Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 115
Filtrar
1.
J Endocrinol Invest ; 2024 Jun 15.
Artigo em Inglês | MEDLINE | ID: mdl-38878126

RESUMO

PURPOSE: The use of thyroid hormones (TH) to treat obesity is unsupported by evidence as reflected in international guidelines. We explored views about this practice, and associations with respondent characteristics among European thyroid specialists. METHODS: Specialists from 28 countries were invited to a survey via professional organisations. The relevant question was whether "Thyroid hormones may be indicated in biochemically euthyroid patients with obesity resistant to lifestyle interventions". RESULTS: Of 17,232 invitations 5695 responses were received (33% valid response rate; 65% women; 90% endocrinologists). Of these, 290 (5.1%) stated that TH may be indicated as treatment for obesity in euthyroid patients. This view was commoner among non-endocrinologists (8.7% vs. 4.7%, p < 0.01), private practice (6.5% vs. 4.5%, p < 0.01), and varied geographically (Eastern Europe, 7.3%; Southern Europe, 4.8%; Western Europe, 2.7%; and Northern Europe, 2.5%). Respondents from Northern and Western Europe were less likely to use TH than those from Eastern Europe (p < 0.01). Gross national income (GNI) correlated inversely with this view (OR 0.97, CI: 0.96-0.97; p < 0.001). Having national guidelines on hypothyroidism correlated negatively with treating obesity with TH (OR 0.71, CI: 0.55-0.91). CONCLUSIONS: Despite the lack of evidence, and contrary to guidelines' recommendations, about 5% of respondents stated that TH may be indicated as a treatment for obesity in euthyroid patients resistant to life-style interventions. This opinion was associated with (i) respondent characteristics: being non-endocrinologist, working in private practice, treating a small number of hypothyroid patients annually and (ii) national characteristics: prevalence of obesity, Eastern Europe, low GNI and lack of national hypothyroidism guidelines.

2.
Endocrine ; 78(3): 559-569, 2022 12.
Artigo em Inglês | MEDLINE | ID: mdl-35962896

RESUMO

BACKGROUND: Most pituitary adenomas (PAs) are considered to have a soft tumor consistency. However, there is a non-negligible percentage (5-13%) of tumors presenting or exhibiting a fibrous consistency that would entail a more difficult and complicated surgical excision with higher surgical morbidity and mortality rates. PURPOSE: To analyze the clinical consequences of PA tumor consistency on the surgical outcomes in patients undergoing endonasal endoscopic transsphenoidal (EET) pituitary surgery. METHODS: An ambispective study of patients with PAs operated on through an EET approach in two Spanish tertiary hospitals over the last 12 years. A total of 226 consecutive interventions were carried out in the Neurosurgery Departments of the Hospital Universitario Ramón y Cajal (HURC) and the Hospital Universitario Puerta del Sur by the same neurosurgeon. PAs were grouped into soft (n = 150) and fibrous (n = 76). All patients underwent hormonal and magnetic resonance imaging (MRI) studies before and after surgery. In addition, neurosurgical complications were recorded in each patient. RESULTS: Fibrous adenomas were independently associated with lower resection rates compared to soft adenomas (fibrous gross total resection [GTR] rate 48.7% vs. 76.3%, p < 0.001), even in those adenomas without invasion of the cavernous sinus (Knosp grades 0, I, and II). There were more intraoperative cerebrospinal fluid (CSF) leaks in patients with fibrous PAs. Moreover, fibrous PAs showed higher rates of postoperative hypopituitarism, permanent diabetes insipidus (DI) and postoperative treatments (hormonal treatment and radiotherapy). The excision of a fibrous PA required a longer surgical time (22.5 min more than soft PAs, p = 0.014), regardless of other factors. CONCLUSION: The consistency of the PAs significantly conditions both the results of surgery (lower resections rates), complications (higher incidence of postoperative hypopituitarism, permanent DI), and the prognosis (higher incidence of postoperative treatments) of the patient undergoing EET.


