BCD020 rituximab bioanalog compared to standard treatment in juvenile systemic lupus erythematosus: The data of 12 months case-control study.

BACKGROUND: Systemic lupus erythematosus (SLE) is the most frequent and serious systemic connective tissue disease. Nowadays there is no clear guidance on its treatment in childhood. There are a lot of negative effects of standard-of-care treatment (SOCT), including steroid toxicity. Rituximab (RTX) is the biological B-lymphocyte-depleting agent suggested as a basic therapy in pediatric SLE. AIM: To compare the benefits of RTX above SOCT. METHODS: The data from case histories of 79 children from the Saint-Petersburg State Pediatric Medical University from 2012 to 2022 years, were analyzed. The diagnosis of SLE was established with SLICC criteria. We compared the outcomes of treatment of SLE in children treated with and without RTX. Laboratory data, doses of glucocorticosteroids, disease activity measured with SELENA-SLEDAI, and organ damage were assessed at the time of initiation of therapy and one year later. RESULTS: Patients, treated with RTX initially had a higher degree of disease activity with prevalence of central nervous system and kidney involvement, compared to patients with SOCT. One year later the disease characteristics became similar between groups with a more marked reduction of disease activity (SELENA-SLEDAI activity index) in the children who received RTX [-19 points (17; 23) since baseline] compared to children with SOCT [-10 (5; 15.5) points since baseline, P = 0.001], the number of patients with active lupus nephritis, and daily proteinuria. During RTX therapy, infectious diseases had three patients; one patient developed a bi-cytopenia. CONCLUSION: RTX can be considered as the option in the treatment of severe forms of SLE, due to its ability to arrest disease activity compared to SOCT.

Rituximab Biosimilar BCD020 Shows Superior Efficacy above Conventional Non-Biologics Treatment in Pediatric Lupus Nephritis: The Data of Retrospective Cohort Study.

BACKGROUND: Pediatric lupus nephritis (LN) is one of the most serious manifestations of systemic lupus erythematosus (SLE) in children, determining the outcomes of the disease. There are no standardized treatment protocols for pediatric LN, and the role of biologics has not yet been conclusively defined. OBJECTIVES: analyze the safety and efficacy of rituximab biosimilar BCD020 in pediatric patients with lupus nephritis. METHODS: in a retrospective cohort study, the data from the case histories of 25 patients with LN (10 boys and 15 girls) with an onset age of 13 (9-16) years, who failed conventional non-biologic treatment or developed corticosteroid dependence/toxicity, were included. The diagnosis was made using Systemic Lupus International Collaborating Clinics (SLICC) classification criteria. Rituximab biosimilar BCD020 was prescribed in a dosage of 375 mg/m2 every week (2-4 infusions) with repeated courses every 6-12 months (2-4 infusions) according to disease activity, B-cell depletion, and IgG levels. The dynamics of clinical and laboratory data, the activity of the disease by SLEDAI, and corticosteroid doses were assessed at the onset and during the rituximab trial. RESULTS: The main patient's characteristics were: Pre-rituximab non-biologic conventional treatment included: cyclophosphamide 15 (60%), MMF 8 (32%), azathioprine 3 (12%), hydroxychloroquine 12 (48%), and pulse therapy of methylprednisolone followed by oral methylprednisolone 25 (100%). The time before rituximab was 7.0 (3.0-24.0) months, and the whole observation period was 7.0 (0; 24) months. The initial pre-rituximab treatment slightly reduced SLEDAI levels and the proportion of patients with LN. A significant reduction of SLEDAI, the anti-dsDNA level, proteinuria, hematuria, C4 complement, ESR, and the median corticosteroid dose by 80% from the initial value, as well as the proportion of patients without corticosteroids, was observed after rituximab administration. Two deaths were observed due to catastrophic SLE with macrophage activation syndrome, accompanied by a severe infection (invasive aspergillosis, n = 2). Three patients developed serious adverse events: pneumonia (n = 2), transient agranulocytosis (n = 1) after the third rituximab infusion, and meningitis, caused by Listeria monocytosis, after the first rituximab infusion. Eight patients received antibacterial treatment for different respiratory infections without hospital admissions. CONCLUSIONS: Rituximab biosimilar BCD020 showed effectiveness in LN, whereas previous non-biologic treatment was insufficiently effective. Randomized controlled trials are required to evaluate the efficacy and safety of rituximab and evaluate the benefits when compared with conventional SLE treatment.

