Celiac trunk aortic dissection induced by bevacizumab therapy for rectal cancer: A case report.

RATIONALE: Bevacizumab (Bev) is a humanized monoclonal antibody that targets vascular endothelial growth factor A and is primarily used for the treatment of various solid tumors. Aortic dissection (AD) is a severe vascular disease caused by the tearing of the intimal layer of the aorta or bleeding within the aortic wall, resulting in the separation of different layers of the aortic wall. However, the pathogenesis is not fully understood. Some studies have suggested that Bev treatment is associated with the occurrence of AD. PATIENT CONCERNS: A 67-year-old Chinese male was diagnosed with rectal cancer accompanied by liver and lung metastasis. Three days after starting combined chemotherapy with Bev, the patient developed persistent abdominal pain. Abdominal CT scan revealed celiac trunk AD in the abdominal aorta. DIAGNOSES: The patient was diagnosed with rectal cancer accompanied by liver and lung metastases. Abdominal CT tomography revealed a celiac trunk AD. INTERVENTIONS: Somatostatin combined with valsartan was used to control blood pressure. The patient was subsequently referred for vascular surgery and underwent an abdominal aortic angiography. Conservative treatment was continued. OUTCOMES: Three months after the initiation of treatment, follow-up abdominal CT scans showed stability in the condition of celiac trunk AD, with no abdominal pain or hypertension. There were no signs of worsening dissection, aneurysm formation, or inadequate perfusion of end organs. LESSONS: There may be a connection between Bev and elevated blood pressure as well as celiac trunk AD.

Enhancing automatic prediction of clinically significant prostate cancer with deep transfer learning 2.5-dimensional segmentation on bi-parametric magnetic resonance imaging (bp-MRI).

Background: The aggressiveness of prostate cancer (PCa) is crucial in determining treatment method. The purpose of this study was to establish a 2.5-dimensional (2.5D) deep transfer learning (DTL) detection model for the automatic detection of clinically significant PCa (csPCa) based on bi-parametric magnetic resonance imaging (bp-MRI). Methods: A total of 231 patients, including 181 with csPCa and 50 with non-clinically significant PCa (non-csPCa), were enrolled. Stratified random sampling was then employed to divide all participants into a training set [185] and a test set [46]. The DTL model was obtained through image acquisition, image segmentation, and model construction. Finally, the diagnostic performance of the 2.5D and 2-dimensional (2D) models in predicting the aggressiveness of PCa was evaluated and compared using receiver operating characteristic (ROC) curves. Results: DTL models based on 2D and 2.5D segmentation were established and validated to assess the aggressiveness of PCa. The results demonstrated that the diagnostic efficiency of the DTL model based on 2.5D was superior to that of the 2D model, regardless of whether in a single or combined sequence. Particularly, the 2.5D combined model outperformed other models in differentiating csPCa from non-csPCa. The area under the curve (AUC) values for the 2.5D combined model in the training and test sets were 0.960 and 0.949, respectively. Furthermore, the T2-weighted imaging (T2WI) model showed superiority over the apparent diffusion coefficient (ADC) model, but was not as effective as the combined model, whether based on 2.5D or 2D. Conclusions: A DTL model based on 2.5D segmentation was developed to automatically evaluate PCa aggressiveness on bp-MRI, improving the diagnostic performance of the 2D model. The results indicated that the continuous information between adjacent layers can enhance the detection rate of lesions and reduce the misjudgment rate based on the DTL model.

Spectroscopic evidence of spin-state excitation in d-electron correlated semiconductor FeSb2.

