Chemoproteomics Reveals USP5 (Ubiquitin Carboxyl-Terminal Hydrolase 5) as Promising Target of the Marine Polyketide Gracilioether A.

Mass spectrometry-based chemical proteomic approaches using limited proteolysis have become a powerful tool for the identification and analysis of the interactions between a small molecule (SM) and its protein target(s). Gracilioether A (GeA) is a polyketide isolated from a marine sponge, for which we aimed to trace the interactome using this strategy. DARTS (Drug Affinity Responsive Target Stability) and t-LiP-MS (targeted-Limited Proteolysis-Mass Spectrometry) represented the main techniques used in this study. DARTS was applied on HeLa cell lysate for the identification of the GeA target proteins, and t-LiP-MS was employed to investigate the protein's regions involved in the binding with GeA. The results were complemented through the use of binding studies using Surface Plasmon Resonance (SPR) and in silico molecular docking experiments. Ubiquitin carboxyl-terminal hydrolase 5 (USP5) was identified as a promising target of GeA, and the interaction profile of the USP5-GeA complex was explained. USP5 is an enzyme involved in the pathway of protein metabolism through the disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. This activity is connected to different cellular functions concerning the maintenance of chromatin structure and receptors and the degradation of abnormal proteins and cancerogenic progression. On this basis, this structural information opens the way to following studies focused on the definition of the biological potential of Gracilioether A and the rational development of novel USP5 inhibitors based on a new structural skeleton.

Theonella: A Treasure Trove of Structurally Unique and Biologically Active Sterols.

The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the sponge Theonella spp. represents an arsenal of novel compounds ranging from peptides, alkaloids, terpenes, macrolides, and sterols. In this review, we summarize the recent reports on sterols isolated from this amazing sponge, describing their structural features and peculiar biological activities. We also discuss the total syntheses of solomonsterols A and B and the medicinal chemistry modifications on theonellasterol and conicasterol, focusing on the effect of chemical transformations on the biological activity of this class of metabolites. The promising compounds identified from Theonella spp. possess pronounced biological activity on nuclear receptors or cytotoxicity and result in promising candidates for extended preclinical evaluations. The identification of naturally occurring and semisynthetic marine bioactive sterols reaffirms the utility of examining natural product libraries for the discovery of new therapeutical approach to human diseases.

Expanding the Library of 1,2,4-Oxadiazole Derivatives: Discovery of New Farnesoid X Receptor (FXR) Antagonists/Pregnane X Receptor (PXR) Agonists.

Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand this class of compounds and to understand the building blocks necessary to maintain the antagonistic activity, we describe herein the synthesis, the pharmacological evaluation, and the in vitro pharmacokinetic properties of a novel series of 1,2,4-oxadiazole derivatives decorated on the nitrogen of the piperidine ring with different N-alkyl and N-aryl side chains. In vitro pharmacological evaluation showed compounds 5 and 11 as the first examples of nonsteroidal dual FXR/Pregnane X receptor (PXR) modulators. In HepG2 cells, these compounds modulated PXR- and FXR-regulated genes, resulting in interesting leads in the treatment of inflammatory disorders. Moreover, molecular docking studies supported the experimental results, disclosing the ligand binding mode and allowing rationalization of the activities of compounds 5 and 11.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Biological Profile of Two Gentiana lutea L. Metabolites Using Computational Approaches and In Vitro Tests.

Natural products have been the main source of bioactive molecules for centuries. We tested the biological profile of two metabolites extracted from Gentiana lutea L. by means of computational techniques and in vitro assays. The two molecules (loganic acid and gentiopicroside) were tested in silico using an innovative technique, named Inverse Virtual Screening (IVS), to highlight putative partners among a panel of proteins involved in inflammation and cancer events. A positive binding with cyclooxygenase-2 (COX-2), alpha-1-antichymotrypsin, and alpha-1-acid glycoprotein emerged from the computational experiments and the outcomes from the promising interaction with COX-2 were confirmed by Western blot, highlighting the reliability of IVS in the field of the natural products.

Synergism of a Novel 1,2,4-oxadiazole-containing Derivative with Oxacillin against Methicillin-Resistant Staphylococcus aureus.