Assuntos
Adenoma , Diabetes Insípido , Hipopituitarismo , Neoplasias Hipofisárias , Humanos , Neoplasias Hipofisárias/patologia , Estudos Retrospectivos , Resultado do Tratamento , Complicações Pós-Operatórias/epidemiologia , Complicações Pós-Operatórias/etiologia , Adenoma/patologia , Hipopituitarismo/etiologia , Hipopituitarismo/complicações
3.
Tissue Cell ; 71: 101589, 2021 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-34274592

RESUMO

The liver has multiple functions that change throughout ontogeny. South American camelids (SAC) have unique characteristics related to adaptation to extreme environments and metabolism. However, the process of hepatic cell differentiation has not been studied in any SAC. We study the patterns of cell differentiation and proliferation in the liver of the alpaca at different times of the ontogeny, excluding the hematopoietic components. Immunohistochemical techniques were performed in 66 specimens, including embryos, fetuses, neonates and adults. Supplementary analyses were performed by lectinhistochemistry. The hepatocytic differentiation was performed by the identification of Hepatocyte (Clone: ​​OCH1ES Dako®). It began in the specimens of 1.8-2.5 cm of crown to rump length (CRL), from Days 25-29 (ovulation = Day 0), continued during gestation and intensified towards its end. The cholangiocytic differentiation was performed by the identification of cytokeratin 7 (CK7, Dako®). It was manifested at the final of gestation (specimens of 28.4 cm CRL, from Day 223 onwards). Parenchymal cells underwent a process of gradual differentiation (differentiation of hepatocytes preceded that of cholangiocytes). Cell proliferation was observed along gestation using the nuclear proliferation antigen (PCNA) and Ki-67. Hepatic organogenesis in the alpacas shares similar differentiation and proliferation mechanisms with other altricial, but phylogenetically distant, species.


Assuntos
Antígenos de Diferenciação/metabolismo , Camelídeos Americanos/embriologia , Diferenciação Celular , Proliferação de Células , Hepatócitos/metabolismo , Fígado/embriologia , Animais , Feminino , Masculino
4.
Rev Clin Esp (Barc) ; 221(1): 18-25, 2021 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-33998473

RESUMO

OBJECTIVE: To analyze the clinical and analytical features, diagnostic tests, therapies, and outcomes of pheochromocytoma (PCC). DESIGN AND METHODS: A multicenter retrospective study in surgically treated patients with PCC followed in 3 Spanish tertiary referral hospitals. RESULTS: A total of 106 patients (61 [57.5%] women, mean age 52.3 ±â€¯14.8 years) were evaluated. At diagnosis, PCC was symptomatic in 62% and sporadic in 83%. Patients with familial PCC were significantly younger than those with sporadic disease (40.8 ±â€¯14.2 years vs 54.5 ±â€¯13.9 years, p < .001). Familial PCCs were more frequently associated with MEN2A (n = 8). Levels of 24-h urinary fractionated metanephrines were positively related to tumor size. The maximum tumor diameter was 4.3 cm (3-6 cm); 27.7% of the patients had tumors ≥6 cm. Incidental PCCs were significantly smaller than symptomatic PCCs (3.4 cm [2.4-5.0 cm] vs 5.6 cm [4.0-7.0 cm], p < .001). Scintigraphy by ¹²³I-metaiodobenzylguanidine showed a high sensitivity (81.9%). Preoperative alpha blockade with phenoxybenzamine was used in 93.6% and doxazosin in the rest. Laparoscopic surgery was used in 2/3 of the patients, with a low conversion (1.9%) to open surgery. Perioperative complications appeared in approximately 20% of patients, mainly hypertensive crisis (9.4%). Recurrent disease appeared in 10%, and malignant PCC was uncommon (6.3%). CONCLUSIONS: PCCs surgically treated in Spain are usually large, symptomatic, and sporadic tumors diagnosed around the sixth decade of life. Hereditary PCC is usually associated with MEN2A. The main type of surgical technique used is laparoscopic surgery, and the prevalence of metastatic PCC is low.


Assuntos
Neoplasias das Glândulas Suprarrenais , Feocromocitoma , 3-Iodobenzilguanidina , Adolescente , Neoplasias das Glândulas Suprarrenais/diagnóstico por imagem , Neoplasias das Glândulas Suprarrenais/genética , Neoplasias das Glândulas Suprarrenais/patologia , Neoplasias das Glândulas Suprarrenais/terapia , Antagonistas Adrenérgicos alfa/uso terapêutico , Adulto , Idoso , Idoso de 80 Anos ou mais , Catecolaminas/urina , Conversão para Cirurgia Aberta/estatística & dados numéricos , Doxazossina/uso terapêutico , Feminino , Humanos , Hipertensão/epidemiologia , Masculino , Metanefrina/urina , Pessoa de Meia-Idade , Neoplasia Endócrina Múltipla Tipo 2a/complicações , Neoplasias Pancreáticas/genética , Fenoxibenzamina/uso terapêutico , Feocromocitoma/diagnóstico por imagem , Feocromocitoma/genética , Feocromocitoma/patologia , Feocromocitoma/terapia , Complicações Pós-Operatórias/epidemiologia , Estudos Retrospectivos , Fatores de Tempo , Carga Tumoral , Adulto Jovem
5.
Rev Clin Esp ; 2020 Jul 06.
Artigo em Inglês, Espanhol | MEDLINE | ID: mdl-32646754

