Dexamethasone action on caudal fin regeneration of carp Cyprinus carpio (Linnaeus, 1758).

Studies have demonstrated that the prolonged use of corticoids can delay the healing process, affecting re-epithelialization, neovascularization and collagen synthesis. As the fins of teleost fish contain a large amount of collagen, the aim of the present study was to investigate the effect of dexamethasone (anti-inflammatory and glucocorticoid steroid widely used in the treatment of rheumatic diseases) during the regeneration process in the caudal fin of specimens of carp (Cyprinus carpio). For such, two glass aquaria were used - one for a group of fish treated with dexamethasone (Henrifarma) in a 20 mg/L concentration and the other for the control group. The caudal fins were amputated transversally and fish remained in their respective aquaria until regeneration occurred. Samples of regenerating fins were collected on days 1, 2, 4, 6, 8 and 10 after amputation. The fins in the control group regenerated normally and grew within the expected in time course. The fins in the group treated with dexamethasone were significantly smaller in comparison to the control group at every evaluation time. Thus, it was possible to verify that, at this concentration of dexamethasone, the regeneration of the caudal fins was delayed, but not completely inhibited. The results show that the caudal fin is a good model for histological studies on regeneration and the action of drug toxicity, but it's also of great importance the interaction with further studies for a better knowledge and understanding of all the changes in all the phases.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Influence of indomethacin on the regenerative process of the tail fin of teleost: morphometric and ultrastructural analysis.

When partially amputated or severely injured, teleost fins suffer a regenerative process called epimorphic regeneration characterised by the following stages: the formation of a multistratified epidermal layer, the disorganisation and distal migration of multipotent mesenchymal cells, the proliferation of these cells in order to form the blastema, continuous proliferation of distal blastema to facilitate the growth, and differentiation of the proximal blastema in order to restore its lost structure. The regeneration of the fin is extremely sensitive to the action of some drugs that can interfere in its structure restoration. For this reason, and also based on papers relating that indomethacin can interfere somehow in the tissue restoration of many different organisms, the aim of this work is to evaluate the possible effects of this drug in three different doses in the regeneration of the teleost fish tail fin, taking into consideration the synthesis, the disposition and organisation of lepidotrichial matrix components, the restoration of actinotrichia, as well as the fin area itself. Therefore, histochemical, ultrastructural and morphometric analysis were done and it was observed that indomethacin in doses of 20 and 30 mg.L-1 caused a delay in the regenerative process of the dermal skeleton (lepidotrichia and actinotrichia) of the tail fins. These doses could have interfered, momentarily, in the process of blastemal cell differentiation in the cells responsible for the synthesis and disposition of actinotrichia and lepidotrichia or, even interfered in the signalling necessary for the recent differentiated cells to begin synthesising the components of the dermal skeleton.

Histological study of the dynamics in epidermis regeneration of the carp tail fin (Cyprinus carpio, Linnaeus, 1758).

Teleostean fins when partially amputated suffer a regenerative process called epimorphic regeneration, characterized by the following stages: healing, based on the formation of a multistratified epidermal layer, the formation of a mass of pluripotent cells known as blastema, the differentiation of these cells, the synthesis and disposition of the extracellular matrix, morphological growth and restoration. The epidermis has a fundamental role in the regenerative process of fish fins, as the healing time of this structure leads it to a faster regenerative process and it also works as a defense against the external environment. In this sense, due to the fast regeneration shown by the epidermis, the aim of this paper is to study the histology of the regenerative dynamics of the carp fin tail (Cyprinus carpio), under the light and transmission electron microscope. Epidermic regeneration begins right in the first hours after the fin amputation and it continues throughout the regenerative process. After 24 hours, an apical epidermal cap is established. Cytoplasmatic prolongations and intercellular junctions are observed and the cells of the basal layer of the epidermis change from the cubic form to the cylindrical, due to the development of the cytoplasmatic organelles responsible for the synthesis of the basal membrane, lost after amputation. These results show the importance of histological studies in regenerative processes. We believe that the association of molecular biology with histological studies can throw further light onto these regenerative dynamics.

The regeneration of the tail fin actinotrichia of carp (Cyprinus carpio, Linnaeus, 1758) under the action of naproxen.