Staphylococcusaureus is an important opportunistic pathogen that causes many infections in humans and animals. The inappropriate use of antibiotics has favored the diffusion of methicillin-resistant S. aureus (MRSA), nullifying the efforts undertaken in the discovery of antimicrobial agents. Oxadiazole heterocycles represent privileged scaffolds for the development of new drugs because of their unique bioisosteric properties, easy synthesis, and therapeutic potential. A vast number of oxadiazole-containing derivatives have been discovered as potent antibacterial agents against multidrug-resistant MRSA strains. Here, we investigate the ability of a new library of oxadiazoles to contrast the growth of Gram-positive and Gram-negative strains. The strongest antimicrobial activity was obtained with compounds 3 (4 µM) and 12 (2 µM). Compound 12, selected for further evaluation, was found to be noncytotoxic on the HaCaT cell line up to 25 µM, bactericidal, and was able to improve the activity of oxacillin against the MRSA. The highest synergistic interaction was obtained with the combination values of 0.78 µM for compound 12, and 0.06 µg/mL for oxacillin. The FIC index value of 0.396 confirms the synergistic effect of compound 12 and oxacillin. MRSA treatment with compound 12 reduced the expression of genes included in the mec operon. In conclusion, 12 inhibited the growth of the MRSA and restored the activity of oxacillin, thus resulting in a promising compound in the treatment of MRSA infection.

Structure-based screening for the discovery of 1,2,4-oxadiazoles as promising hits for the development of new anti-inflammatory agents interfering with eicosanoid biosynthesis pathways.

The multiple inhibition of biological targets involved in pro-inflammatory eicosanoid biosynthesis represents an innovative strategy for treating inflammatory disorders in light of higher efficacy and safety. Herein, following a multidisciplinary protocol involving virtual combinatorial screening, chemical synthesis, and in vitro and in vivo validation of the biological activities, we report the identification of 1,2,4-oxadiazole-based eicosanoid biosynthesis multi-target inhibitors. The multidisciplinary scientific approach led to the identification of three 1,2,4-oxadiazole hits (compounds 1, 2 and 5), all endowed with IC50 values in the low micromolar range, acting as 5-lipoxygenase-activating protein (FLAP) antagonists (compounds 1 and 2), and as a multi-target inhibitor (compound 5) of arachidonic acid cascade enzymes, namely cyclooxygenase-1 (COX-1), 5-lipoxygenase (5-LO) and microsomal prostaglandin E2 synthase-1 (mPGES-1). Moreover, our in vivo results demonstrate that compound 5 is able to attenuate leukocyte migration in a model of zymosan-induced peritonitis and to modulate the production of IL-1ß and TNF-α. These results are of interest for further expanding the chemical diversity around the 1,2,4-oxadiazole central core, enabling the identification of novel anti-inflammatory agents characterized by a favorable pharmacological profile and considering that moderate interference with multiple targets might have advantages in re-adjusting homeostasis.

Molecular Network and Culture Media Variation Reveal a Complex Metabolic Profile in Pantoea cf. eucrina D2 Associated with an Acidified Marine Sponge.

The Gram-negative Pantoea eucrina D2 was isolated from the marine sponge Chondrosia reniformis. Sponges were collected in a shallow volcanic vents system in Ischia island (South Italy), influenced by CO2 emissions and lowered pH. The chemical diversity of the secondary metabolites produced by this strain, under different culture conditions, was explored by a combined approach including molecular networking, pure compound isolation and NMR spectroscopy. The metabolome of Pantoea cf. eucrina D2 yielded a very complex molecular network, allowing the annotation of several metabolites, among them two biosurfactant clusters: lipoamino acids and surfactins. The production of each class of metabolites was highly dependent on the culture conditions, in particular, the production of unusual surfactins derivatives was reported for the first time from this genus; interestingly the production of these metabolites only arises by utilizing inorganic nitrogen as a sole nitrogen source. Major components of the extract obtained under standard medium culture conditions were isolated and identified as N-lipoamino acids by a combination of 1D and 2D NMR spectroscopy and HRESI-MS analysis. Assessment of the antimicrobial activity of the pure compounds towards some human pathogens, indicated a moderate activity of leucine containing N-lipoamino acids towards Staphylococcus aureus, Staphylococcus epidermidis and a clinical isolate of the emerging food pathogen Listeria monocytogenes.