Standard and increased canakinumab dosing to quiet macrophage activation syndrome in children with systemic juvenile idiopathic arthritis.

Objective: Macrophage activation syndrome (MAS) is a life-threatening, potentially fatal condition associated with systemic juvenile idiopathic arthritis (sJIA). Interleukin-1 (IL-1) is a key cytokine in the pathogenesis of sJIA MAS. Many cases of MAS are medically refractory to traditional doses of biologic cytokine inhibitors and may require increased dosing. When MAS occurs in the setting of sJIA treated with the IL-1 receptor antagonist (IL-1Ra), anakinra, increased anakinra dosing may be beneficial. Increased dosing of another IL-1 inhibitor, canakinumab, a monoclonal antibody to IL-1ß, has not been reported to treat refractory MAS in the setting of sJIA. Methods: Retrospective data collection extracted from the electronic medical record focused on canakinumab usage and dosing in 8 children with sJIA who developed MAS at a single academic center from 2011 to 2020. Results: Eight sJIA children (five girls) with median age 8.5 years (range, 0.9-14.2 years) were included in the present study. Five children developed MAS at disease onset and three during ongoing canakinumab therapy. MAS resolved in all eight children with canakinumab treatment. When the canakinumab dosing was insufficient or MAS developed during canakinumab therapy, the dosing was temporally up-titrated (four patients, maximum 300 mg per dose) without observed side effects. Conclusion: This report provides evidence for the efficacy and safety of short-term increased doses (2-3-times normal) of canakinumab in treating sJIA associated MAS. Further study of the efficacy and safety of increased doses of canakinumab for treatment of MAS in children with sJIA is warranted.

Uveitis Is a Risk Factor for Juvenile Idiopathic Arthritis' Significant Flare in Patients Treated With Biologics.

Objectives: Uveitis is the most frequent extra-articular manifestation of juvenile idiopathic arthritis (JIA). Our study is aimed to evaluate the possible difference in arthritis course depending on uveitis presence in patients with JIA, treated with biologics. Methods: From our database of patients with JIA treated with biologics, we extracted patients to whom the first agent was administrated with or without MTX. The exclusion criteria included treatment with current systemic corticosteroids, infliximab, rituximab, observation period <3 years, and no missing data. After selection, 175 patients were eligible for analysis. We evaluated clinically significant flare with joint involvement (which required change of biologic or non-biologic DMARD) and time to flare. We compared two groups: (i) patients with uveitis (n = 32) and (ii) patients without uveitis (n = 143). For statistical analysis, we used Cox's regression models, the log-Rank test, x 2 test, and the Mann-Whitney test. Results: There was no difference in gender distribution and achievement of arthritis remission between groups. Patients in the non-uveitis group predominantly received etanercept (64.3%). In the uveitis group, the most prescribed biologic agent was adalimumab (71.9%). The presence of uveitis increased the risk of JIA flare, OR = 3.8 (95% CI: 1.7; 8.7), and the cumulative probability of joint flare, RR = 4.5 (95% CI: 1.7; 12.1), p =.003, after adjustment on methotrexate, RR = 3.1 (1.6; 6.), p =.0008. In the subgroup of patients treated with adalimumab, the absence of methotrexate increased the cumulative probability of flare [RR = 6.5 (95% CI: 1.4; 31.1), p = 0.02]. Conclusion: The presence of uveitis proved to be a risk factor in JIA flare. Methotrexate can decrease the cumulative flare probability. Further trials are required.

