RESUMO
PURPOSE: To study the stability of physicochemical properties and sterilizing effect about two commercially available hypochlorous acid (HClO) products under simulated clinical conditions, and to evaluate the compatibility of HClO on soft and hard tissues and cells in oral cavity. METHODS: Samples of HClO solution with different production processes were prepared, to detect the changes of physicochemical indexes of each sample over time under simulated clinical conditions (shielded from light at 20-25 â, open the cover for 5 minutes every day), including free available chlorine, oxidation-reduction potential and pH. Through suspension quantitative germicidal test, the antibiosis-concentration curve of HClO solution was made, so as to calibrate the change of antibacterial ability of disinfectant with the decrease of available chlorine content during storage. Pulp, tongue and dentine were immersed in PBS, 100 ppm HClO, 200 ppm HClO and 3% NaClO. The influence on soft and hard tissues was evaluated by weighing method and microhardness test. The toxic effects of HClO, NaClO and their 10-fold diluent on human gingival fibroblasts were determined by CCK-8 cytotoxicity assay. GraphPad PRIS 8.0 software was used to analyze the data. RESULTS: Under simulated conditions, the free available chlorine (FAC) of HClO solution decayed with time, and the attenuation degree was less than 20 ppm within 1 month. The bactericidal effect of each HClO sample was still higher than 5log after concentration decay. There was no obvious dissolution and destruction to soft and hard tissues for HClO(Pï¼0.05). The cell viability of HClO to human gingival fibroblast cells (HGFC) was greater than 80%, which was much higher than 3% NaClO (Pï¼0.001). CONCLUSIONS: The bactericidal effect and stability of HClO solution can meet clinical needs, which has low cytotoxicity and good histocompatibility. It is expected to become a safe and efficient disinfection product in the field of living pulp preservation and dental pulp regeneration.
Assuntos
Fibroblastos , Ácido Hipocloroso , Boca , Ácido Hipocloroso/química , Humanos , Boca/efeitos dos fármacos , Fibroblastos/efeitos dos fármacos , Gengiva/citologia , Gengiva/efeitos dos fármacos , Irritantes , Desinfetantes/farmacologia , Desinfetantes/química , Antibacterianos/farmacologia , Antibacterianos/químicaRESUMO
OBJECTIVE: To describe multimodal imaging of peculiar bilateral globular subretinal deposits and acquired serous retinal detachment in patients with systemic immunoglobulin light chain deposition. DESIGN: A retrospective observational case series. PARTICIPANTS: We examined six eyes in three patients (one with multiple myeloma, one with membranous nephropathy, and one with immunoglobulin A nephropathy) at the Eye and ENT Hospital of Fudan University. The patients presented with peculiar globular subretinal deposits along the retinal pigment epithelium (RPE)âBruch's membrane complex and acquired serous retinal detachment. METHODS: Fundus appearance was documented with multimodal imaging, which included fundus photography, fundus autofluorescence, spectral domain optical coherence tomography (OCT), swept-source OCT (SS-OCT), en-face OCT, and SS-OCT angiography. Additional evaluations included serum protein electrophoreses, positron emission tomography computed tomography, and renal and bone biopsies to assess the primary diseases. MAIN OUTCOME MEASURES: Multimodal imaging, course, and prognosis of bilateral RPE immunoglobulin light chain deposition in patients with systemic immunoglobulin light chain deposition. RESULTS: Bilateral, multiple, speckled, or patchy RPE changes in the posterior fundus that corresponded to striking multifocal hyperautofluorescence on fundus autofluorescence and lumpy, globular hyperreflective deposits along the RPEâBruch's membrane complex were identified as characteristic features of bilateral RPE light chain deposition. These features may be accompanied by dense light chain deposits in the choriocapillaris and choroid vessels, diffuse choroidal thickening, and "angiographically silent" serous retinal detachment in patients with systemic immunoglobulin light chain deposition. CONCLUSIONS: We have documented the characteristic features, clinical course, and prognosis of bilateral RPE immunoglobulin light chain deposition in patients with systemic immunoglobulin light chain deposition. Appropriate evaluations, including serum protein electrophoresis and hematologic consultation, are recommended to manage patients with this fundus abnormality.
