RESUMO
Nucleotide-binding leucine-rich repeat (NLR) proteins contribute widely to plant immunity by regulating defense mechanisms through the elicitation of a hypersensitive response (HR). Here, we find that TaRACK1B (the receptor for activated C-kinase 1B) regulates wheat immune response against Chinese wheat mosaic virus (CWMV) infection. TaRACK1B recruits TaSGT1 and TaHSP90 to form the TaRACK1B-TaSGT1-TaHSP90 complex. This complex is essential for maintaining NLR proteins' stability (TaRGA5-like and TaRGH1A-like) in order to control HR activation and inhibit viral infection. However, the cysteine-rich protein encoded by CWMV can disrupt TaRACK1B-TaSGT1-TaHSP90 complex formation, leading to the reduction of NLR-protein stability and suppression of HR activation, thus promoting CWMV infection. Interestingly, the 7K protein of wheat yellow mosaic virus also interferes with this antiviral immunity. Our findings show a shared viral counter-defense strategy whereby two soil-borne viruses may disrupt the TaRACK1B-TaSGT1-TaHSP90 complex, suppressing NLR-protein-mediated broad-spectrum antiviral immunity and promoting viral infection in wheat.
RESUMO
Graph neural networks offer an effective avenue for predicting drug-target interactions. In this domain, researchers have found that constructing heterogeneous information networks based on metapaths using diverse biological datasets enhances prediction performance. However, the performance of such methods is closely tied to the selection of metapaths and the compatibility between metapath subgraphs and graph neural networks. Most existing approaches still rely on fixed strategies for selecting metapaths and often fail to fully exploit node information along the metapaths, limiting the improvement in model performance. This paper introduces a novel method for predicting drug-target interactions by optimizing metapaths in heterogeneous information networks. On one hand, the method formulates the metapath optimization problem as a Markov decision process, using the enhancement of downstream network performance as a reward signal. Through iterative training of a reinforcement learning agent, a high-quality set of metapaths is learned. On the other hand, to fully leverage node information along the metapaths, the paper constructs subgraphs based on nodes along the metapaths. Different depths of subgraphs are processed using different graph convolutional neural network. The proposed method is validated using standard heterogeneous biological benchmark datasets. Experimental results on standard datasets show significant advantages over traditional methods.
RESUMO
Berberine (BBR) is a major active component of traditional Chinese medicine Rhizoma Coptidis and Cortex Phellodendri, which have been frequently used to treat liver diseases. Oxidative stress and inflammation are two pivotal hepatic pathological hallmarks. This study aimed to explore the potential effect and underlying mechanism of BBR on fructose-induced rat liver injury model, and hepatocyte damage in HepG2 and BRL-3A cells. Our results indicated that BBR effectively reversed fructose-induced body weight gain, glucose intolerance, and insulin resistance, observably attenuated abnormal histopathological alterations and ameliorated serum activities of ALT and AST. In vivo and in vitro, BBR significantly alleviated the secretion of pro-inflammatory cytokines IL-6 and TNF-α, and elevated levels of anti-inflammatory cytokine IL-10. BBR also attenuated oxidative stress by markedly decreasing intracellular contents of ROS and MDA, and increasing SOD enzymatic activity and GSH level. Furthermore, BBR substantially upregulated the protein expression of Nrf2, HO-1 and p-AMPK, and the fluorescence level of p-AMPK. In addition, BBR significantly increased the level of AMP, the ratio of AMP/ATP, and promoted the expression of ADK. Nevertheless, siADK abolished the benefits exerted by BBR on HepG2 and BRL-3A cells. Conclusively, the hepatoprotective effect of BBR was believed to be intimately associated with anti-inflammatory and antioxidant action mediated, at least partially, via ADK/AMPK/Nrf2 signaling. This work provided further support for the traditional application of Rhizoma Coptidis and Cortex Phellodendri in liver protection and might shed novel dimension to the clinical application of BBR, providing a promising lead compound for drug design.