The Safety and Efficacy of Tofacitinib in 24 Cases of Pediatric Rheumatic Diseases: Single Centre Experience.

JAK-inhibitors are small molecules blocking the JAK-STAT pathway that have proven effective in the treatment of different immune-mediated diseases in adults and juvenile idiopathic arthritis (JIA). AIM OF STUDY: To evaluate the safety and efficacy of tofacitinib in children with different rheumatic diseases. MATERIAL AND METHODS: We extracted information from 24 children with the following diagnosis: JIA (n = 15), undifferentiated systemic autoinflammatory diseases (SAIDs) (n = 7), and juvenile dermatomyositis (JDM) (n = 2) who have been treated with tofacitinib for a period of longer than 6 months. The treatment outcomes were classified according to the opinion of the attending physicians as having a complete response (CR), i.e., the absence of disease activity, or a partial response (PR)-a significant improvement of symptoms and disease activity, or no response (NR)-no changes in disease activity. RESULTS: CR was achieved in 10/24 patients; 7/15 among JIA patients, 1/2 among JDM patients, 4/7 among SAID patients, and PR in 5/15 of JIA, 1/2 of JDM, and 3/7 of SAID patients. Three non-responders with JIA discontinued tofacitinib. Corticosteroids were successfully tapered off in 11/14 patients and discontinued in 2/14 patients. Four patients had side effects not requiring treatment discontinuation: liver enzyme elevation (n = 2), hypercholesterolemia (n = 1), lymphadenitis (n = 1). CONCLUSION: JAK-inhibitors are effective new therapies for the treatment of multiple immune-mediated diseases. Our experience has shown the best results in patients with JIA and JIA-associated alopecia, and type I interferonopathies. More data from randomized controlled clinical trials are needed to use JAK-inhibitors safely in pediatric rheumatic diseases.

Next generation sequencing analysis of consecutive Russian patients with clinical suspicion of inborn errors of immunity.

Primary immune deficiencies are usually attributed to genetic defects and, therefore, frequently referred to as inborn errors of immunity (IEI). We subjected the genomic DNA of 333 patients with clinical signs of IEI to next generation sequencing (NGS) analysis of 344 immunity-related genes and, in some instances, additional genetic techniques. Genetic causes of the disease were identified in 69/333 (21%) of subjects, including 11/18 (61%) of children with syndrome-associated IEIs, 45/202 (22%) of nonsyndromic patients with Jeffrey Modell Foundation (JMF) warning signs, 9/56 (16%) of subjects with periodic fever, 3/30 (10%) of cases of autoimmune cytopenia, 1/21 (5%) of patients with unusually severe infections and 0/6 (0%) of individuals with isolated elevation of IgE level. There were unusual clinical observations: twins with severe immunodeficiency carried a de novo CHARGE syndrome-associated SEMA3E c.2108C>T (p.S703L) allele; however, they lacked clinical features of CHARGE syndrome. Additionally, there were genetically proven instances of Netherton syndrome, Х-linked agammaglobulinemia, severe combined immune deficiency (SCID), IPEX and APECED syndromes, among others. Some patients carried recurrent pathogenic alleles, such as AIRE c.769C>T (p.R257*), NBN c.657del5, DCLRE1C c.103C>G (p.H35D), NLRP12 c.1054C>T (p.R352C) and c.910C>T (p.H304Y). NGS is a powerful tool for high-throughput examination of patients with malfunction of immunity.

Reasons for inactive disease and flare in systemic onset juvenile idiopathic arthritis patients during tocilizumab treatment.