RESUMO
Background: Chronic obstructive pulmonary disease (COPD) stands as a predominant cause of global morbidity and mortality. This study aims to elucidate the relationship between pyroptosis-related genes (PRGs) and COPD diagnosis in the context of immune infiltration, ultimately proposing a PRG-based diagnostic model for predicting COPD outcomes. Methods: Clinical data and PRGs of COPD patients were sourced from the GEO database. The "ConsensusClusterPlus" package was employed to generate molecular subtypes derived from PRGs that were identified through differential expression analysis and LASSO Cox analysis. A diagnostic signature including eight genes (CASP4, CASP5, ELANE, GPX4, NLRP1, GSDME, NOD1and IL18) was also constructed. Immune cell infiltration calculated by the ESTIMATE score, Stroma scores and Immune scores were also compared on the basis of pyroptosis-related molecular subtypes and the risk signature. We finally used qRT - PCR to detect the expression levels of eight genes in COPD patient and normal. Results: The diagnostic model, anchored on eight PRGs, underwent validation with an independent experimental cohort. The area under the receiver operating characteristic (ROC) curves (AUC) for the diagnostic model showcased values of 0.809, 0.765, and 0.956 for the GSE76925, GSE8545, and GSE5058 datasets, respectively. Distinct expression patterns and clinical attributes of PRGs were observed between the comparative groups, with functional analysis underscoring a disparity in immune-related functions between them. Conclusion: In this study, we developed a potential as diagnostic biomarkers for COPD and have a significant role in modulating the immune response. Such insights pave the way for novel diagnostic and therapeutic strategies for COPD.
Assuntos
Bases de Dados Genéticas , Valor Preditivo dos Testes , Doença Pulmonar Obstrutiva Crônica , Piroptose , Humanos , Doença Pulmonar Obstrutiva Crônica/genética , Doença Pulmonar Obstrutiva Crônica/diagnóstico , Doença Pulmonar Obstrutiva Crônica/imunologia , Piroptose/genética , Perfilação da Expressão Gênica , Pulmão/imunologia , Masculino , Feminino , Pessoa de Meia-Idade , Marcadores Genéticos , Estudos de Casos e Controles , Transcriptoma , Idoso , Reprodutibilidade dos Testes , Predisposição Genética para Doença , PrognósticoRESUMO
BACKGROUND: Evidence has shown that the individual metrics in Life's Essential 8 (LE8), an updated cardiovascular health (CVH) concept proposed by the American Heart Association, play a role in the development of inflammatory bowel disease (IBD). However, epidemiological evidence on the overall LE8 on IBD risk remains limited. We aimed to assess the longitudinal associations of LE8-defined CVH and the risks of IBD and its subtypes, ulcerative colitis (UC) and Crohn's disease (CD). We also tested whether genetic susceptibility could modify these associations. METHODS: A total of 260,836 participants from the UK Biobank were included. LE8 scores were determined by 8 metrics (physical activity, diet, nicotine exposure, sleep, body mass index, blood pressure, blood glucose, and blood lipids), and were divided into three levels: low CVH (0-49), moderate CVH (50-79), and high CVH (80-100). Cox proportional hazards models were used to calculate the hazard ratios (HRs) and confidence intervals (CIs) of the risk of IBD in relation to CVH status. RESULTS: Over a median follow-up 12.3 years, we documented 1,500 IBD cases (including 1,070 UC and 502 CD). Compared to participants with low CVH, the HRs (95% CIs) of those with high CVH for IBD, UC, and CD were 0.67 (0.52, 0.83), 0.70 (0.52, 0.93), and 0.55 (0.38, 0.80), respectively. These associations were not modified by genetic susceptibility (all P for interactions > 0.05). The lowest HR (UC: 0.30, 95% CI: 0.20-0.45; CD: 0.33, 95% CI: 0.20-0.57) was observed in participants with both high CVH and low genetic risk. CONCLUSIONS: Better CVH, defined by LE8, was associated with significantly lower risks of IBD, UC, and CD, irrespective of genetic predisposition. Our results underscore the importance of adherence to LE8 guidelines for maintaining CVH as a potential strategy in the prevention of IBD.