Assuntos
Proteínas Quinases Ativadas por AMP , Berberina , Doença Hepática Induzida por Substâncias e Drogas , Frutose , Fator 2 Relacionado a NF-E2 , Ratos Sprague-Dawley , Transdução de Sinais , Berberina/farmacologia , Animais , Humanos , Fator 2 Relacionado a NF-E2/metabolismo , Masculino , Células Hep G2 , Proteínas Quinases Ativadas por AMP/metabolismo , Transdução de Sinais/efeitos dos fármacos , Ratos , Doença Hepática Induzida por Substâncias e Drogas/tratamento farmacológico , Doença Hepática Induzida por Substâncias e Drogas/metabolismo , Doença Hepática Induzida por Substâncias e Drogas/prevenção & controle , Doença Hepática Induzida por Substâncias e Drogas/patologia , Estresse Oxidativo/efeitos dos fármacos , Fígado/efeitos dos fármacos , Fígado/patologia , Fígado/metabolismo , Antioxidantes/farmacologiaRESUMO
Glioma poses a serious threat to human health and has a high mortality rate. Therefore, developing natural anti-tumour drugs for cancer treatment is an urgent priority. Schizophyllum commune is an edible and medicinal fungus, with polysaccharides as its main active components, which may have anti-tumour properties. Herein, we characterised S. commune fruiting body polysaccharides (SCFP) structure and evaluated its anti-glioma activity in vitro and in vivo. UV and FTIR spectra, high-performance gel chromatography, and monosaccharide composition analyses demonstrated that SCFP was a heteropolysaccharide with a molecular weight of 290.92 kDa. Among the monosaccharide compositions, mannose, galactose, and glucose were the most abundant. SCFP significantly inhibited the survival of the glioma cell lines U251 and U-87MG. U251 xenograft tumours treated with SCFP via gavage showed a 47.39 % inhibition, with no significant toxic side effects observed. SCFP upregulated aplasia Ras homologue member I (ARHI) expression, thereby regulating PI3K/AKT signalling, inhibiting tumour migration, and inducing apoptosis, to inhibit tumour growth. Furthermore, SCFP treatment increased the relative abundance of beneficial bacteria, including Akkermansia muciniphila, Ligilactobacillus murinus, and Parabacteroides goldsteinii, in tumour-bearing mice and restored the gut microbiota structure to that of the normal group (NG group) mice without tumours. Thus, SCFP has the potential for application as a natural anticancer drug.
RESUMO
In recent years, the application of real scene 3D technology has become widespread in urban planning and cultural heritage protection. However, there has been relatively little attention paid to the construction of real scene 3D models for special natural landscapes such as caves. Given the global distribution of karst topography and the large number of naturally developed caves with diverse types, unique landscape styles, and significant scientific value, this paper enriches the research in this field. By combining ground-based and aerial remote sensing techniques, and based on 3D laser scanning and photogrammetry, we have successfully constructed a real scene 3D model of the internal structure of a karst cave with a precision better than 4 cm. Utilizing Unmanned Aerial Vehicle (UAV) oblique photography, we established a real scene 3D model of the external karst landform with a precision better than 2 cm. We also integrated the internal and external 3D models of the cave, developing a new, complete, and high-precision method for constructing real scene 3D models of karst cave landscapes. Furthermore, we proposed a method for texture reproduction in the dark environment inside the caves, enhancing the reproduction and visual appeal of the real interior. The establishment of high-precision real scene 3D models can not only serve as an effective tool for scientific research on caves but also, as replicas of the real world, play a crucial role in public dissemination and education, thereby enhancing public understanding of cave geological landscapes.