GPBAR1 Activation by C6-Substituted Hyodeoxycholane Analogues Protect against Colitis.

GPBAR1 agonists have been identified as potential leads for the treatment of diseases related to colon inflammation such as Crohn's and ulcerative colitis. In this paper, we report the discovery of a small library of hyodeoxycholane analogues, decorated at C-6 with different substituents, as potent and selective GPBAR1 agonists. In vitro pharmacological assays showed that compound 6 selectively activates GPBAR1 (EC50 = 0.3 µM) and reduces the production of pro-inflammatory cytokines (IL-1ß, IL-6, and TNF-α) in THP1 cells. The binding mode of compound 6 in GPBAR1 was elucidated by docking calculations. Moreover, compound 6 protects against TNBS-induced colitis in Gpbar1+/+ rodent model, representing an intriguing lead for the treatment of these inflammatory disorders.

Genomics-Metabolomics Profiling Disclosed Marine Vibrio spartinae 3.6 as a Producer of a New Branched Side Chain Prodigiosin.

A wide range of prescreening tests for antimicrobial activity of 59 bacterial isolates from sediments of Ria Formosa Lagoon (Algarve, Portugal) disclosed Vibrio spartinae 3.6 as the most active antibacterial producing strain. This bacterial strain, which has not previously been submitted for chemical profiling, was subjected to de novo whole genome sequencing, which aided in the discovery and elucidation of a prodigiosin biosynthetic gene cluster that was predicted by the bioinformatic tool KEGG BlastKoala. Comparative genomics led to the identification of a new membrane di-iron oxygenase-like enzyme, annotated as Vspart_02107, which is likely to be involved in the biosynthesis of cycloprodigiosin and analogues. The combined genomics-metabolomics profiling of the strain led to the isolation and identification of one new branched-chain prodigiosin (5) and to the detection of two new cyclic forms. Furthermore, the evaluation of the minimum inhibitory concentrations disclosed the major prodigiosin as very effective against multi-drug-resistant pathogens including Stenotrophomonas maltophilia, a clinical isolate of Listeria monocytogenes, as well as some human pathogens reported by the World Health Organization as prioritized targets.

Crellastatin A, a PARP-1 Inhibitor Discovered by Complementary Proteomic Approaches.

Crellastatin A, a cytotoxic sulfated bis-steroid isolated from the Vanuatu Island marine sponge Crella sp., was selected as an interesting probe for a comprehensive proteomic analysis directed at the characterization of its protein interactors. Given its peculiar structural features, A was submitted to a mass spectrometry-based drug affinity responsive target stability (DARTS) assay combined with (targeted-limited proteolysis-multiple reaction monitoring (t-LiP MRM), rather than a classical affinity purification strategy. Poly-ADP-ribose-polymerase-1 (PARP-1) emerged as the main crellastatin A cellular partner. This result was confirmed by both biochemical and in silico analyses. Further in vitro biological assays highlighted an interesting crellastatin A inhibitory activity on PARP-1.

Wound healing activity and phytochemical screening of purified fractions of Sempervivum tectorum L. leaves on HCT 116.

INTRODUCTION: Sempervivum tectorum L. (Crassulaceae), is a succulent perennial plant widespread in Mediterranean countries and commonly used in traditional medicine for ear inflammation, ulcers and skin rashes as a refrigerant and astringent. OBJECTIVE: To demonstrate the therapeutic effects of the plant, various fractions were purified and characterised. The potential wound healing activity, proliferation rate and intracellular signalling cascades were investigated by using human epithelial colorectal carcinoma (HCT 116) cells. METHODOLOGY: An extraction method without organic solvents was applied for the first time. The purification was carried out by droplet counter current chromatography (DCCC) coupled with high-performance liquid chromatography (HPLC) and electrospray ionisation mass spectrometry (ESI-MS) data. By nuclear magnetic resonance (NMR) [1 H, 13 C and two-dimensional (2D) experiments] pure components were identified. Wound healing and cell proliferation assays were utilised to determine the role of the isolated S. tectorum (SVT) fraction on cellular migration and proliferation. The signalling pathways elicited from the SVT fractions, were analysed by Western blot analysis. RESULTS: In this study two rare natural components were identified, namely monosaccharide sedoheptulose and polyalcohol 2-C-methyl-D-erythritol, along with known organic acids and flavonoids. The fractions with high level of sedoheptulose enhance the proliferation and the cellular migration of epithelial HCT 116 cells. The intracellular signalling cascades elicited from the purified fractions induce the c-Src-mediated transactivation of EGFR and the activation of the STAT3 pathway which, in turn, are crucially involved in the cellular proliferation and migration. CONCLUSIONS: Our study demonstrates the efficacy of purified fractions of S. tectorum L. in enhancing cellular proliferation and migration, suggesting their potential role as topical therapeutic treatments for wound healing.