Assuntos
Doença de Crohn , Dieta , Predisposição Genética para Doença , Doenças Inflamatórias Intestinais , Humanos , Masculino , Feminino , Pessoa de Meia-Idade , Fatores de Risco , Reino Unido , Adulto , Doenças Inflamatórias Intestinais/genética , Doença de Crohn/genética , Exercício Físico , Idoso , Índice de Massa Corporal , Colite Ulcerativa/genética , Estudos de Coortes , Modelos de Riscos Proporcionais , Estudos Longitudinais , Pressão Sanguínea , Sono , Glicemia/metabolismoRESUMO
Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.
RESUMO
The design of boron-based molecular rotors stems from boron-carbon binary clusters containing multiple planar hypercoordinate carbons (phCs, such as C2B8). However, the design of boron-coordinated phCs is challenging due to boron's tendency to occupy hypercoordinate centers more than carbon. Although this challenge has been addressed, the designed clusters of interest have not exhibited dynamic fluxionality similar to that of the initial C2B8. To address this issue, we report a σ/π doubly aromatic CB2H5+ cluster, the first global minimum containing a boron-coordinated planar tetracoordinate carbon atom with dynamic fluxionality. Dynamics simulations show that two ligand H atoms exhibit alternate rotation, resulting in an intriguing dynamic fluxionality in this cluster. Electronic structure analysis reveals the flexible bonding positions of the ligand H atoms because they do not participate in π delocalized bonding nor bond to any other non-carbon atom, highlighting this rotational fluxionality. Unprecedentedly, the fluxional process involves not only the usual conversion of the number of bonding atoms, but also the type of bonding (3c π bonds â 4c σ bonds), which is an uncommon fluxional mechanism. The cluster represents an effort to apply phC species to molecular machines.
RESUMO
Iron ion (Fe3+) detection is crucial for human health since it plays a crucial role in many physiological activities. In this work, a novel Schiff-base functionalized cyanine derivative (CyPy) was synthesized, which was successfully assembled on the surface of upconversion nanoparticles (UCNPs) through an amphiphilic polymer encapsulation method. In the as-designed nanoprobe, CyPy, a recognizer of Fe3+, is served as energy donor and ß-NaYF4:Yb,Er upconversion nanoparticles are adopted as energy acceptor. As a result, a 93-fold enhancement of upconversion luminescence is achieved. The efficient energy transfer from CyPy to ß-NaYF4:Yb,Er endows the nanoprobe a high sensitivity for Fe3+ in water with a low detection limit of 0.21 µM. Moreover, the nanoprobe has been successfully applied for Fe3+ determination in human serum and tap water samples with recovery ranges of 95 %-105 % and 97 %-106 %, respectively. Moreover, their relative standard deviations are all below 3.72 %. This work provides a sensitive and efficient methodology for Fe3+ detection in clinical and environmental testing.