OBJECTIVES: The aim of our study was to evaluate disease courses and outcomes of sJIA children undergoing tocilizumab (TCZ) treatment, and to establish the predictors which distinguish inactive disease and disease flares. METHODS: Our retrospective study included 48 active sJIA children who were refractory to different anti-rheumatic drugs and who were then started on TCZ. The effectiveness of TCZ was assessed by the changes of sJIA attributed signs and symptoms and the remission was judged according to the Wallace (2004) criteria. RESULTS: The main demographic parameters (Me; IQR) were shown; mean age: 9.9 (5-12.7) years and mean duration of TCZ administration: 27.0 (5.9-89.7) months. During the TCZ treatment 40 cases (83.3%) achieved remission in 138.5 (56.0; 255.0) days. Patients who achieved remission had milder disease course, and presented less frequent epatosplenomegaly, lung, heart involvement and MAS. They had higher Hb and lower WBC, granulocytes, ESR, CRP, LDH, ferritin. The main predictors of achievement of inactive disease, calculated with Cox-regression models, were CRP≤82.0 mg/l (OR=7.9, HR=1.17), ESR≤32 mm/h (OR=17.0, HR=0.85), ferritin ≤273 ng/ml (OR=56.5, HR=2.6), Hb>113 g/l (OR=17.0, HR=1.33), LDH≤676 U/l (OR=113.6, HR=3.2), PLT>335*109/l (OR=5.0, HR=2.5), and intensive depression of WBC in 2 weeks after the 1st TCZ infusion>11% (OR=13.0, HR=6.0) and granulocytes>12% (OR=14.0, HR=4.7). CONCLUSIONS: sJIA children with milder disease course have more posssibilty of achieving disease remission during TCZ treatment. Male sex, signs of high disease activity, previous CS treatment, the long time needed to achieve inactive disease and treatment protocol deviations increased the risk of sJIA flare.

Comparable Efficacy of Abatacept Used as First-line or Second-line Biological Agent for Severe Juvenile Idiopathic Arthritis-related Uveitis.

OBJECTIVE: Abatacept (ABA) has recently been proposed as second-line treatment in patients with juvenile idiopathic arthritis (JIA)-associated uveitis refractory to anti-tumor necrosis factor-α (anti-TNF) agents, but little is known about its efficacy as a first-line approach. The aim of the present study was to compare the safety and efficacy of ABA as a first-line biological agent (ABA-1) with that of ABA as a second-line treatment after 1 or more anti-TNF agents (ABA-2), in patients with severe JIA-related uveitis. METHODS: In this multicenter study, we collected data on patients with severe JIA-related uveitis treated with ABA as a first-line or second-line biological agent. Changes in frequency of uveitis flares/year and ocular complications before and after ABA treatment, clinical remission, and side effects were recorded. RESULTS: Thirty-five patients with a mean age of 10.8 years were treated with ABA for a mean period of 19.6 months. In 4 patients, ABA administration was discontinued, owing to inefficacy on arthritis in 3 cases and allergic reaction in 1. Thirty-one patients, 14 in the ABA-1 group and 17 in the ABA-2 group, completed the 12-month followup period; of these, 17 (54.8%) had clinical remission. The mean frequency of uveitis flares decreased from 4.1 to 1.2 in the ABA-1 group (p = 0.002) and from 3.7 to 1.2 in the ABA-2 group (p = 0.004). Preexisting ocular complications improved or remained stable in all but 5 patients, all in the ABA-2 group. No significant difference was found between the efficacy of the 2 treatment modalities. ABA confirmed its good safety profile. CONCLUSION: ABA, used as first-line biological treatment or after 1 or more anti-TNF agents, induces a comparable improvement in severe refractory JIA-related uveitis.

Methotrexate treatment may prevent uveitis onset in patients with juvenile idiopathic arthritis: experiences and subgroup analysis in a cohort with frequent methotrexate use.