RESUMO

OBJECTIVE: To analyze the clinical and analytical features, diagnostic tests, therapies, and outcomes of pheochromocytoma (PCC). DESIGN AND METHODS: A multicenter retrospective study in surgically treated patients with PCC followed in 3 Spanish tertiary referral hospitals. RESULTS: A total of 106 patients (61 [57.5%] women, mean age 52.3 ± 14.8 years) were evaluated. At diagnosis, PCC was symptomatic in 62% and sporadic in 83%. Patients with familial PCC were significantly younger than those with sporadic disease (40.8 ± 14.2 years vs. 54.5 ± 13.9 years, p<.001). Familial PCCs were more frequently associated with MEN2A (n=8). Levels of 24-h urinary fractionated metanephrines were positively related to tumor size. The maximum tumor diameter was 4.3cm (3-6cm); 27.7% of the patients had tumors ≥6cm. Incidental PCCs were significantly smaller than symptomatic PCCs (3.4cm [2.4-5.0cm] vs. 5.6cm [4.0-7.0cm], p<.001). Scintigraphy by 123I-metaiodobenzylguanidine showed a high sensitivity (81.9%). Preoperative alpha blockade with phenoxybenzamine was used in 93.6% and doxazosin in the rest. Laparoscopic surgery was used in 2/3 of the patients, with a low conversion (1.9%) to open surgery. Perioperative complications appeared in approximately 20% of patients, mainly hypertensive crisis (9.4%). Recurrent disease appeared in 10%, and malignant PCC was uncommon (6.3%). CONCLUSIONS: PCCs surgically treated in Spain are usually large, symptomatic, and sporadic tumors diagnosed around the sixth decade of life. Hereditary PCC is usually associated with MEN2A. The main type of surgical technique used is laparoscopic surgery, and the prevalence of metastatic PCC is low.

6.
Clin Transl Oncol ; 21(10): 1319-1326, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-30721524

RESUMO

AIM: There is an important lack of knowledge as to the functioning of multidisciplinary teams on thyroid cancer in current clinical practice. We aimed to retrieve data on the composition, structure, and procedures developed by the multidisciplinary units of thyroid cancer in Spain. METHODS: A nationwide survey consisting of questions about composition, structure, and functioning of multidisciplinary teams was designed. It was available online from November 15, 2017 to February 15, 2018. RESULTS: Seventy-two multidisciplinary units responded to our survey. Of these, 15 (20.8%) focused only in thyroid cancer, while 57 (79.2%) included other endocrine disorders or non-endocrine tumors. The median (interquartile range) of members of the teams was 11 (9-14). The most frequent medical specialties in the units were endocrinology (100%), surgery (94.4%), pathology (80.6%), radiology (75.0%), nuclear medicine (73.6%), and medical oncology (55.6%). The annual number of patients reviewed by the teams was 40 (20-74). 56.9% of the multidisciplinary teams have elaborated clinical protocols for local use. Apart from clinical case discussions in the meetings, 45.8% of the units included educational activities and 36.1% research subjects. Quality indicators were developed by 22% of the teams. CONCLUSIONS: These results suggest that there are some hopeful signs that international recommendations of having multidisciplinary approach to patients with thyroid cancer are being followed in Spain. This gives us the opportunity to proceed with further studies to analyze the real impact of this high standard of care on patient outcomes.


Assuntos
Equipe de Assistência ao Paciente/organização & administração , Neoplasias da Glândula Tireoide/terapia , Distribuição de Qui-Quadrado , Fidelidade a Diretrizes/estatística & dados numéricos , Pesquisas sobre Atenção à Saúde/estatística & dados numéricos , Humanos , Equipe de Assistência ao Paciente/estatística & dados numéricos , Indicadores de Qualidade em Assistência à Saúde , Espanha , Estatísticas não Paramétricas
7.
Arch Virol ; 163(4): 1009-1018, 2018 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-29353424

RESUMO

Deep sequencing of small RNAs has proved effective in the diagnosis of mycovirus infections. In this study, the presence of mycoviruses in ten isolates of the phytopathogenic fungus Fusarium circinatum was investigated by high-throughput sequencing (HTS) of small RNAs. The contigs resulting from de novo assembly of the reads were aligned to viral genome sequences. The presence of each mycovirus detected in the isolates was confirmed by RT-PCR analysis with four previously described primer pairs and seven new pairs designed on the basis of sequencing data. The findings demonstrate the potential use of HTS for reconstructing previously identified mitoviruses infecting F. circinatum.