RESUMO
OBJECTIVE: To compare the differences between Ultrasound Volume Navigation (UVN), O-arm Navigation, and conventional X-ray fluoroscopy-guided screw placement in Minimally Invasive Transforaminal Lumbar Interbody Fusion (MIS-TLIF) surgeries. METHODS: A total of 90 patients who underwent MIS-TLIF due to lumbar disc herniation from January 2022 to January 2023 were randomly assigned to the UVN group, O-arm group, and X-ray group. UVN, O-arm navigation, and X-ray guidance were used for screw placement in the respective groups, while the remaining surgical procedures followed routine MIS-TLIF protocols. Intraoperative data including average single screw placement time, total radiation dose, and average effective radiation dose per screw were recorded and calculated. On the 10th day after surgery, postoperative X-ray and CT examinations were conducted to assess screw placement accuracy and facet joint violation. RESULTS: There were no significant differences in general characteristics among the three groups, ensuring comparability. Firstly, the average single screw placement time in the O-arm group was significantly shorter than that in the UVN group and X-ray group (P<0.05). Secondly, in terms of total radiation dose during surgery, for single-level MIS-TLIF, the O-arm group had a significantly higher radiation dose compared to the UVN group and X-ray group (P<0.05). However, for multi-level MIS-TLIF, the X-ray group had a significantly higher radiation dose than the O-arm group and UVN group (P<0.05). In terms of average single screw radiation dose, the O-arm group and X-ray group were similar (P>0.05), while the UVN group was significantly lower than the other two groups (P<0.05). Furthermore, no significant differences were found in screw placement assessment grades among the three groups (P>0.05). However, in terms of facet joint violation rate, the UVN group (10.3%) and O-arm group (10.7%) showed no significant difference (P>0.05), while the X-ray group (26.7%) was significantly higher than both groups (P<0.05). Moreover, in the UVN group, there were significant correlations between average single screw placement time and placement grade with BMI index (r = 0.637, P<0.05; r = 0.504, P<0.05), while no similar significant correlations were found in the O-arm and X-ray groups. CONCLUSION: UVN-guided screw placement in MIS-TLIF surgeries demonstrates comparable efficiency, visualization, and accuracy to O-arm navigation, while significantly reducing radiation exposure compared to both O-arm navigation and X-ray guidance. However, UVN may be influenced by factors like obesity, limiting its application.
RESUMO
BACKGROUND: The CRC-VTE trial conducted in China revealed a significant occurrence of venous thromboembolism (VTE) in patients following colorectal cancer (CRC) surgery, raising concerns about implementing thromboprophylaxis measures. The present study aimed to identify and analyze inappropriate aspects of current thromboprophylaxis practices. METHODS: This study performed an analysis of the CRC-VTE trial, a prospective multicenter study that enrolled 1836 patients who underwent CRC surgery. The primary objective was to identify independent risk factors for VTE after CRC surgery using multivariate logistic regression analysis. Furthermore, among the cases in which VTE occurred, the appropriateness of thromboprophylaxis was assessed based on several factors, including pharmacologic prophylaxis, time to initiate prophylaxis, drug selection, drug dosage, and duration of pharmacologic prophylaxis. Based on the analysis of the current state of thromboprophylaxis and relevant clinical guidelines, a modified Delphi method was used to develop a clinical pathway for VTE prophylaxis after CRC surgery. RESULTS: In this analysis of 1836 patients, 205 (11.2%) were diagnosed with VTE during follow-up. The multifactorial analysis identified several independent risk factors for VTE, including age (≥70 years), female sex, varicose veins in the lower extremities, intraoperative blood transfusion, and the duration of immobilization exceeding 24 h. None of the patients diagnosed with VTE in the CRC trial received adequate thromboprophylaxis. The main reasons for this inappropriate practice were the omission of thromboprophylaxis, delayed initiation, and insufficient duration of thromboprophylaxis. We developed a specialized clinical pathway for thromboprophylaxis after CRC surgery to address these issues. CONCLUSIONS: This study offers a comprehensive nationwide evaluation of existing thromboprophylaxis practices in patients after CRC surgery in China. A specialized clinical pathway was developed to address the identified gaps and improve the quality of care. This clinical pathway incorporates explicit, tailored, detailed recommendations for thromboprophylaxis after CRC surgery.