Iron antimonide (FeSb2) has been investigated for decades due to its puzzling electronic properties. It undergoes the temperature-controlled transition from an insulator to an ill-defined metal, with a cross-over from diamagnetism to paramagnetism. Extensive efforts have been made to uncover the underlying mechanism, but a consensus has yet to be reached. While macroscopic transport and magnetic measurements can be explained by different theoretical proposals, the essential spectroscopic evidence required to distinguish the physical origin is missing. In this paper, through the use of X-ray absorption spectroscopy and atomic multiplet simulations, we have observed the mixed spin states of 3d 6 configuration in FeSb2. Furthermore, we reveal that the enhancement of the conductivity, whether induced by temperature or doping, is characterized by populating the high-spin state from the low-spin state. Our work constitutes vital spectroscopic evidence that the electrical/magnetical transition in FeSb2 is directly associated with the spin-state excitation.

Inhibition of autophagy via 3-methyladenine alleviates the progression of preeclampsia.

Autophagy is a cellular mechanism for self-renewal that involves the breakdown of cytoplasmic proteins or organelles within lysosomes. Although preeclampsia (PE) exhibits several characteristics that could imply disrupted autophagy, there is limited evidence supporting the notion that impaired placental autophagy directly causes PE, as indicated by differential expression profiling of whole placental tissue. In this study, we aim to explore the significance of autophagy in maintaining pregnancy and its association with PE. First, the RNA-seq results show that 218 genes are differentially expressed in placentas from preeclamptic pregnancies. Notably, KEGG pathway analysis reveals significant enrichment of genes related to autophagy-related signaling pathways, including the PI3K-Akt signaling pathway, the AMPK signaling pathway, and the mTOR signaling pathway. Additionally, our findings indicate an increase in autophagy in placentas from pregnancies complicated by preeclampsia as well as in trophoblasts subjected to hypoxic conditions. Next, we examine the impact of 3-methyladenine (3-MA), a targeted inhibitor of autophagy, on the progression of PE. The administration of 3-MA profoundly alleviates the severity of PE-like symptoms in rats subjected to reduced uterine perfusion pressure (RUPP). The findings from our study suggest that inhibiting autophagy may serve as a promising approach for adjuvant chemotherapy for PE.

The relationship between uric acid and bone mineral density in the intermediate stage of CKD 1-3.

BACKGROUND: Some studies have suggested that uric acid has antioxidant properties that can prevent bone loss, but the relationship between uric acid and bone mineral density is controversial. The aim of this study was to investigate the relationship between UA and BMD in patients with CKD stage 1-3. METHODS: We extracted 13,047 participants from the NHANES database, including 7342 male subjects and 5705 female subjects. Weighted multiple linear regression analysis was used to investigate the correlation between UA and BMD in patients with CKD stages 1-3. RESULTS: In patients with CKD stage 1-3, UA was significantly correlated with BMD. In the male group, UA was positively associated with BMD (ß, 7.94 [95%CI, 4.95, 10.94]). In the female group, there was a negative relationship between them (ß, -5.33 [95%CI, -8.77, -1.89]). The relationship between UA and BMD in male group showed an inverted U-shaped curve, and UA was positively correlated before 6.1 mg/dl and negatively correlated after 6.1 mg/dl. The relationship was basically negative in the female group. CONCLUSIONS: For the patients with CKD stage 1-3, the relationship between UA and BMD showed an inverted U-shaped curve in the males, while the relationship was largely negative in the females.

Activation of Piezo1 or TRPV2 channels inhibits human ureteral contractions via NO release from the mucosa.