RESUMO
Background: Recurrent acute myocardial infarction requiring unplanned percutaneous coronary intervention (PCI) is one of the major adverse cardiovascular events (MACEs) in patients with acute coronary syndrome (ACS) after PCI. There is a continuing controversy about the association between serum cystatin C, a biomarker for the evaluation of renal function, and the prognosis of ACS patients following PCI. The retrospective study evaluated the association between serum cystatin C level and MACE in ACS patients after PCI. Methods: Data were retrieved for 330 patients with ACS for primary PCI in a single center. Serum cystatin C levels were measured before PCI. All patients underwent regular follow-ups after PCI, and the studied endpoint was MACE, defined as the need for a repeat revascularization in the heart. The predictive value of serum cystatin C for MACE was analyzed using univariate and multivariate analysis. Restricted cubic spline (RCS) analysis was applied to evaluate the dose-response relationship between serum cystatin C level and MACE in ACS patients following PCI. Results: After a median follow-up of 63 months (range, 1-148 months), 121 of the 330 patients experienced MACE. Compared to patients who did not have MACE, patients who had MACE showed a significant decrease in serum cystatin C levels (0.99±0.32 vs. 1.15±0.78 mg/L, P=0.03). In multivariate regression analysis, serum cystatin C level was an independent risk factor for MACE. According to the serum cystatin C level, patients were divided into 4 categories, Cox regression analysis illustrated that the second quartile of serum cystatin C level indicated an increased risk of MACE in patients with PCI for primary ACS compared to the highest quartile [Q2: adjusted hazard ratio (HR) =2.109; 95% confidence interval (CI): 1.193-3.727; P=0.01]. RCS analysis showed a significant U-shaped dose-response relationship between cystatin C level and MACE in patients with PCI for ACS (P for non-linearity =0.004). Conclusions: These results indicated an association between serum cystatin C level and post-PCI MACE in ACS patients.
RESUMO
BACKGROUND: The increasing comprehension of spleen function has led to the gradual endorsement of laparoscopic partial splenectomy (LPS) as a treatment option for benign spleen lesions. However, it is important to note that the LPS technique remains challenging. This study explores the standardized process and surgical techniques in LPS, aiming to promote the application of this technique. METHODS: The clinical data of 20 patients with benign cystic or solid spleen lesions who underwent LPS at Shunde Hospital, Southern Medical University were retrospectively collected. Data include age, gender, imaging data, surgical process, and postoperative complications. Additionally, the surgical techniques and standardization process were recorded in detail. RESULTS: All 20 cases completed LPS without conversion to laparotomy or splenectomy. The surgical time was 162.25 ± 37.96 min, the intraoperative blood loss was 93.00 ± 58.40 mL, no blood products were transfused during the operations, and the removed volume of the spleen was about 34.75 ± 12.19 %. There were no postoperative complications such as intra-abdominal bleeding, intra-abdominal infection, pancreatic fistula, and residual splenic infarction. Postoperative pleural effusion occurred in four cases, and symptoms improved after symptomatic treatment. The postoperative hospital stay was 7.0 ± 1.4 days. There were no perioperative deaths. The residual splenic vessels were normal during the follow-up period, and no vascular embolism occurred. CONCLUSIONS: LPS is a safe, feasible, and effective surgical method for patients with benign cystic or solid spleen lesions. Subsequently, mastering related surgical techniques and standardized surgical procedures can control the surgical risks in suitable cases, making LPS the standard procedure for treating benign spleen diseases.
RESUMO
Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.
RESUMO
The study aims to investigate the effects of nano-alumina (AlNPs) on the early development and neurobehavior of zebrafish and the role of mTOR in this process. After embryos and grown-up larvae exposed to AlNPs from 0 to 200 µg/mL, we examined the development, neurobehavior, AlNPs content, and mTOR pathway genes. Moreover, embryos were randomly administered with control, negative control, mTOR knockdown, AlNPs, and mTOR knockdown + AlNPs, then examined for development, neurobehavior, oxidative stress, neurotransmitters, and development genes. As AlNPs increased, swimming speed and distance initially increased and then decreased; thigmotaxis and panic-avoidance reflex substantially decreased in the high-dose AlNPs group; aluminum and nanoparticles considerably accumulated in the 100 µg/mL AlNPs group; AlNPs at high dose decreased mTOR gene and protein levels, stimulating autophagy via increasing ULK1 and ULK2. mTOR knockdown exacerbated the harm to normal development rate, eye and body length, and neurobehavior induced by AlNPs through raising ROS, SOD, and ACH levels but decreasing AchE activity and development genes. Therefore, AlNPs suppress neurobehavior through downregulating mTOR, and mTOR knockdown further aggravates their early development and neurobehavior loss, suggesting mTOR could be a potential target for the toxicity of AlNPs.