Assuntos
Micovírus/genética , Fusarium/virologia , Genoma Viral , RNA Citoplasmático Pequeno/genética , RNA Viral/genética , Traqueófitas/microbiologia , Mapeamento de Sequências Contíguas , Micovírus/classificação , Micovírus/isolamento & purificação , Sequenciamento de Nucleotídeos em Larga Escala , Filogenia , Doenças das Plantas/microbiologia , Reação em Cadeia da Polimerase Via Transcriptase Reversa
9.
QJM ; 109(8): 561-2, 2016 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-27289112
10.
Exp Clin Endocrinol Diabetes ; 123(10): 589-93, 2015 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-26600053

RESUMO

OBJECTIVE: To investigate the relationship between hypogonadism and mortality in aged hospitalized male patients. DESIGN: A 5-year prospective observational study was conducted. Gonadal function was assessed at hospital admission and mortality was registered in the follow-up period. PATIENTS AND METHODS: We studied all patients≥65 years admitted for any reason during 2010 and 2011. Serum T concentrations were quantified in all patients. Hypogonadism was defined by the presence of serum T levels<200 ng/dl. Number of deaths and all-cause and cardiovascular (CV) mortality were registered until December 31(st), 2014. RESULTS: During the study 150 patients were admitted and 103 (68.7%) of them died during follow-up. Hypogonadism was positively associated with mortality (P=0.036). The percentage of hypogonadal patients was significantly (P=0.02) higher in the group of patients who died in hospital compared with those who died after hospital discharge and those who survived. CV disease was the main cause of death in 52 patients (50.5%). Kaplan-Meier analysis showed a median survival time for all-cause mortality of 2.0 (0-16.5) months and 21.0 (5.0-33.2) months for patients with and without hypogonadism, respectively (P<0.001). Similar findings were found when analyzing mortality due to CV disease (P=0.009). Hypogonadism was a strong independent predictor for all-cause (adjusted multivariate analysis, HR 3.35; 1.55-7.23, P=0.002) and CV mortality (HR 2.14; 1.18-3.86, P=0.012). CONCLUSIONS: Hypogonadism discovered during hospitalization is associated with in-hospital and long-term mortality in elderly male patients and predicts both all-cause mortality and CV mortality in this population.


Assuntos
Envelhecimento , Eunuquismo/mortalidade , Mortalidade Hospitalar , Hospitalização , Idoso , Idoso de 80 Anos ou mais , Eunuquismo/sangue , Humanos , Masculino , Estudos Prospectivos
11.
Ann Oncol ; 26(9): 1987-1993, 2015 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-26063633

RESUMO

BACKGROUND: The management of advanced neuroendocrine tumors (NETs) has recently changed. We assessed the activity of pazopanib after failure of other systemic treatments in advanced NETs. METHODS: This was a multicenter, open-label, phase II study evaluating pazopanib as a single agent in advanced NETs (PAZONET study). The clinical benefit rate (CBR) at 6 months was the primary end point. Translational correlation of radiological response and progression-free survival (PFS) with circulating and tissue biomarkers was also evaluated. RESULTS: A total of 44 patients were enrolled. Twenty-five patients (59.5%) were progression-free at 6 months (4 partial responses, 21 stable diseases) with a median PFS of 9.5 months [95% confidence interval (CI) 4.8-14.1]. The CBR varied according to prior therapy received, with 73%, 60% and 25% in patients treated with prior multitarget inhibitors, prior mTOR inhibitors and both agents, respectively. A nonsignificant increase in PFS was observed in patients presenting lower baseline circulating tumor cell (CTC) counts (9.1 versus 5.8 months; P = 0.22) and in those with decreased levels of soluble-vascular endothelial growth factor receptor-2 (sVEGFR-2) (12.6 versus 9.1 months; P = 0.067). A trend toward reduced survival was documented in patients with VEGFR3 rs307821 and rs307826 missense polymorphisms [hazard ratio (HR): 12.3; 95% CI 1.09-139.2; P = 0.042 and HR: 6.9; 95% CI 0.96-49.9; P = 0.055, respectively]. CONCLUSIONS: Pazopanib showed clinical activity in patients with advanced NETs regardless of previous treatments. Additionally, CTCs, soluble-s VEFGR-2 and VEGFR3 gene polymorphisms constitute potential biomarkers for selecting patients for pazopanib (NCT01280201). CLINICAL TRIAL NUMBER: NCT01280201.