Assuntos
Neoplasias Colorretais , Tromboembolia Venosa , Humanos , Feminino , Masculino , Neoplasias Colorretais/cirurgia , Tromboembolia Venosa/prevenção & controle , Tromboembolia Venosa/etiologia , China , Idoso , Estudos Prospectivos , Pessoa de Meia-Idade , Fatores de Risco , Complicações Pós-Operatórias/prevenção & controle , Complicações Pós-Operatórias/epidemiologia , Anticoagulantes/uso terapêutico , Anticoagulantes/administração & dosagem , Procedimentos Clínicos , Guias de Prática Clínica como AssuntoRESUMO
The family Scolopacidae presents a valuable subject for evolutionary research; however, molecular studies of Scolopacidae are still relatively understudied, and the phylogenetic relationships of certain species remain unclear. In this study, we sequenced and obtained complete mitochondrial DNA (mtDNA) from Actitis hypoleucos and partial mtDNA from Numenius arquata, Limosa limosa, and Limnodromus semipalmatus. The complete mtDNA contained 13 protein-coding genes (PCGs), two ribosomal RNA genes, 22 tRNA genes, and a control region. Scolopacidae contained three types of start codons and five types of stop codons (including one incomplete stop codon, T--). In 13 protein-coding genes, average uncorrected pairwise distances (Aupd) revealed that ATP8 was the least conserved while COX3 had the lowest evolutionary rate. The ratio of Ka/Ks suggested that all PCGs were under purifying selection. Using two methods (maximum likelihood and Bayesian inference) to analyze the phylogenetic relationships of the family Scolopacidae, it was found that the genera Xenus and Actitis were clustered into another sister group, while the genus Phalaropus is more closely related to the genus Tringa. The genera Limnodromus, Gallinago, and Scolopax form a monophyletic group. This study improves our understanding of the evolutionary patterns and phylogenetic relationships of the family Scolopacidae.
RESUMO
BACKGROUND: Magnetic resonance enteroclysis (MRE) has been widely applied to diagnose Crohn's disease (CD). Magnetic resonance (MR) at 3.0 T improves signal-to-noise ratio (SNR), shortens image acquisition time, and shows more advantages. OBJECTIVE: This study aimed to retrospectively analyze the diagnostic value of 3.0 T MR imaging for active CD. METHODS: 48 CD patients hospitalized in our hospital from January 2021 to December 2022 were selected as the study subjects. These 48 CD patients underwent both double-balloon enteroscopy and 3.0 T MRE. All patients' arterial phase signal, venous phase signal, bowel wall, and bowel lumen of MRE were observed to identify whether they suffered from active CD. Based on the results of enteroscopy, the number of true positives, true negatives, false negatives, and false positives diagnosed by MRE were screened; next, the diagnostic accuracy, sensitivity, and specificity of MRE in assessing active CD were calculated. RESULTS: Of the 48 patients, 39 were diagnosed with small bowel CD by MRE, which was not significantly different from the results of enteroscopy (P>0.05). According to MRE diagnostic results, the arterial phase predominantly presented high signal intensity, and the venous phase mainly presented low signal intensity or isointensity. Small bowel CD lesions were primarily characterized by bowel wall thickening, rare pneumatosis enhancement of the bowel wall, bowel lumen pneumatosis or dilatation, and rare strictures. Besides, MRE presented an accuracy of 93.75%, sensitivity of 97.37%, and specificity of 80.00% in diagnosing CD. CONCLUSION: 3.0 T MR imaging has diagnostic value for active CD and shows certain clinical application value.
.Assuntos
Doença de Crohn , Imageamento por Ressonância Magnética , Sensibilidade e Especificidade , Humanos , Doença de Crohn/diagnóstico por imagem , Imageamento por Ressonância Magnética/métodos , Masculino , Feminino , Adulto , Estudos Retrospectivos , Pessoa de Meia-Idade , Adulto Jovem , Razão Sinal-Ruído , Adolescente , Enteroscopia de Duplo Balão/métodos , Intestino Delgado/diagnóstico por imagemRESUMO
BACKGROUND: Ocular tuberculosis is a relatively rare extrapulmonary manifestation of tuberculosis. This vision-threatening disease is extremely challenging to diagnose, particularly because it can mimic other diseases. We report a case of tuberculous ciliary body granuloma initially diagnosed as bullous retinal detachment. CASE REPORT: A 52-year-old female presented with bullous retinal detachment in her left eye, and ultrasound biomicroscopy (UBM) verified the presence of a lesion with ciliary body granulomatous inflammation. The T-SPOT was positive, and the purified protein derivative (PPD) test was strongly positive (diameter of 20 mm). Following the administration of oral anti-tuberculosis regimen combined with prednisone, the retina gradually became reattached, the ciliary body granuloma became significantly reduced in size, and the visual acuity of the patient noticeably improved. CONCLUSIONS: Tuberculous ciliary body granulomas can cause bullous exudative retinal detachment and can be diagnosed with UBM. Early and full-course anti-tuberculosis treatment (ATT) combined with corticosteroid therapy can improve the patient prognosis.