RESUMO
In this study, we identified a novel mycovirus, Fusarium graminearum ormycovirus 1 (FgOV1), from the pathogenic fungus Fusarium graminearum. The virus has two RNA segments, RNA1 and RNA2, with lengths of 2,591 and 1,801 nucleotides, respectively, excluding the polyA tail. Each segment contains a single open reading frame (ORF). The ORF in RNA1 encodes an RNA-dependent RNA polymerase, while the ORF in RNA2 encodes a hypothetical protein. Phylogenetic analysis showed that FgOV1 belongs to the gammaormycovirus clade, whose members are related to betaormycoviruses. To our knowledge, this is the first report of an ormycovirus in Fusarium graminearum.
Assuntos
Micovírus , Fusarium , Genoma Viral , Fases de Leitura Aberta , Filogenia , Doenças das Plantas , Vírus de RNA , RNA Viral , Fusarium/virologia , Fusarium/genética , Fusarium/isolamento & purificação , Micovírus/genética , Micovírus/classificação , Micovírus/isolamento & purificação , Doenças das Plantas/microbiologia , Doenças das Plantas/virologia , Genoma Viral/genética , Vírus de RNA/genética , Vírus de RNA/isolamento & purificação , Vírus de RNA/classificação , RNA Viral/genética , Proteínas Virais/genética , RNA Polimerase Dependente de RNA/genéticaRESUMO
BACKGROUND: DEAD-box protein (DDX) is a member of the DDX RNA helicase family that exerts multiple functions in RNA metabolism, cell cycle, tumorigenesis, signal pathway, and fertility, particularly in mammals. Nevertheless, the biological functions of DDXs in insects have not been fully resolved and attracted increasing attention these years. Laodelphax striatellus (Hemiptera) is a notorious rice pest through feeding on rice sap and transmitting plant viruses. In this study, we aim to elucidate the functional characterization of DDXs in L. striatellus, and to exploit potential target genes for the development of pest control strategies. RESULTS: In this study, we characterized the expression patterns of LsDDX6, LsDDX47, and LsDDX51 in planthoppers and analyzed their conserved motifs. These genes were found to be expressed in all tissues and developmental stages examined, with significantly higher transcript levels observed in the ovary. Knockdown of LsDDX6, LsDDX47, and LsDDX51 resulted in an obvious lethal phenotype in nymphs and abnormal ovarian development in adults. Furthermore, a total of 27 DDXs were identified in L. striatellus, and most DDXs were highly expressed in ovary and structure analysis result revealed that all of the DDXs possessed nine motifs that were unique to the DDX family. CONCLUSION: The three DDX RNA helicases (LsDDX6, LsDDX47, and LsDDX51) are essential for both survivorship and reproduction in L. striatellus. Considering a total number of 27 DDXs identified in L. striatellus, they might serve as promising candidates for application in RNAi-based control of this destructive pest. © 2024 Society of Chemical Industry.
RESUMO
Viroporins are small, hydrophobic viral proteins that modify cellular membranes to form tiny pores for influx of ions and small molecules. Previously, viroporins were identified exclusively in vertebrate viruses. Recent studies have shown that both plant-infecting positive-sense single-stranded (+ss) and negative-sense single-stranded (-ss) RNA viruses also encode functional viroporins. These seminal discoveries not only advance our understanding of the distribution and evolution of viroporins, but also open up a new field of plant virus research.