Assuntos
Inibidores da Angiogênese/uso terapêutico , Biomarcadores Tumorais/genética , Tumores Neuroendócrinos/tratamento farmacológico , Neoplasias Pancreáticas/tratamento farmacológico , Pirimidinas/uso terapêutico , Sulfonamidas/uso terapêutico , Adulto , Idoso , Idoso de 80 Anos ou mais , Inibidores da Angiogênese/efeitos adversos , Antineoplásicos/efeitos adversos , Antineoplásicos/uso terapêutico , Intervalo Livre de Doença , Feminino , Humanos , Indazóis , Estimativa de Kaplan-Meier , Masculino , Pessoa de Meia-Idade , Células Neoplásicas Circulantes , Tumores Neuroendócrinos/mortalidade , Neoplasias Pancreáticas/mortalidade , Polimorfismo de Nucleotídeo Único/genética , Modelos de Riscos Proporcionais , Pirimidinas/efeitos adversos , Sulfonamidas/efeitos adversos , Resultado do Tratamento , Receptor 2 de Fatores de Crescimento do Endotélio Vascular/genética , Receptor 3 de Fatores de Crescimento do Endotélio Vascular/genética
12.
Ther Adv Med Oncol ; 7(1): 22-38, 2015 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-25553081

RESUMO

Advanced thyroid carcinoma is an infrequent tumor entity with limited treatment possibilities until recently. The extraordinary improvement in the comprehension of genetic and molecular alterations involving the RAS/RAF/mitogen-activated protein kinase and phosphatidylinositide 3-kinase/Akt/mammalian target of rapamycin signaling and interacting pathways that are involved in tumor survival, proliferation, differentiation, motility and angiogenesis have been the rationale for the development of new effective targeted therapies. Data coming from phase II clinical trials have confirmed the efficacy of those targeted agents against receptors in cell membrane and cytoplasmic molecules. Moreover, four of those investigational drugs, vandetanib, cabozantinib, sorafenib and lenvatinib, have reached a phase III clinical trial with favorable results in progression-free survival and overall survival in medullary thyroid carcinoma and differentiated thyroid carcinoma. Further analysis for an optimal approach has been conducted according to mutational profile and tumor subtypes. However, consistent results are still awaited and the research for adequate prognostic and predictive biomarkers is ongoing. The following report offers a comprehensive review from the rationale to the basis of targeted agents in the treatment of thyroid carcinoma. In addition, current and future therapeutic developments by the inhibition of further molecular targets are discussed in this setting.

13.
Endocrine ; 48(3): 978-84, 2015 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-25205450

RESUMO

Our aim was to assess short-term natural course of hypogonadism diagnosed during hospitalization for acute disease in aged male patients after discharge. A group of 43 hypogonadal males, aged 86.7±5.7 year, was studied. Serum concentrations of testosterone (T) and gonadotropins (follicle-stimulating hormone, FSH, and luteinizing hormone, LH) were measured in every patient both at admission and one month after discharge. Mean serum T at entry was 115.4±48.0 ng/dl. Hypogonadism was hyper-, hypo-, and normogonadotropic in 20 (46.5%), 20 (46.5%), and 3 (7.0%) patients, respectively. One month after discharge serum T concentrations increased significantly (230.9±135.6 ng/dl, p<0.001). At this point, more than half of the patients (n=27, 62.8%) showed normal serum T concentrations. Both gonadotropins, FSH (p<0.001), and LH (p=0.04) also increased one month after discharge. Approximately, half of the patients (13, 48.1%) who normalized serum T concentrations also showed normal serum gonadotropin concentrations. Patients who normalized their serum T concentrations one month after discharge showed significantly higher baseline values of T (134.7±33.9 ng/dl) than those who persisted with hypogonadism (n=16, 32.7%; 82.8±51.6 ng/dl, p<0.001). Lastly, serum T was the only independent predictor for achieving eugonadal status (OR 1.030; CI 95%, 1.010-1.050; p<0.001). In conclusion, about 63% of aged patients hospitalized for acute illness with hypogonadism discovered during hospitalization spontaneously normalize their serum T concentrations one month after discharge. Serum gonadotropin concentrations also increased after discharge. Serum T levels at admission was an independent predictor for the normalization of serum T concentrations.