Assuntos
Corpo Ciliar , Descolamento Retiniano , Tuberculose Ocular , Humanos , Feminino , Pessoa de Meia-Idade , Tuberculose Ocular/diagnóstico , Tuberculose Ocular/tratamento farmacológico , Descolamento Retiniano/diagnóstico , Descolamento Retiniano/etiologia , Corpo Ciliar/patologia , Granuloma/diagnóstico , Doenças da Úvea/diagnóstico , Diagnóstico Diferencial , Microscopia Acústica , Antituberculosos/uso terapêuticoRESUMO
Several studies have reported a potential association between the gut microbiota (GM) and scoliosis. However, the causal relationship between GM and scoliosis and the role of inflammatory factors (IFs) as mediators remain unclear. This study aimed to analyze the relationship between GM, IFs, and scoliosis. We investigated whether IFs act as mediators in pathways from the GM to scoliosis. Additionally, using reverse Mendelian randomization (MR) analysis, we further investigated the potential impact of genetic predisposition to scoliosis on the GM and IFs. In this study, we searched for publicly available genome-wide association study aggregate data and utilized the MR method to establish bidirectional causal relationships among 211 GM taxa, 91 IFs, and scoliosis. To ensure the reliability of our research findings, we employed 5 MR methods, with the inverse variance weighting approach serving as the primary statistical method, and assessed the robustness of the results through various sensitivity analyses. Additionally, we investigated whether IFs mediate pathways from GM to scoliosis. Three negative causal correlations were observed between the genetic predisposition to GM and scoliosis. Additionally, both positive and negative correlations were found between IFs and scoliosis, with 3 positive and 3 negative correlations observed. IFs do not appear to act as mediators in the pathway from GM to scoliosis. In conclusion, this study demonstrated a causal association between the GM, IFs, and scoliosis, indicating that IFs are not mediators in the pathway from the GM to scoliosis. These findings offer new insights into prevention and treatment strategies for scoliosis.
Assuntos
Microbioma Gastrointestinal , Predisposição Genética para Doença , Estudo de Associação Genômica Ampla , Análise da Randomização Mendeliana , Escoliose , Escoliose/genética , Humanos , Microbioma Gastrointestinal/genética , Mediadores da Inflamação/metabolismo , Mediadores da Inflamação/sangueRESUMO
Objective: This cross-sectional study aimed to determine the epidemiology of olfactory and gustatory dysfunctions related to COVID-19 in China. Methods: This study was conducted by 45 tertiary Grade-A hospitals in China. Online and offline questionnaire data were obtained from patients infected with COVID-19 between December 28, 2022, and February 21, 2023. The collected information included basic demographics, medical history, smoking and drinking history, vaccination history, changes in olfactory and gustatory functions before and after infection, and other postinfection symptoms, as well as the duration and improvement status of olfactory and gustatory disorders. Results: Complete questionnaires were obtained from 35,566 subjects. The overall incidence of olfactory and taste dysfunction was 67.75%. Being female or being a cigarette smoker increased the likelihood of developing olfactory and taste dysfunction. Having received four doses of the vaccine or having good oral health or being a alcohol drinker decreased the risk of such dysfunction. Before infection, the average olfactory and taste VAS scores were 8.41 and 8.51, respectively; after infection, they decreased to 3.69 and 4.29 and recovered to 5.83 and 6.55 by the time of the survey. The median duration of dysosmia and dysgeusia was 15 and 12 days, respectively, with 0.5% of patients having symptoms lasting for more than 28 days. The overall self-reported improvement rate was 59.16%. Recovery was higher in males, never smokers, those who received two or three vaccine doses, and those that had never experienced dental health issues, or chronic accompanying symptoms. Conclusions: The incidence of dysosmia and dysgeusia following infection with the SARS-CoV-2 virus is high in China. Incidence and prognosis are influenced by several factors, including sex, SARS-CoV-2 vaccination, history of head-facial trauma, nasal and oral health status, smoking and drinking history, and the persistence of accompanying symptoms.