Assuntos
Doenças das Plantas , Vírus de Plantas , Vírus de Plantas/genética , Vírus de Plantas/fisiologia , Doenças das Plantas/virologia , Proteínas Viroporinas/genética , Proteínas Viroporinas/metabolismo , Plantas/virologiaRESUMO
Pinewood nematodes (PWN, Bursaphelenchus xylophilus) are destructive plant parasitic nematodes that cause pine wilt disease (PWD) by attacking the vascular systems of pine trees, resulting in widespread tree mortality. Research has shown that there are connections between nematode-associated microbes and PWD. Yet the variations in microbial communities across different geographic regions are not well-understood. In this study, we examined the bacterial and fungal communities associated with nematodes and infested wood collected from 34 sites across three vegetation zones in China, as well as samples from the United States, using 16S rRNA and internal transcribed spacer (ITS) gene amplicon sequencing. The predominant genera Pseudomonas and Rhodococcus were found in nematodes, and Acinetobacter was present in the wood of PWD-infected pine trees across China. Network analysis revealed that core bacterial taxa belonged to the Pseudomonadota and Actinomycetota phyla for the nematodes, whereas the Pseudomonadota and Bacteroidota phyla were dominant in the infested wood. Identification of enriched key microbial taxa in nematodes and infested wood across vegetation zones indicates distinct biogeographic microbial community structures and key bacterial species. Although the nematode-associated bacterial community showed consistency across geographic distances, the similarity of the PWD pine trees' bacterial community decreased with distance, suggesting a spatial correlation with environmental variables. Our findings enhance our understanding of the microbiota associated with pinewood nematode (PWN) and offer valuable insights into PWD management. IMPORTANCE: Our research uncovered specific bacteria and fungi linked to pinewood nematode (PWN) and infested wood in three different vegetation zones in China, as well as samples from the United States. This sheds light on the critical roles of certain microbial groups, such as Pseudomonas, Acinetobacter, and Stenotrophomonas, in influencing PWN fitness. Understanding these patterns provides valuable insights into the dynamics of PWN-associated microbiomes, offering potential strategies for managing pine wilt disease (PWD). We found significant correlations between geographic distance and similarity in bacterial communities in the infested wood, indicating a spatial influence on wood-associated microbial communities due to limited dispersal and localized environmental conditions. Further investigations of these spatial patterns and driving forces are crucial for understanding the ecological processes that shape microbial communities in complex ecosystems and, ultimately, for mitigating the transmission of PWN in forests.
RESUMO
BACKGROUND/AIMS: The endoscopic features of small-bowel gastrointestinal stromal tumors (GISTs) are not well defined. The objective of this study was to describe the endoscopic features of GISTs of the small intestine detected via single-balloon enteroscopy (SBE). MATERIALS AND METHODS: Patients with surgically confirmed small intestinal GISTs from January 2014 to September 2022 were retrospectively analyzed. The hospital's electronic medical record system was used to retrieve the patients' data, including their demographics, clinical symptoms, hemoglobin on admission, endoscopic and computerized tomography findings, clinicopathological findings, and surgical management data. RESULTS: In total, 46 GIST patients (23 men and 23 women) with overt bleeding were included, with a mean age of 52 years (23-80 years). The typical duration of the symptoms was 48 hours. Four patients (8.70%) had lesions in the duodenum, 32 (69.56%) had lesions in the jejunum, 8 (17.39%) had lesions in the ileum, and 2 (4.35%) had lesions around the junction of the jejunum and ileum. Out of the 46 patients, 27 underwent SBE, and GISTs were visualized in 25, while the lesions could not be visualized in the remaining 2. Submucosal round (n = 13), submucosal sessile (n = 8), and invasive/penetrating (n = 4) were among the endoscopic tumor features. Twenty patients exhibited submucosal protuberant lesions, with ulceration, vascular nodules/congestion, or erosion on the surface, and 5 patients presented ulcerative infiltrative lesions. The multiple logistic regression analysis indicated that the invasive/penetrating characteristics of GISTs under SBE evaluation are significantly correlated with the risk level of GIST malignancy (P < .05). CONCLUSION: A variety of endoscopic characteristics could be observed during the preoperative SBE evaluation of small-intestine GISTs.