Chemistry and Pharmacology of GPBAR1 and FXR Selective Agonists, Dual Agonists, and Antagonists.

In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic syndrome, inflammatory states, nonalcoholic steatohepatitis (NASH), and diabetes.Consequently, the development of dual FXR/GPBAR1 agonists, as well as selective targeting of one of these receptors, is considered a hopeful possibility in the treatment of these disorders. Because endogenous bile acids and steroidal ligands, which cover the same chemical space of bile acids, often target both receptor families, speculation on nonsteroidal ligands represents a promising and innovative strategy to selectively target GPBAR1 or FXR.In this review, we summarize the most recent acquisition on natural, semisynthetic, and synthetic steroidal and nonsteroidal ligands, able to interact with FXR and GPBAR1.

Phytochemical and Biological Studies of Nepeta asterotricha Rech. f. (Lamiaceae): Isolation of Nepetamoside.

The n-butanolic extract, from an Iranian specimen of Nepeta asterotricha Rech. f. (NABE), displayed anti-inflammatory effects on lipopolysaccharide (LPS)-stimulated J774A.1 macrophages, which reduced nitrites and cytokines production. Bioassay guided fractionation of the extract led to the isolation of four iridoid glycosides, including a new one known as nepetamoside (1), one hexenyl-diglycoside, and some polyphenol and flavonoid components. None of the isolated iridoid components displayed significant effects on nitrites formation in an in vitro LPS-induced model of inflammation, thus suggesting that the plant anti-inflammatory effect is probably due to a synergistic action among its constituents.

Investigation around the Oxadiazole Core in the Discovery of a New Chemotype of Potent and Selective FXR Antagonists.

Recent findings have shown that Farnesoid X Receptor (FXR) antagonists might be useful in the treatment of cholestasis and related metabolic disorders. In this paper, we report the discovery of a new chemotype of FXR antagonists featured by a 3,5-disubstituted oxadiazole core. In total, 35 new derivatives were designed and synthesized, and notably, compounds 3f and 13, containing a piperidine ring, displayed the best antagonistic activity against FXR with promising cellular potency (IC50 = 0.58 ± 0.27 and 0.127 ± 0.02 µM, respectively). The excellent pharmacokinetic properties make compound 3f the most promising lead identified in this study.

Discovery of ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl)ureidyl derivatives as selective non-steroidal agonists of the G-protein coupled bile acid receptor-1.

The G-protein bile acid receptor 1 (GPBAR1) has emerged in the last decade as prominent target for the treatment of metabolic and inflammatory diseases including type 2 diabetes, obesity, and non-alcoholic steatohepatitis. To date numerous bile acid derivatives have been identified as GPBAR1 agonists, however their clinical application is hampered by the lack of selectivity toward the other bile acid receptors. Therefore, non-steroidal GPBAR1 ligands able to selectively activate the receptor are urgently needed. With this aim, we here designed, synthesized and biologically evaluated ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl) urea derivatives as novel potent GPBAR1 agonists. Particularly, compounds 9 and 10 induce the mRNA expression of the GPBAR1 target gene pro-glucagon and show high selectivity over the other bile acid receptors FXR, LXRα, LXRß and PXR, and the related receptors PPARα and PPARγ. Computational studies elucidated the binding mode of 10 to GPBAR1, providing important structural insights for the design of non-steroidal GPBAR1 agonists. The pharmacokinetic properties of 9 and 10 suggest that the ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl)ureydil scaffold might be exploited to achieve effective drug candidates to treat GPBAR1 related disorders.