Assuntos
Hormônio Foliculoestimulante/sangue , Hipogonadismo/diagnóstico , Hormônio Luteinizante/sangue , Testosterona/sangue , Idoso , Idoso de 80 Anos ou mais , Progressão da Doença , Hospitalização , Humanos , Hipogonadismo/sangue , Pacientes Internados , Masculino , Estudos Prospectivos
14.
J Endocrinol Invest ; 37(2): 135-41, 2014 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-24497212

RESUMO

OBJECTIVE: Male hypogonadism is common in the elderly and has been associated with increased risk of mortality. Our objective has been to assess the prevalence of primary and central hypogonadism in elderly male patients admitted to the hospital because of acute illness. We also evaluated the relationships between gonadal dysfunction and in-hospital mortality. PATIENTS AND METHODS: 150 patients, aged ≥65 years, admitted during 2010 and 2011 in our geriatric unit, were studied. Serum concentrations total, bioavailable and free testosterone, as well as of follicle-stimulating hormone and luteinizing hormone were quantified in every patient. Hypogonadism was defined by the presence of serum testosterone levels lower than 200 ng/dl. RESULTS: Hypogonadism was found in 80 patients (53.3 %). Serum gonadotropin concentrations were elevated in 43.7 % of these patients, whereas 41.3 % of hypogonadic patients showed normal and 15 % low gonadotropin concentrations. Respiratory tract infection and congestive heart failure were the main causes of hospitalization in hypogonadal men, whereas acute cerebrovascular disease was the main reason for admission in eugonadal patients. Of the 13 patients who died during hospitalization, 12 were hypogonadic. Patients who died showed significantly lower serum levels of total, free and bioavailable testosterone than those found in patients who survived. CONCLUSION: Our results show that about half of patients admitted for acute illness have hypogonadism, mainly of non-hypergonadotropic type. Gonadal hypofunction is significantly related with in-hospital mortality. A low value of serum testosterone may be a predictor for mortality in elderly male patients.


Assuntos
Idoso , Hospitalização/estatística & dados numéricos , Hipogonadismo/diagnóstico , Hipogonadismo/epidemiologia , Idoso de 80 Anos ou mais , Envelhecimento/sangue , Estudos Transversais , Gonadotropinas/sangue , Mortalidade Hospitalar , Humanos , Hipogonadismo/sangue , Hipogonadismo/terapia , Masculino , Prevalência , Prognóstico , Testosterona/sangue
15.
Plant Dis ; 98(3): 425, 2014 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-30708423

RESUMO

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36'34″ N, 3°25'10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41'42″ N, 5°35'36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d-1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 µm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 µm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 µm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5' GAAGGTGAAGTCGTAACAAGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3') primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.

16.
QJM ; 106(6): 495-504, 2013 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-23329574

RESUMO

Prolactinomas are the most common type of pituitary adenomas. Macroprolactinomas are the name used for these tumors when their size is ≥ 1 cm. These tumors commonly cause symptoms due to the excessive production of prolactin as well as complaints caused by tumor mass and compression of neural adjacent structures. Clinical diagnosis and assessment of macroprolactinoma are based on the measurement of serum prolactin concentrations and the morphological evaluation of the pituitary gland by magnetic resonance imaging. Dopamine agonists are the first-line treatment modality, with cabergoline being preferred to bromocriptine, because of its better tolerance and feasibility of administration. Cabergoline therapy has been reported to achieve normalization of prolactin levels and gonadal function and reduction of tumor volume in >50% of patients with macroprolactinoma. Resistance or intolerance to dopamine agonists are the main indications for transsphenoidal adenomectomy in patients with macroprolactinoma. External radiation therapy has been used in patients with poor response to medical and surgical procedures. Clinically significant tumor growth may occur during pregnancy in women with macroprolactinomas, especially if they have not received prior surgical or radiation therapy. Visual fields should be assessed periodically during pregnancy and therapy with dopamine agonists is indicated if symptomatic tumor growth occurs. Cystic and giant prolactinomas as well as the rare cases of malignant prolactinomas have special peculiarities and entail a therapeutic challenge.