OBJECTIVES: To re-evaluate the ability of methotrexate (MTX) to prevent the onset of uveitis in Russian children with juvenile idiopathic arthritis (JIA). METHODS: The clinical charts for all consecutive patients who received a stable management for at least 2 years with or without MTX were reviewed. Patients who were given systemic medications other than MTX (except NSAID) and patients with systemic arthritis, rheumatoid factor-positive arthritis, or enthesitis-related arthritis were excluded. Each patient was examined after at least a 2-year follow-up period after the first visit to establish whether uveitis had occurred. RESULTS: A total of 281 patients with a median disease duration of 3.8 years were included. 191 patients (68%) were treated with MTX. During the observation period, 64 patients (22.8%) developed uveitis, a median of 1.6 year after disease onset. The frequency of uveitis was lower in MTX-treated than in MTX-untreated patients (11.5% vs. 46.7%, respectively, OR=6.7 (95%CI:3.7-12.3), p=0.0000001). Survival analysis confirmed that patients treated with MTX had a lower probability of developing uveitis (HR=4.35, p=0.000001). In subgroup analysis it was shown that MTX was more preventive in boys than in girls, and in patients with JIA onset age of over 5 years compared to those with disease onset less than 5 years. The data of survival analysis of MTX prevention has shown that benefits do not depend on the number of active joints and ANA status. CONCLUSIONS: MTX therapy may prevent the onset of uveitis in children with JIA. Further randomised controlled trials are required to confirm our results.

Successful treatment with tocilizumab every 4 weeks of a low disease activity group who achieve a drug-free remission in patients with systemic-onset juvenile idiopathic arthritis.

BACKGROUND: Systemic juvenile idiopathic arthritis (SoJIA) is the most striking form of juvenile idiopathic arthritis. The aim of our study was to evaluate the clinical responses and outcomes of children with SoJIA to IL-6 blockade using two different tocilizumab (TCZ) treatment protocols designed for milder and more severe SoJIA patient groups, and evaluate the possibility of achieving biologic-free remission. METHODS: Thirty-seven active SoJIA children who have failed treatment with corticosteroids and other DMARDs were included in our retrospective study. TCZ doses were prescribed in two treatment approaches: every 2 weeks TCZ dosing (Q2W) and every 4 weeks TCZ dosing (Q4W). The patients were assigned to these two groups by the study physicians depending on the severity of the SoJIA disease as judged by each clinician. RESULTS: Thirty-three of the 37 children successfully completed the trial. TCZ was discontinued in 11patients during the trial. Seven children achieved inactive disease and were allowed to stop the TCZ and 4 had severe adverse events requiring drug cessation. Currently 7 patients continue to have TCZ-free remission [4/7 remission off-medication, 3/7still on methotrexate (MTX)]. This mixed group had a median treatment duration of 1002 days. The children in remission off of all medications, TCZ and MTX, had a median remission duration of 1162 days (ranged 932-1301 days). Compared to the patients assigned to the Q2W TCZ treatment group, the patients assigned to the Q4W TCZ group had a milder SoJIA course. The patients had higher levels of hemoglobin, total proteins, and serum albumins. They had lower white blood cell counts (WBC), % granulocytes, CRP, ESR, ferritins, and LDH. These children had a lower frequency of internal organ involvement, fewer relapses during TCZ treatment, and no macrophage activation syndrome episodes. CONCLUSIONS: Our experience with TCZ for SoJIA supports the excellent result of other studies. What may be novel is our finding that thisIL-6 blockade with TCZ may be able to be utilized at a less frequent dosing schedule in mild SoJIA compared to severe SoJIA. We discuss other factors that may increase the probability of a patient reaching TCZ-free remission.

Identification of the best cutoff points and clinical signs specific for early recognition of macrophage activation syndrome in active systemic juvenile idiopathic arthritis.