Assuntos
Tumores do Estroma Gastrointestinal , Intestino Delgado , Enteroscopia de Balão Único , Humanos , Tumores do Estroma Gastrointestinal/patologia , Tumores do Estroma Gastrointestinal/diagnóstico por imagem , Tumores do Estroma Gastrointestinal/cirurgia , Tumores do Estroma Gastrointestinal/diagnóstico , Feminino , Pessoa de Meia-Idade , Masculino , Estudos Retrospectivos , Idoso , Adulto , Idoso de 80 Anos ou mais , Enteroscopia de Balão Único/métodos , Intestino Delgado/patologia , Intestino Delgado/diagnóstico por imagem , Adulto Jovem , Hemorragia Gastrointestinal/etiologia , Neoplasias Intestinais/patologia , Neoplasias Intestinais/cirurgia , Neoplasias Intestinais/diagnóstico por imagem , Neoplasias Gastrointestinais/patologia , Neoplasias Gastrointestinais/diagnóstico por imagem , Neoplasias Gastrointestinais/cirurgiaRESUMO
Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.
RESUMO
OBJECTIVE: To assess the genetic etiologies underlying agenesis of the corpus callosum (ACC) and its pregnancy outcomes in the era of next-generation sequencing. METHODS: A retrospective analysis was conducted on prospectively collected prenatal ACC cases in which amniocentesis was performed between January 2016 and December 2022. ACC was divided into non-isolated and isolated according to the presence or absence of ultrasound abnormalities. Chromosomal microarray analysis (CMA), karyotyping and exome sequencing (ES) were performed after genetic counseling. Pregnancy outcomes were assessed by pediatric neurosurgeons and were followed up by telephone through their parents. RESULTS: Sixty-eight fetuses with ACC were enrolled in this study. CMA detected eight cases with pathogenic copy number variants (CNVs) and all were non-isolated ACC, with a detection rate of 11.8% (8/68). Among the CMA abnormalities, the majority (6/8) were detectable by karyotyping. ES was performed in 26 cases with normal CMA, revealing pathogenic or likely pathogenic gene variations in 12 cases (46.2%, 12/26), involving L1CMA, SMARCB1, PPP2R1A, ARID1B, USP34, CDC42, NFIA and DCC genes. The detection rates of ES in isolated and non-isolated ACC were 40% (6/15) and 54.5% (6/11), respectively. After excluding cases where pregnancy was terminated (56 cases), there were 12 live births, ranging in age from 15 months to 7 years. Of these, 91.7% (11 out of 12) demonstrated normal neurodevelopmental outcomes. Specifically, all five cases with isolated ACC and negative ES results exhibited normal neurodevelopment. The remaining six cases with favorable outcomes were all isolated ACC, among which ES identified variants of DCC and USP34 gene in one each case. The other four cases were CMA-negative and declined ES. CONCLUSIONS: We highlight the efficacy of prenatal ES in determining the genetic etiology of ACC, whether isolated or not. Favorable neurodevelopmental outcomes were observed when ACC was isolated and with normal ES results.
RESUMO
Herbivorous insects harbor a variety of insect-specific viruses (ISVs) some of which are considered to be valuable biological agents for potential applications in biological defense and control strategies. Leaf beetles with chewing mouthparts are particularly known for their capacity to disrupt plant tissue while feeding, often creating openings that can act as entry points for plant pathogens. In this study, we have identified two new negative-sense RNA viruses infecting the leaf beetle Aulacophora indica, an important member of the Chrysomelidae family. These recently discovered viruses belong to the viral families Nyamiviridae and Chuviridae and have been preliminarily named Aulacophora indica nyami-like virus 1 (AINlV1) and Aulacophora indica chu-like virus 1 (AIClV1), respectively. The complete genomic sequences of these viruses were obtained using rapid amplification of cDNA ends (RACE) techniques. Detailed analysis of their genomic structures has confirmed their similarity to other members within their respective families. Furthermore, analysis of virus-derived small interfering RNA (vsiRNA) demonstrated a high abundance and typical vsiRNA pattern of AINlV1 and AIClV1, offering substantial evidence to support their classification as ISVs. This research enhances our understanding of viral diversity within insects.