We aimed to investigate the expression and motor modulatory roles of several mechano-sensitive channels (MSCs) in human ureter. Human proximal ureters were obtained from eighty patients subjected to nephrectomy. Expression of MSCs at mRNA, protein and functional levels were examined. Contractions of longitudinal ureter strips were recorded in organ bath. A fluorescent probe Diaminofluoresceins was used to measure nitric oxide (NO). RT-PCR analyses revealed predominant expression of Piezo1 and TRPV2 mRNA in intact ureter and mucosa. Immunofluorescence assays indicate proteins of MSCs (Piezo1/Piezo2, TRPV2 and TRPV4) were mainly distributed in the urothelium. Ca2+ imaging confirmed functional expression of TRPV2, TRPV4 and Piezo1 in cultured urothelial cells. Specific agonists of Piezo1 (Yoda1, 3-300 µM) and TRPV2 (cannabidiol, 3-300 µM) attenuated the frequency of ureteral contractions in a dose-dependent manner while the TRPV4 agonist GSK1016790A (100 nM-1 µM) exerted no effect. The inhibitory effects of Piezo1 and TRPV2 agonists were significantly blocked by the selective antagonists (Dooku 1 for Piezo1, Tranilast for TRPV2), removal of the mucosa, and pretreatment with NO synthase inhibitor L-NAME (10 µM). Yoda1 (30 µM) and cannabidiol (50 µM) increased production of NO in cultured urothelial cells. Our results suggest that activation of Piezo1 or TRPV2 evokes NO production and release from mucosa that may mediate mechanical stimulus-induced reduction of ureter contractions. Our findings support the idea that targeting Piezo1 and TRPV2 channels may be a promising pharmacological strategy for ureter stone passage or colic pain relief.

[Gene cloning and functional analysis of an iridoid oxidase gene in Rehmannia glutinosa].

Rehmannia glutinosa is one of the commonly used Chinese herbal medicines, which has activities of heat-clearing,blood-cooling, Yin-nourishing, and body fluid-promoting. Iridoid glycosides are the main bioactive in R. glutinosa. Iridoid oxidase is a key rate-limiting enzyme in the biosynthetic pathway of iridoid glycosides. In this study, an iridoid oxidase gene Rg IO was screened based on the transcriptome data, followed by bioinformatics analysis, expression characteristic detection, and subcellular localization analysis. The results show that the coding region of Rg IO is 1 536 bp, with 511 amino acids encoded, and the molecular weight is about 58 258. 01. The protein sequence of Rg IO contains the conserved domains and motifs of cytochrome P450 oxidases. Rg IO has the highest sequence identities with its ortholog proteins in Striga asiatica, Striga hermonthica, and Centranthera grandiflora and has good sequence identities(77. 28%) with Catharanthus roseus Cr IO. Rg IO shows specific expression in the leaf of R. glutinosa. In response to MeJA induction, the expression of MeJA in leaves and roots after treatment increases by 3. 15 and 1. 3 times at 3 h and 6 h,respectively. The result of subcellular localization shows that Rg IO is distributed in the endoplasmic reticulum. Agrobacterium-mediated transient expression of Rg IO gene in leaves of R. glutinosa makes the content of catalpol increase by 0. 82 times compared with the transient expression of the empty vector. This study provides a key target gene for the molecular regulation and biosynthesis of catalpol in R. glutinosa and lays a foundation for revealing the complete biosynthetic pathway of catalpol.

Inverse Regulation of C-C Chemokine Receptor 3 Oligomerization by Downstream Proteins Indicates Biased Signal Transduction Pathways.

Oligomerization is one of the important mechanisms for G protein-coupled receptors (GPCRs) to modulate their activity in signal transduction. However, details of how and why the oligomerization of GPCRs regulates their functions under physiological conditions remain largely unknown. Here, using single-molecule photobleaching technology, we show that chemokine ligand 5 (CCL5) and chemokine ligand 8 (CCL8) are similar to the previously reported chemokine ligand 11 (CCL11) and chemokine ligand 24 (CCL24), which can regulate the oligomerization of chemokine receptor 3 (CCR3). Our results further demonstrate that downstream proteins, ß-arrestin 2 and Gi protein complex, on the CCR3 signal transduction pathway, can inversely regulate the oligomeric states of CCR3 induced by its binding ligands. This unexpected discovery suggests complex relationships between the oligomeric behaviors of CCR3 and the components of ligands-CCR3-downstream proteins, reflecting the potentially functional impact of the oligomerization on the multiple activation pathways of GPCR, such as biased activation.

Probe fusion all-optic OCT-PAM dual-mode imaging system for biomedical imaging.