Assuntos
Neoplasias Hipofisárias/diagnóstico , Prolactinoma/diagnóstico , Fatores Etários , Agonistas de Dopamina/uso terapêutico , Feminino , Humanos , Imageamento por Ressonância Magnética , Neoplasias Hipofisárias/genética , Neoplasias Hipofisárias/terapia , Gravidez , Complicações Neoplásicas na Gravidez/terapia , Prolactinoma/genética , Prolactinoma/terapia , Fatores Sexuais
17.
Diabet Med ; 29(12): 1510-4, 2012 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-22507223

RESUMO

AIMS: We aimed to assess the relative risk for hypothyroidism in patients with Type 2 diabetes. METHODS: In this study, 1112 patients with Type 2 diabetes (58% women, mean age 66.7 years, median duration of diabetes 10 years, 179 with previous history of thyroid disease) and 911 subjects without diabetes were evaluated. RESULTS: The gender-, age- and weight-adjusted relative risk (odds ratio) of newly identified hypothyroidism in patients with Type 2 diabetes in comparison with control subjects was 2.81 (1.77-4.48). This odds ratio was significant in patients over 65 years [4.02 (1.95-8.31)], as well as in both men [4.84 (1.58-14.80)] and women [2.60 (1.54-4.38)], in obese patients [2.56 (1.36-4.82)] and non-obese patients [3.11 (1.56-6.20)] and in individuals with [4.26 (1.73-10.46)] and without [2.93 (1.50-5.75)] thyroid autoantibodies. Logistic regression analysis showed that newly diagnosed hypothyroidism was significantly and directly related not only with thyroid autoimmunity [19.15 (8.73-42.01)], but also with the presence of macroangiopathy [2.85 (1.51-5.35)] and metformin treatment [2.51 (1.28-4.92)]. CONCLUSIONS: Our results favour screening for hypothyroidism in patients with Type 2 diabetes older than 65 years, especially in the presence of diabetic macroangiopathy or treatment with metformin.


Assuntos
Diabetes Mellitus Tipo 2/sangue , Jejum/sangue , Hipotireoidismo/sangue , Tireotropina/sangue , Tiroxina/sangue , Idoso , Autoanticorpos , Diabetes Mellitus Tipo 2/tratamento farmacológico , Diabetes Mellitus Tipo 2/epidemiologia , Feminino , Humanos , Hipoglicemiantes/uso terapêutico , Hipotireoidismo/epidemiologia , Hipotireoidismo/prevenção & controle , Modelos Logísticos , Masculino , Metformina/uso terapêutico , Razão de Chances , Prevalência , Risco
18.
Plant Dis ; 96(5): 770, 2012 May.
Artigo em Inglês | MEDLINE | ID: mdl-30727562