OBJECTIVES: The purpose of our study was to detect early clinical and laboratory signs that help to discriminate macrophage activation syndrome (MAS) from active systemic juvenile idiopathic arthritis (SJIA) without MAS. METHODS: Our retrospective study was based on reviewing the medical charts of the children admitted to the rheumatology department with active SJIA and definite MAS (n = 18) and without MAS (n = 40). We evaluated the data related to SJIA and MAS at the moment of the patient׳s admission. If the patient had signs of MAS since admission or developed definite MAS later during this flare, he was referred to the main group. The children who did not have MAS during the flare episode and did not have MAS in the past medical history were in the control group. We calculated the cutoff points for MAS parameters, performed the analysis of sensitivity and specificity, identified the predictors, and provided the preliminary diagnostic rule through "the-number-of-criteria-present" approach. RESULTS: The clinical signs were relevant to MAS in SJIA: oligoarticular disease course (OR = 5.6), splenomegaly (OR = 67.6), hemorrhages (OR = 33.0), and respiratory failure (OR = 11.3). The involvement of wrist (OR = 0.2), MCP (OR = 0.1), and PIP joints (OR = 0.1) was protective against MAS development. The best cutoffs for laboratory parameters were PLT ≤ 211 × 10(9)/l, WBC ≤ 9.9 × 10(9)/l, AST > 59.7U/l, LDH > 882U/l, albumin ≤ 2.9g/dl, ferritin > 400µg/l, fibrinogen ≤ 1.8g/l, and proteinuria. The laboratory variables were more precise in the discrimination of early MAS than clinical: any 3 or more laboratory criteria provided the highest specificity (1.0) and sensitivity (1.0) and OR = 2997. CONCLUSIONS: We detected clinical and laboratory markers and created preliminary diagnostic (laboratory) guidelines for early discrimination of MAS in active SJIA.

A130: Is the CCR5-delta32 Mutation Protective Against Systemic-Onset Juvenile Idiopathic Arthritis?

BACKGROUND/PURPOSE: The CCR5 protein is a chemokine receptor, and is known to be expressed on T cells, macrophages, dendritic and microglia cells. It is believed that different prevalence of HLA and CCR5- delta32-a 32 base pair deletion in the coding region-in various ethnic groups is associated with the severity and prevalence of chemokine-mediated autoimmune diseases, systemic-onset Juvenile Idiopathic Arthritis (soJIA) being among them (Del Rincon et al., 2003). Since the end of the last century the protective role of the CCR5-delta32 mutation against JIA is discussed (Hinks et al., 2010), though it seems the role of this mutation is less simple than was hitherto thought. The purposes of the study was to compare the prevalence of the CCR5-delta32 mutation in children with and without soJIA, to assess the association of this mutation with the severity of the disease and thus to evaluate its protective role. METHODS: 234 children (193 of European origin, 25-Hispanic or Latino, 14-Afro-Americans, 3-of Asian origin) with soJIA living in the USA and in the Northwestern part of Russia were enrolled in the study. Genomic DNA was isolated from blood samples using QIAamp Mini Kit and amplified by PCR. The following oligonucleotide primers were used to detect CCR5 d32: CCR5- Δ32-F: 5'CTTCATTACACCTGCAGTC3', CCR5-Δ32-R: 5'TGAAGATAAGCCTCACAGCC3' by following condition: 95°-5'×1; 95°-15″→55°-15″→72°-60″×40; 72°-10'×3→4°-∞; the resulting PCR products were separated on 2% agarose gel by electrophoresis and visualized by Gel Doc XR Plus. RESULTS: Mutation was revealed only in children of European origin. Though the prevalence of the heterozygous CCR5-delta32 mutation being 16% and 21% in the USA and in Russia correspondingly didn't excel from its prevalence in populations in total (10-18% for Northwestern Russia, Kofiady, 2008; 11,8%- for white American group, Downer et al, 2002), some laboratory and clinical signs of soJIA proved to be related to the mutation (see ). Heterozygous CCR5-delta32 genotype was associated with milder so-JIA course and predominance of the articular features over systemic. [Table: see text] CONCLUSION: The results of the study may be considered rather not supporting the idea of the protective role of the CCR5-delta32 mutation against soJIA, though the revealed associations-most of them related to the signs of the Macrophage Associated Syndrome-can be the basis for a more sophisticated research.