were co-inheritance of α- and ß-thalassemia. In α-thalassemia carriers, the phenotypic severity increases with the number of nonfunctional α-globin genes. The patients with -SEA /αWS α genotype have less severe clinical phenotypes than those with other Hb H diseases. As for ß-thalassemia, the MCV and MCH in both ß0 and ß+ carriers are markedly reduced. CONCLUSIONS: This is the first comprehensive molecular epidemiological survey and hematological profiling of thalassemia in Dongguan area. This study will be benefit for genetic counseling in the clinic and may help pediatricians to make a correct diagnosis of different types of thalassemia.