We proposed a non-contact photoacoustic (PA) detection method using spectral domain optical coherence tomography (SDOCT). Two interference spectrums (A-lines) were acquired before and after the PA excitation with SDOCT. PA signal propagated within the sample causing the vibration. The vibration inner the sample introduced phase change between the acquired two A-lines. Thus, the PA signal can be detected by evaluating the difference in phase between the two A-lines. Based on the method, an OCT-PAM dual-mode imaging system was constructed. In the system, SDOCT served as the detection unit for PAM. Thus, the combination of the two imaging modalities was simplified. Another advantage of the system is that it realizes non-contact all-optic detection, which is attractive for biomedical imaging. Using the system, we imaged phantoms of carbon fibers, asparagus leaves and human hairs. Furthermore, the cortical vasculature of rat was imaged in vivo and the flow status was evaluated quantitatively.

Pathogen stimulations and immune cells synergistically affect the gene expression profile characteristics of porcine peripheral blood mononuclear cells.

BACKGROUND: Pigs serve as a crucial source of protein in the human diet and play a fundamental role in ensuring food security. However, infectious diseases caused by bacteria or viruses are a major threat to effective global pig farming, jeopardizing human health. Peripheral blood mononuclear cells (PBMCs) are a mixture of immune cells that play crucial roles in immunity and disease resistance in pigs. Previous studies on the gene expression regulation patterns of PBMCs have concentrated on a single immune stimulus or immune cell subpopulation, which has limited our comprehensive understanding of the mechanisms of the pig immune response. RESULTS: Here, we integrated and re-analyzed RNA-seq data published online for porcine PBMC stimulated by lipopolysaccharide (LPS), polyinosinic acid (PolyI:C), and various unknown microorganisms (EM). The results revealed that gene expression and its functional characterization are highly specific to the pathogen, identifying 603, 254, and 882 pathogen-specific genes and 38 shared genes, respectively. Notably, LPS and PolyI:C stimulation directly triggered inflammatory and immune-response pathways, while exposure to mixed microbes (EM) enhanced metabolic processes. These pathogen-specific genes were enriched in immune trait-associated quantitative trait loci (QTL) and eGenes in porcine immune tissues and were implicated in specific cell types. Furthermore, we discussed the roles of eQTLs rs3473322705 and rs1109431654 in regulating pathogen- and cell-specific genes CD300A and CD93, using cellular experiments. Additionally, by integrating genome-wide association studies datasets from 33 complex traits and diseases in humans, we found that pathogen-specific genes were significantly enriched for immune traits and metabolic diseases. CONCLUSIONS: We systematically analyzed the gene expression profiles of the three stimulations and demonstrated pathogen-specific and cell-specific gene regulation across different stimulations in porcine PBMCs. These findings enhance our understanding of shared and distinct regulatory mechanisms of genetic variants in pig immune traits.

Portable Hadamard-Transform Raman Spectrometer: A Powerful Analytical Tool for Point-of-Care Testing.

A portable Hadamard-transform Raman spectrometer with excellent performance was fabricated consisting of a 785 nm laser, an optical filter, an optical system, a control system, and a signal processing system. As the core of the spectrometer, the optical system was composed of a slit, collimator, optical grating, reflector, digital micromirror devices (DMD), lens system, and InGaAs photodetector. Compared with a conventional dispersive Raman spectrometer, the proposed Raman spectrometer adopted the DMD and corresponding controlling device (DLPC350 control chip) to collect the Raman spectrum. Thus, in our design, the gratings are fixed, while the full Raman spectrum was collected by the deflection of the micromirror. This design can greatly improve the vibration resistance ability of the spectrometer since the gratings are not rotating during the spectrum collecting. More importantly, Hadamard-transform was used as signal processing technology, which has the ability of faster calculation, the merits of high energy input, single detector multichannel simultaneous detection (imaging) ability, and high signal-to-noise ratio (SNR). Hence, the Hadamard-transform portable Raman spectrometer has the potential to be applied in the field of point-of-care testing (POCT).