RESUMO
BACKGROUND: Robot-assisted implant surgery has emerged as a novel digital technology, and the accuracy need further assessment. PURPOSE: This study aimed to compare the accuracy of single dental implant placement between a novel semi-active robot-assisted implant surgery (RAIS) method and the conventional free-hand implant surgery (FHIS) method through a multicenter, randomized controlled clinical trial. MATERIALS AND METHODS: Patients requiring single dental implant placement were recruited and randomized into RAIS and FHIS group. Deviations at the platform, apex, and angle between the planned and final implant positions were assessed in both groups. Additionally, the evaluation of instrument and surgical complications was examined. RESULTS: A total of 140 patients (median age: 35.35 ± 12.55 years; 43 males, 97 females) with 140 implants from four different research centers were included, with 70 patients (70 implants) in the RAIS group and 70 patients (70 implants) in the FHIS group. In the RAIS and FHIS groups, the median platform deviations were 0.76 ± 0.36 mm and 1.48 ± 0.93 mm, respectively (p < 0.001); median apex deviations were 0.85 ± 0.48 mm and 2.14 ± 1.25 mm, respectively (p < 0.001); and median angular deviations were 2.05 ± 1.33° and 7.36 ± 4.67°, respectively (p < 0.001). Similar significant difference also presented between RAIS and FHIS group in platform vertical/horizontal deviation, apex vertical/horizontal deviation. Additionally, implants with self-tapping characteristics exhibited significantly larger deviations compared with those without self-tapping characteristics in the RAIS group. Both RAIS and FHIS methods demonstrated comparable morbidity and safety pre- and post-operation. CONCLUSIONS: The results indicated that the RAIS method demonstrated superior accuracy in single dental implant placement compared with the FHIS method. Specifically, RAIS exhibited significantly smaller deviations in platform, apex, and angular positions, as well as platform and apex vertical/horizontal deviations. This clinical trial was not registered prior to participant recruitment and randomization. https://www.chictr.org.cn/showproj.html?proj=195045.
RESUMO
Negevirus is a recently proposed taxon of arthropod-infecting virus, which is associated with plant viruses of two families (Virgaviridae and Kitaviridae). Nevertheless, the evolutionary history of negevirus-host and its relationship with plant viruses remain poorly understood. Endogenous nege-like viral elements (ENVEs) are ancient nege-like viral sequences integrated into the arthropod genomes, which can serve as the molecular fossil records of previous viral infection. In this study, 292 ENVEs were identified in 150 published arthropod genomes, revealing the evolutionary history of nege-like viruses and two related plant virus families. We discovered three novel and eight strains of nege-like viruses in 11 aphid species. Further analysis indicated that 10 ENVEs were detected in six aphid genomes, and they were divided into four types (ENVE1-ENVE4). Orthologous integration and phylogenetic analyses revealed that nege-like viruses had a history of infection of over 60 My and coexisted with aphid ancestors throughout the Cenozoic Era. Moreover, two nege-like viral proteins (CP and SP24) were highly homologous to those of plant viruses in the families Virgaviridae and Kitaviridae. CP- and SP24-derived ENVEs were widely integrated into numerous arthropod genomes. These results demonstrate that nege-like viruses have a long-term coexistence with arthropod hosts and plant viruses of the two families, Virgaviridae and Kitaviridae, which may have evolved from the nege-like virus ancestor through horizontal virus transfer events. These findings broaden our perspective on the history of viral infection in arthropods and the origins of plant viruses. IMPORTANCE: Although negevirus is phylogenetically related to plant virus, the evolutionary history of negevirus-host and its relationship with plant virus remain largely unknown. In this study, we used endogenous nege-like viral elements (ENVEs) as the molecular fossil records to investigate the history of nege-like viral infection in arthropod hosts and the evolution of two related plant virus families (Virgaviridae and Kitaviridae). Our results showed the infection of nege-like viruses for over 60 My during the arthropod evolution. ENVEs highly homologous to viral sequences in Virgaviridae and Kitaviridae were present in a wide range of arthropod genomes but were absent in plant genomes, indicating that plant viruses in these two families possibly evolved from the nege-like virus ancestor through cross-species horizontal virus transmission. Our findings provide a new perspective on the virus-host coevolution and the origins of plant viruses.