A conglomerate of small, rigid, fusiform spicules known as actinotrichia sustains the edge of tail fins of teleost. After amputation, these structures show an extremely fast regenerative capacity. In this study we observed the effect of a nonsteroidal anti-inflammatory drug, naproxen, used in the treatment of degenerative articular diseases, during the process of actinotrichia regeneration. For this purpose, regenerating tissue from animals in contact with the drug was submitted to histochemical and ultrastructural analysis in comparison to tissue from animals under normal conditions, i.e., not in contact with the drug in question. Actinotrichia regeneration was similar in both animals, indicating that naproxen, at the dose used in the present study, did not interfere with actinotrichia synthesis during the regenerative process of the tail fin. This could be because naproxen did not influence the expression of the genes required for the regeneration process, such as the Sonic hedgehog (Shh) gene, which is involved in actinotrichia formation.

Effect of naproxen on tail fin regeneration in teleost.

In the present investigation we studied the effect of naproxen, a non-steroidal anti-inflammatory drug used for the treatment of rheumatic disease, on the synthesis of the lepidotrichial matrix of the tail fin of the teleost fish Cyprinus carpio (carp) during the regeneration process. The lepidotrichial synthesis was observed by standard and polarized light microscopy and by transmission electron microscopy. In general, naproxen at the dose used in the present study did not affect the organization of the extracellular matrix components and the mineralization of the fundamental substance of the lepidotrichia during the process of tail fin regeneration. Since the effect of naproxen, as well as of other non-steroidal anti-inflammatory drugs, depends on the dose used, the route of administration and the metabolism of the animal in which the drug is being tested, higher doses of the drug may perhaps delay or even fully inhibit this process, possibly also provoke disorganization of the lepidotrichial matrix.

Histologic study of head cartilage degeneration in rainbow trout (Oncorhynchus mykiss) infected with the parasite Myxobolus cerebralis.

A light microscopy study of head cartilage tissue in rainbow trout alevins (Oncorhynchus mykiss) infected with the parasite Myxobolus cerebralis showed that, regardless of the presence or absence of whirling disease symptoms such as black tail and whirling swimming due to altered tail and spine morphology, some fish presented large amounts of spores lodged in the head after three months of infection. The spores were located in regions where the cartilage was extensively destroyed.

Study of the tail fin rays of rainbow trout (Oncorhynchus mykiss) infected with the parasite Myxobolus cerebralis.

A light, transmission and scanning microscope study of the rays (lepidotrichia) forming the tail fin of rainbow trout (Oncorhynchus mykiss) fingerlings infected with the parasite Myxobolus cerebralis showed that triactinomyxon adherence to the tail fin of host fingerlings occurred 10 min after infection. After 2 h of exposure, it was possible to observe triactinomyxon spores in the epidermis. Although the characteristic symptoms of the disease, such as a black tail and a change in tail morphology, were observed, there was no attack against the tissue forming the tail fin rays and triactinomyxon spores were not observed inside the leptotrichial matrix at any stage, indicating that the spores do not reach the rays or that their observation was not possible under the conditions of the present study.

Collagen-affecting drugs impair regeneration of teleost tail fins.

Regenerating tail fins were studied in two species of teleosts, Tilapia rendalli and Cyprinus carpio, treated with indomethacin, aspirin, dexamethasone, penicillamine, and beta-aminoproprionitrile, drugs known to disrupt collagen metabolism in mammals. Collagen was studied under the light microscope by the Picrosirius-polarization method and also under the electron microscope. In general, these drugs disturbed the deposition and organization of collagen fibrils leading to abnormally thin or practically absent lepidotrichia and actinotrichia, and also to disorganized fibrous connective tissue. The resulting disorganization of the collagenous scaffolding of the regenerating dermoskeleton was probably responsible for a secondary effect on blastema distalization and on the general fin ray patterning that were also observed. The foregoing observations suggest that the stromal histoarchitecture of the regenerate plays a vital role in fin regeneration and indicate that these drugs may be useful in studying the extracellular matrix-cell interactions at the cellular and molecular level. In addition, the present findings provide a basis for developing different biological models by using teleost fin regeneration.

Phospholipid containing choline histochemistry of mouse uterine epithelia during preimplantation stage.