Exploring drug repositioning possibilities of kinase inhibitors via molecular simulation.

Kinases, a class of enzymes controlling various substrates phosphorylation, are pivotal in both physiological and pathological processes. Although their conserved ATP binding pockets pose challenges for achieving selectivity, this feature offers opportunities for drug repositioning of kinase inhibitors (KIs). This study presents a cost-effective in silico prediction of KIs drug repositioning via analyzing cross-docking results. We established the KIs database (278 unique KIs, 1834 bioactivity data points) and kinases database (357 kinase structures categorized by the DFG motif) for carrying out cross-docking. Comparative analysis of the docking scores and reported experimental bioactivity revealed that the Atypical, TK, and TKL superfamilies are suitable for drug repositioning. Among these kinase superfamilies, Olverematinib, Lapatinib, and Abemaciclib displayed enzymatic activity in our focused AKT-PI3K-mTOR pathway with IC50 values of 3.3, 3.2 and 5.8 µM. Further cell assays showed IC50 values of 0.2, 1.2 and 0.6 µM in tumor cells. The consistent result between prediction and validation demonstrated that repositioning KIs via in silico method is feasible.

1-Trinitromethyl-3,5-dinitro-4-nitroaminopyrazole: Intramolecular Full Nitration and Strong Intermolecular H-Bonds toward Highly Dense Energetic Materials.

Full nitration is one of the most effective strategies used in synthesizing high-density energetic materials, but this strategy has reached its limit because the resultant compounds cannot be further functionalized. To overcome this limitation, we present the synergistic action of full nitration and strong intermolecular H-bonding in designing and synthesizing 1-trinitromethyl-3,5-dinitro-4-nitroaminopyrazole (DNTP) with a density that exceeds those of the reported monocyclic CHON compounds. The detonation velocity and specific impulse of DNTP exceed those of 1-trinitromethyl-3,4,5-trinitropyrazole (TTP), HMX, and ADN.

The role of SIRT1 in kidney diseases.

SIRT1, a nicotinamide adenine dinucleotide (NAD +)-dependent class III histone deacetylase, exhibits a high level of expression within renal tissues. It has garnered considerable recognition for its pivotal role in modulating signaling pathways intricately linked with the aging process; however, it extends beyond this in the organism. The literature reports that SIRT1 regulates biological processes such as glucose metabolism, lipid metabolism, oxidative stress, inflammation, autophagy, endoplasmic reticulum stress, and apoptosis. Therefore, our study reviews the primary mechanisms by which SIRT1 induces kidney disease and the regulation of related signaling pathways in different models of renal disease. We also discuss commonly studied SIRT1-targeted interventional drugs reported in the literature, including inhibitors (e.g., Ex-527) and activators (e.g., resveratrol). This study aims to provide theoretical foundations and clinical insights for the development and screening of clinical drugs targeting SIRT1, aiming at enhanced scientific approaches for the prevention and treatment of kidney diseases.

The biological function of demethylase ALKBH1 and its role in human diseases.

AlkB homolog 1 (ALKBH1) is a member of the AlkB family of dioxygenases that are dependent on Fe(II) and α-ketoglutarate. Mounting evidence demonstrates that ALKBH1 exhibits enzymatic activity against various substrates, including N6-methyladenosine (m6A), N1-methyladenosine (m1A), N3-methylcytidine (m3C), 5-methylcytosine (m5C), N6-methyladenine (N6-mA, 6mA), and H2A, indicating its dual roles in different biological processes and involvement in human diseases. Up to the present, there is ongoing debate regarding ALKBH1's enzymatic activity. In this review, we present a comprehensive summary of recent research on ALKBH1, including its substrate diversity and pathological roles in a wide range of human disorders, the underlying mechanisms of its functions, and its dysregulation. We also explored the potential of ALKBH1 as a prognostic target.

Effect of microplastics on sodium hypochlorite disinfection and changes in its toxicity on zebrafish.