RESUMO
OBJECTIVES: Cross-sectional evidence has shown that frailty is highly prevalent in patients with chronic kidney disease (CKD). However, there is limited evidence of the longitudinal associations between frailty, genetic predisposition to CKD, and the risk of CKD in the general population. Therefore, this study aimed to examine such associations among participants in the UK Biobank. STUDY DESIGN: This is a prospective cohort study included 370,965 middle-aged and older adults from the UK Biobank. Physical frailty was assessed using a modified version of the Fried phenotype classification. A weighted genetic risk score was built using 263 variants associated with estimated glomerular filtration rate. MAIN OUTCOME MEASURES: Incident CKD was identified from hospital inpatient records. RESULTS: Over a median follow-up of 12.3 years, we documented a total of 11,121 incident CKD cases. Time-dependent Cox proportional hazards regression models indicated that individuals with frailty (hazard ratio [HR]: 1.94, 95 % confidence interval [CI]: 1.81-2.08) and pre-frailty (HR: 1.27, 95 % CI: 1.22-1.33) had an increased risk of developing CKD, compared with non-frail individuals. No significant interaction between frailty and genetic risk score was observed (P for interaction = 0.41). The highest risk was observed among the individuals with high genetic risk and frailty (HR: 2.31, 95 % CI: 2.00-2.68). CONCLUSION: Our results demonstrated that frailty and pre-frailty were associated with increased risk of incident CKD in middle-age and older adults, regardless of genetic risk of CKD. Our study underscores the importance of frailty screening and intervention as a potential strategy to prevent CKD. Future clinical trials are needed to validate our findings.
RESUMO
BACKGROUND: Frailty, defined as a phenotype of decreased physiological reserves and diminished ability to respond to stressors, has been linked to the development of chronic diseases. Epidemiological evidence connecting frailty to non-alcoholic fatty liver disease (NAFLD) and cirrhosis risks remain sparse. We aimed to assess the longitudinal associations of frailty with the risks of severe NAFLD and cirrhosis in middle-aged to older adults and further explore the modification role of genetic risk on these associations. METHODS: This study included a total of 398 386 participants from the UK Biobank. Incident cases of severe NAFLD and cirrhosis were ascertained through linked hospital records and death registries. Frailty status was assessed by a modified version of the frailty phenotype, encompassing five key components: weight loss, tiredness, physical activity, gait speed, and grip strength. Participants were classified as pre-frailty if they met one or two of these criteria, and as frailty if they met three or more. Genetic predisposition to NAFLD and cirrhosis was estimated by genetic risk score (GRS) and further categorized into high, intermediate, and low genetic risk levels according to tertiles of GRSs. Cox proportional hazards regression model was employed to estimate the hazard ratios (HRs) and 95% confidence intervals (CIs) for their associations. RESULTS: The mean (standard deviation) age of the study population was 56.6 (8.03) years. 214 408 (53.8%) of the participants was female; 14 924 (3.75%) of participants met the criteria for frailty, 170 498 (42.8%) for pre-frailty, and 212 964 (53.5%) for non-frailty. Over a median follow-up of 12.0 years, we documented 4439 incident severe NAFLD and 3323 incident cirrhosis cases, respectively. Compared with non-frailty, both pre-frailty (HR: 1.50; 95% CI: 1.40-1.60) and frailty (HR: 1.98; 95% CI: 1.77-2.21) were associated with increased risk of NAFLD. Similar associations were observed for cirrhosis, the corresponding HRs (95% CIs) for non-frailty, pre-frailty, and frailty were 1.00 (reference), 1.29 (1.20, 1.38), and 1.90 (1.66, 2.18). Such associations were consistent across all genetic risk levels, with no observed interactions between frailty and GRSs (all P for interactions ≥0.10). Compared with participants with frailty and a low level of genetic risk, the greatest risk increasement in developing severe NAFLD (HR: 3.36; 95% CI: 2.83-3.99) and cirrhosis (HR: 2.81; 95% CI: 2.29-3.44) was both observed in those with frailty and a high level of genetic risk. CONCLUSIONS: Our findings indicate that frailty is a significant predictor of severe NAFLD and cirrhosis, irrespective of genetic predisposition.