The physiological role of high lipid content in endometrial cells during pregnancy has not been well established. In the present work we used histochemical techniques to analyze the total lipids and phospholipid containing choline (PCC) in the mouse uterine glandular and luminal epithelia during preimplantation stage. Sudan black histochemistry showed the highest intensity during the second day of pregnancy in both the basal and apical portions of luminal epithelium. Peaks of PCC staining were seen both in the luminal and glandular epithelia at the second and fifth days of pregnancy. Changes in localization and in the amount of lipid in the uterine epithelia suggest high mobility and metabolic rates of this substance, which may be related to morphological and/or functional changes occurring at the same time in the pregnant uterus. The increase and depletion timing of PCC content in the uterine epithelia during preimplantation stage, when uterine prostaglandin is also oscillating, suggest a possible involvement of PCC in prostaglandin biosynthesis. Therefore, the fate of lipid droplets found in the uterine epithelia may be related to critical changes of the pregnant endometrium, rather than the nourishment of developing embryos alone.

Regeneration of fin rays in teleosts: a histochemical, radioautographic, and ultrastructural study.

Regeneration followed partial amputation of the tail fin in three representative species of teleosts. A systematic study, using histochemical methods, radioautography and transmission electron microscopy, disclosed the essentials of the natural history of regeneration of the fin soft-rays. At about 24 hours, epidermal cells had completely covered the cut edge. By the second day an apical epidermal cap was established. Beneath this cap a blastema was formed by about three days after amputation. A collagenous lepidotrichial matrix had begun to develop by 4 days after excision. Actinotrichia were first detected in the regenerates at 5 days. During these processes, the basal lamina of the epidermis played an important morphogenetic role. The cells responsible for the regenerate underwent regressive changes after form and function had been restored.

Histochemical detection of vitamins D, E and cholesterol in the tailfin rays of the teleost Tilapia rendalli

As nadadeiras dos teleósteos säo constituídas por unidades esqueléticas segmentares denominadas lepidotriquiais ou raios. Essas nadadeiras estäo envolvidas em processos regenerativos: assim, o conhecimento de sua estruturaçäo normal é de fundamental importância tanto para a compreensäo do processo de crescimento como de sua regeneraçäo. Com o objetivo de detectar substâncias lipídicas, as nadadeiras caudais foram fixadas pela formalina contendo bicloreto de cálcio a 3 por cento por 24 horas, à temperatura ambiente. Cortes com 10um de espessura, obtidos em micrótomo de congelaçäo foram submetidos às seguintes reaçöes histoquímicas específicas para lipídios: 1) Permanganato de Potássio Alcalino - Azul de Toluidina, para detecçäo de vitamina D; 2) Acido Perfórmico-Azul de Toluidina, para detecçäo de vitamina E e 3) Acido Peracético-Azul de Toluidina, para detecçäo de colesterol. Os controles para os testes histoquímicos 1, 2 e 3 foram feitos omitindo-se o agente oxidante. Reaçöes positivas obtidas para as reaçöes 1, 2 e 3 demonstraram a presença de vitamina D, E e colesterol nos raios das nadadeiras caudais da espécie Tilapia rendalli

Basofilia e anisotropia nucleares em celulas de camundongo apos tratamento com oxamniquine. / Nuclear basophilia and anisotropy in cells of mice treated with oxamniquine

Com objetivo de se estudar a acao da oxamniquine, uma droga utilizada no tratamento da esquistossomose, sobre a cromatina de nucleos de celulas animais, foram estudados os padroes de basofilia e anisotropia nucleares em hepatocitos, em celulas do musculo cardiaco e em linfocitos de camundongos adultos jovens. A oxamniquine foi administrada por via oral ( 436 mg/Kg ) e preparados foram obtidos apos diversos tempos de fornecimento da droga aos animais. Nos nucleos corados com azul de toluidina a pH 4,0, apos digestao com RNAse, nao se encontrou diferenca quanto aos padroes de basofilia e anisotropia comparando-se animais tratados com controles. Demonstrou-se assim que as moleculas de oxamniquine nao se alojam no interior da dupla helice do DNA, nao alteram a sua conformacao helicoidal nem se ligam aos grupos fosfatos livres desta macromolecula, diferindo, portanto, da atuacao de outro esquistossomicida, o hycanthone