The presence of microplastics (MPs) in water may affect the efficacy of the disinfection process and induce toxicity changes to MPs themselves during disinfection. Therefore, this study evaluated the two-way effects of polyethylene microplastic (MP) particles in water and wastewater during sodium hypochlorite (NaClO) disinfection. On the one hand, it has been confirmed that the presence of MPs reduced the disinfection efficiency of NaClO. The required CT (concentration of the disinfection × contact time) for a 2-4-log inactivation of Escherichia coli (E. coli) in different water samples was in the order of deionized water < turbid water (1 NTU) < water with MPs (1 mg/L) < turbid water (10 NTU). On the other hand, although exposure to MPs did induce significant changes in the activities of superoxide dismutase and glutathione, compared to pristine MPs, the MPs treated by NaClO at current conditions (0.3 and 3.0 mg/L for 30 min) did not show significant changes in their toxicity on zebrafish, at an MP exposure concentration of 1 mg/L. There was no significant difference in the survival rate and weight growth rate, neither as in the activities of the oxidative stress-related enzymes (superoxide dismutase, catalase, glutathione, glutathione peroxidase, and glutathione s-transferase) in both gut and muscle tissues of the zebrafish, between exposure to the pristine and NaClO-treated MPs. It is indicated that NaClO disinfection commonly applied for water and wastewater treatment would not pose a serious concern to effluent safety in the presence of mild levels of MPs.

Assessing professional behaviors: a self-administered scale for medical students during clerkships.

BACKGROUND: Medical professionalism is a core competency for medical students during clerkships for further professional development. Given that the behavior-based framework could provide clear insight and is easy to assess, the study aimed to create a self-administered scale to measure the professional behaviors of medical students during their clerkships. METHODS: A comprehensive literature review on medical professional behaviors in English or Chinese and Delphi interviews were used to develop the initial version of the Self-Administered Scale for Professional Behavior of Medical Students During Clerkships. The reliability and validity analysis based on a survey of medical students from China, Cronbach's α calculations, and Confirmatory Factor Analysis (CFA) specifically were conducted to finalize the scale. The associations of professional behaviors with gender, medical programs, and clerkship duration were examined using Wilcoxon rank-sum tests. RESULTS: We included 121 studies and extracted 57 medical professionalism assessment tools, initially forming a pool of 48 items. To refine these items, eighteen experts participated in two rounds of Delphi interviews, ultimately narrowing down the item pool to 24 items. A total of 492 participants effectively completed the questionnaire. One item was removed due to its correlated item-total correlation (CITC) value, resulting in a final scale containing 23 items with six domains: Respect, Altruism, Communication and Collaboration, Integrity, Duty, and Excellence. The overall Cronbach's alpha value was 0.98, ranging from 0.88 to 0.95 for each domain. The fit indices (χ2/df = 4.07, CFI = 0.96, TLI = 0.95, RMSEA = 0.08, and SRMR = 0.02) signified a good fit for the six-domain model. Medical students' professional behavior was significantly associated with gender (p = 0.03) and clerkship duration (p = 0.001). CONCLUSION: The scale was demonstrated to be reliable and valid in assessing the professional behaviors of Chinese medical students during clerkships.

Current Applications of Colorectal Cancer Organoids: A Review.

Colorectal cancer is a prevalent malignancy, with advanced and metastatic forms exhibiting poor treatment outcomes and high relapse rates. To enhance patient outcomes, a comprehensive understanding of the pathophysiological processes and the development of targeted therapies are imperative. The high heterogeneity of colorectal cancer demands precise and personalized treatment strategies. Colorectal cancer organoids, a three-dimensional in vitro model, have emerged as a valuable tool for replicating tumor biology and exhibit promise in scientific research, disease modeling, drug screening, and personalized medicine. In this review, we present an overview of colorectal cancer organoids and explore their applications in research and personalized medicine, while also discussing potential future developments in this field.

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.