RESUMO
In recent years, increased species extinction and habitat loss have significantly reduced biodiversity, posing a serious threat to both nature and human survival. Environmental factors strongly influence bird distribution and diversity. The potential distribution patterns and species richness offer a conservation modeling framework for policymakers to assess the effectiveness of natural protected areas (PAs) and optimize their existing ones. Very few such studies have been published that cover a large and complete taxonomic group with fine resolution at regional scale. Here, using birds as a study group, the maximum entropy model (MaxEnt) was used to analyze the pattern of bird species richness in Jiangsu Province. Using an unparalleled amount of occurrence data, we created species distribution models (SDMs) for 312 bird species to explore emerging diversity patterns at a resolution of 1 km2. The gradient of species richness is steep, decreasing sharply away from water bodies, particularly in the northern part of Jiangsu Province. The migratory status and feeding habits of birds also significantly influence the spatial distribution of avian species richness. This study reveals that the regions with high potential bird species richness are primarily distributed in three areas: the eastern coastal region, the surrounding area of the lower reaches of the Yangtze River, and the surrounding area of Taihu Lake. Compared with species richness hotspots and existing PAs, we found that the majority of hotspots are well-protected. However, only a small portion of the regions, such as coastal areas of Sheyang County in Yancheng City, as well as some regions along the Yangtze River in Nanjing and Zhenjiang, currently have relatively weak protection. Using stacked SDMs, our study reveals effective insights into diversity patterns, directly informing conservation policies and contributing to macroecological research advancements.
RESUMO
Heat shock proteins (HSPs) are a class of highly conserved proteins that play an important role in biological responses to various environmental stresses. The mariculture of Thamnaconus septentrionalis, a burgeoning aquaculture species in China, frequently encounters stressors such as extreme temperatures, salinity variations, and elevated ammonia levels. However, systematic identification and analysis of the HSP70 and HSP90 gene families in T. septentrionalis remain unexplored. This study conducted the first genome-wide identification of 12 HSP70 and 4 HSP90 genes in T. septentrionalis, followed by a comprehensive analysis including phylogenetics, gene structure, conserved domains, chromosomal localization, and expression profiling. Expression analysis from RNA-seq data across various tissues and developmental stages revealed predominant expression in muscle, spleen, and liver, with the highest expression found during the tailbud stage, followed by the gastrula, neurula, and juvenile stages. Under abiotic stress, most HSP70 and HSP90 genes were upregulated in response to high temperature, high salinity, and low salinity, notably hspa5 during thermal stress, hspa14 in high salinity, and hsp90ab1 under low salinity conditions. Ammonia stress led to a predominance of downregulated HSP genes in the liver, particularly hspa2, while upregulation was observed in the gills, especially for hsp90b1. Quantitative real-time PCR analysis corroborated the expression levels under environmental stresses, validating their involvement in stress responses. This investigation provides insights into the molecular mechanisms of HSP70 and HSP90 in T. septentrionalis under stress, offering valuable information for future functional studies of HSPs in teleost evolution, optimizing aquaculture techniques, and developing stress-resistant strains.