RESUMO

The basidiomycete Heterobasidion annosum (Fr.) Bref. (=Fomes annosus (Fr.) Cooke), one of the most important pathogens in coniferous forests in Europe, Asia, and North America, causes root and butt rot. H. annosum was first recorded on Pinus pinaster Ait. (commonly known as Maritime pine) in France and Great Britain in 1961 (4) and Portugal in 1986 (2). P. pinaster is the most widespread conifer in Spain, with more than 700,000 and 600,000 ha in pure and mixed stands, respectively. Over the last few years, P. pinaster decline was observed in several stands in the center of the Iberian Peninsula. Unusual crown transparency, small needles, foliage discoloration, and early tree death are characteristic decline symptoms associated with the high mortality rate on this species. In June of 2010, 11 trees (40 to 60 years old) with a different degree of decline were felled in two zones (42°2'41″N, 3°18'14″W, elevation 1,096 m and 41°55'40″N, 3°12'3″W, elevation 1,128 m) and cut into sections (stump height, breast height, and near the top). Wood slices were removed from each section and taken to the laboratory. Samples were placed in moist chambers with optimal conditions of humidity and temperature to enhance pathogen growth. After 20 days of incubation in darkness at 25°C, H. annosum (anamorph Spiniger meineckellum [A. Olson] Stalpers) occurred on most of these slices. Conidiophores with subglobose to pyriform conidia (5.8 × 4.2 µm) were observed with a compound microscope. The fungus was isolated to extract DNA by disruption of the mycelium followed by washes with phenol/chloroform/isoamyl alcohol solution (25:24:1). DNA was precipitated with 20% polyethylene glycol solution. PCR was carried out according to the instructions of the manufacturer of Dynazyme II DNA polymerase (Finnzymes Ltd, Espoo, Finland) with ITS primers, 1F (5'-CTTGGTCATTTAGAGGAAGTAA-3') and 4 (5'-TCCTCCGCTTATTGATATGC-3'). After DNA purification, samples were sequenced (SECUGEN, Madrid, Spain) and aligned and corrected with Geneious Pro 5.3 to obtain the consensus sequences. Resulting DNA sequences of two isolates were deposited in GenBank (Nos. FR850494 and FR850495), and compared with a Blastn search at GenBank showing 100% identity and 100% coverage with H. annosum sensu stricto, former ISG-P (intersterility group of pines). For pathogenicity tests, 10 seedlings (2 year old) were inoculated with autoclaved P. pinaster wood chips colonized by H. annosum, and 10 control seedlings were inoculated with noncolonized wood chips. Inoculums were prepared by growing H. annosum on 4-mm-diameter wood chips placed on potato dextrose agar media for 3 weeks. The wood chips were put inside an oblique incision made at 6 cm above the soil line and wrapped with Parafilm. After 8 weeks in a growth chamber at 22.5°C with a 14-h photoperiod, the inoculated seedlings showed typical symptoms and 3 seedlings of 10 were dead. H. annosum was previously recorded on P. sylvestris in central Spain (1), causing needle drop, swelling at the stump height, and presence of dead trees by circular areas. This pathogen was also reported on P. nigra in northeastern Spain, associated with defoliation and mortality (3). To our knowledge, this is the first record of H. annosum on P. pinaster in Spain. References: (1) J. Benito-Martínez. An. Jardín Bot. Madrid 3:23, 1943. (2) N. Neves et al. EPPO Bull. 16:505, 1986. (3) J. Oliva et al. Bol. Sanidad Vegetal. Plagas. 34:415, 2008. (4) P. Spaulding. US Dep. Agric. Agric. Handb. 197:100, 1961.

20.
Int J Clin Pract ; 65(6): 669-73, 2011 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-21564439

RESUMO

BACKGROUND: An association between prolactin-secreting pituitary adenomas and anaemia in male patients has been recently reported. Our aim has been to evaluate the prevalence of anaemia in men with prolactinomas and to assess the relationships between haemoglobin concentrations and pituitary function at diagnosis in these patients. METHODS: In a retrospective analysis, 26 male patients with prolactinomas (22 macroprolactinomas and 4 microprolactinomas) were studied. Blood haemoglobin concentration, haematocrit value and baseline hormonal levels were collected at the time of prolactinoma diagnosis. The presence or absence of partial or total hypopituitarism was also evaluated at diagnosis. Logistic regression analysis was used to assess the presence of anaemia as a function of serum hormone concentrations and pituitary dysfunction. RESULTS: Patient bearing macroprolactinomas showed significant lower haemoglobin concentrations than those found in patients with microprolactinomas (13.5 ± 1.2 g/dl vs. 15.1 ± 0.9 g/dl, p < 0.05). Anaemia (haemoglobin < 13 g/dl) was present in nine (34.6%) patients, all of them with macroprolactinomas. The degree of anaemia was mild (haemoglobin > 11 g/dl) in all patients. No correlation between haemoglobin and serum prolactin was found. Haemoglobin concentration was significantly lower in men with hypogonadism (n = 14) than in eugonadal men. Haemoglobin value was also significantly lower in patients with total hypopituitarism in comparison with patients with partial hypopituitarism (12.4 ± 1.0 g/dl, n = 7 vs. 14.0 ± 1.2 g/dl, n = 13, p = 0.007). The number of affected pituitary axes was found to be related with the presence of anaemia. Logistic regression analysis showed that anaemia was related with FT4 (OR 0.23; 95% CI 0.06-0.81, p = 0.02), cortisol (OR 0.81; 95% CI 0.68-0.96, p= 0.02) and the presence of hypopituitarism (OR 20.0; 95% CI 1.68-238.63, p = 0.02). CONCLUSIONS: Anaemia was found in about a third of men with prolactinomas. Our results also suggest that the presence of anaemia in these patients seems to be associated with panhypopituitarism.


Assuntos
Anemia/etiologia , Neoplasias Hipofisárias/complicações , Prolactinoma/complicações , Adulto , Hemoglobinas/metabolismo , Humanos , Hipogonadismo/etiologia , Hipopituitarismo/etiologia , Masculino , Pessoa de Meia-Idade , Neoplasias Hipofisárias/sangue , Prolactinoma/sangue , Estudos Retrospectivos , Adulto Jovem
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...