Identification of a Sorbicillinoid-Producing Aspergillus Strain with Antimicrobial Activity Against Staphylococcus aureus: a New Polyextremophilic Marine Fungus from Barents Sea.

The exploration of poorly studied areas of Earth can highly increase the possibility to discover novel bioactive compounds. In this study, the cultivable fraction of fungi and bacteria from Barents Sea sediments has been studied to mine new bioactive molecules with antibacterial activity against a panel of human pathogens. We isolated diverse strains of psychrophilic and halophilic bacteria and fungi from a collection of nine samples from sea sediment. Following a full bioassay-guided approach, we isolated a new promising polyextremophilic marine fungus strain 8Na, identified as Aspergillus protuberus MUT 3638, possessing the potential to produce antimicrobial agents. This fungus, isolated from cold seawater, was able to grow in a wide range of salinity, pH and temperatures. The growth conditions were optimised and scaled to fermentation, and its produced extract was subjected to chemical analysis. The active component was identified as bisvertinolone, a member of sorbicillonoid family that was found to display significant activity against Staphylococcus aureus with a minimum inhibitory concentration (MIC) of 30 µg/mL.

Discovering the Biological Target of 5-epi-Sinuleptolide Using a Combination of Proteomic Approaches.

Sinuleptolide and its congeners are diterpenes with a norcembranoid skeleton isolated from the soft coral genus Sinularia. These marine metabolites are endowed with relevant biological activities, mainly associated with cancer development. 5-epi-sinuleptolide has been selected as a candidate for target discovery studies through the application of complementary proteomic approaches. Specifically, a combination of conventional chemical proteomics based on affinity chromatography, coupled with high-resolution mass spectrometry and bioinformatics, as well as drug affinity responsive target stability (DARTS), led to a clear identification of actins as main targets for 5-epi-sinuleptolide. Subsequent in-cell assays, performed with cytochalasin D as reference compound, gave information on the ability of 5-epi-sinuleptolide to disrupt the actin cytoskeleton by loss of actin fibers and formation of F-actin amorphous aggregates. These results suggest the potential application of 5-epi-sinuleptolide as a useful tool in the study of the molecular processes impaired in several disorders in which actin is thought to play an essential role.

Targeting Bile Acid Receptors: Discovery of a Potent and Selective Farnesoid X Receptor Agonist as a New Lead in the Pharmacological Approach to Liver Diseases.

Bile acid (BA) receptors represent well-defined targets for the development of novel therapeutic approaches to metabolic and inflammatory diseases. In the present study, we report the generation of novel C-3 modified 6-ethylcholane derivatives. The pharmacological characterization and molecular docking studies for the structure-activity rationalization, allowed the identification of 3ß-azido-6α-ethyl-7α-hydroxy-5ß-cholan-24-oic acid (compound 2), a potent and selective FXR agonist with a nanomolar potency in transactivation assay and high efficacy in the recruitment of SRC-1 co-activator peptide in Alfa Screen assay. In vitro, compound 2 was completely inactive towards common off-targets such as the nuclear receptors PPARα, PPARγ, LXRα, and LXRß and the membrane G-coupled BA receptor, GPBAR1. This compound when administered in vivo exerts a robust FXR agonistic activity increasing the liver expression of FXR-target genes including SHP, BSEP, OSTα, and FGF21, while represses the expression of CYP7A1 gene that is negatively regulated by FXR. Collectively these effects result in a significant reshaping of BA pool in mouse. In summary, compound 2 represents a promising candidate for drug development in liver and metabolic disorders.

Determination of Gymnemic Acid I as a Protein Biosynthesis Inhibitor Using Chemical Proteomics.

The plant Gymnema sylvestre has been used widely in traditional medicine as a remedy for several diseases, and its leaf extract is known to contain a group of bioactive triterpene saponins belonging to the gymnemic acid class. Gymnemic acid I (1) is one of the main components among this group of secondary metabolites and is endowed with an interesting bioactivity profile. Since there is a lack of information about its specific biological targets, the full interactome of 1 was investigated through a quantitative chemical proteomic approach, based on stable-isotope dimethyl labeling. The ribosome complex was found to be the main partner of compound 1, and a full validation of the proteomics results was achieved by orthogonal approaches. Further biochemical and biological investigations revealed an inhibitory effect of 1 on the ribosome machinery.