[Exploring the therapeutic mechanism of Liuwei Suanzao decoction for perimenopausal insomnia based on network pharmacology and animal experiments].

OBJECTIVE: To explore the therapeutic mechanism of Liuwei Suanzao decoction (LWSZD) for perimenopausal insomnia (PI) based on network pharmacology. METHODS: TCMSP and Batman-TCM databases were searched for the active ingredients and targets of LWSZD and a herb-active ingredient-target network was constructed, and the disease targets were obtained from the OMIM, Genecards and Gene databases.The common targets were imported into STRING database and Cytoscape software to screen the core therapeutic targets, and GO enrichment and KEGG pathway analyses were performed using DAVID database.Molecular docking of the main active ingredients of LWSZD and the core targets was conducted using AutoDock, and the results were verified by observing the therapeutic effects of LWSZD and zolpidem in a rat model of PI induced by bilateral ovariectomy and intraperitoneal p-chlorophenylalanine injection. RESULTS: A total of 99 active ingredients, 389 drug targets, 187 PI-related targets, and 15 drug-PI common targets were screened.The core active ingredients were armepavine, sanjoinenine and mairin, and the core targets included ESR1, SIRT1, SERPINE1, COMT and CCL2, which were involved in the positive regulation of transcription from RNA polymerase II promoter, signal transduction, response to drug and positive regulation of transcription and in the pathways of dopaminergic synapses, tyrosine metabolism and tryptophan metabolism.Molecular docking results showed that LWSZD had a strong binding with ESR1, SIRT1 and SERPINE1 and was comparable to zolpidem.In the rat models of PI, treatment with LWSZD effectively alleviated the symptoms of insomnia (P<0.01), improved the levels of estrogen and other HPO axis-related hormones (P<0.05), and promoted the mRNA and protein expressions of ESR1 and SIRT1 in the hypothalamus tissues (P<0.01). CONCLUSION: The active ingredients armepavine, sanjoinenine and mairin in LWSZD may synergistically regulate the expressions of ESR1, SIRT1 and SERPINE1 to improve PI in rats.

MiRNA-488-3p inhibits malignant progression of NSCLC by modulating ADAM9.

Since this article has been suspected of research misconduct and the corresponding authors did not respond to our request to prove originality of data and figures, "MiRNA-488-3p inhibits malignant progression of NSCLC by modulating ADAM9, by Y. Wu, Y. Wu, X.-Y. Chen, Y.-X. Niu, F.-Z. Lv, W. Gao, published in Eur Rev Med Pharmacol Sci 2020; 24 (17): 8893-8901-DOI: 10.26355/eurrev_202009_22830-PMID: 32964979" has been withdrawn. The Publisher apologizes for any inconvenience this may cause. https://www.europeanreview.org/article/22830.

Sex-specific associations of serum insulin-like growth factor-1 with bone density and risk of fractures in Chinese patients with type 2 diabetes.

We evaluated the associations of serum insulin-like growth factor-1 (IGF-1) with bone mineral density (BMD) and risk of fractures in Chinese patients with type 2 diabetes (T2D). We found positive associations between IGF-I and BMD and negative associations between IGF-I and all three modified 10-year probabilities of MOFs and HFs in men, but not in women. INTRODUCTION: The objective was to investigate the associations of serum insulin-like growth factor-1 (IGF-1) with bone mineral density (BMD) and risk of fractures in Chinese patients with type 2 diabetes (T2D) in each gender. METHODS: This was a cross-sectional, retrospective study that included men over 50 years and postmenopausal women with T2D without medical conditions or medications known to significantly affect BMD or serum IGF-I levels. Data of IGF-1, bone metabolism markers, lumbar spine (LS), femoral neck (FN), and total hip (TH) BMD were obtained; 10-year probability of major osteoporotic fractures (MOFs) and hip fractures (HFs) was calculated and modified with rheumatoid arthritis, femoral neck T-score, and age. Correlations of IGF-1 levels with bone metabolism and risk of fractures were statistically analyzed in men and women, respectively. RESULTS: A total of 391 patients, including 226 men and 165 women, were included. The age, serum fasting C-peptide, glycosylated hemoglobin (HbA1c), bone formation marker, and all three modified 10-year probabilities of MOFs and HFs were higher in women than those in men (all p < 0.05). The levels of 25 hydroxyvitamin D (25OHD), IGF-1, and BMD were lower in women than those in men (all p < 0.05). In men, IGF-1 was positively correlated with FN and TH BMD (FN BMD: r = 0.267, p < 0.001; TH BMD: r = 0.235, p < 0.001) and negatively correlated with all three modified 10-year probabilities of MOFs (RA-modified MOFs: r = - 0.289, p < 0.001; age-modified MOFs: r = - 0.237, p < 0.001; FN T-score-modified MOFs: r = - 0.280, p < 0.001) and HFs (RA-modified HFs: r = - 0.291, p < 0.001; age-modified HFs: r = - 0.271, p < 0.001; FN T-score-modified HFs: r = - 0.270, p < 0.001), while no significant correlations were found between serum IGF-I and BMD and three modified 10-year probability in women. CONCLUSIONS: According to this study, we found sex differences in the associations of serum IGF-1 with BMD and risk of fractures in Chinese patients with T2D. These results suggested that increasing serum IGF-1 might be a clinical target for protecting fractures in T2D, especially in men.

Effects of probiotic and Bidens pilosa on the performance and gut health of chicken during induced Eimeria tenella infection.

AIM: In this study, we have examined the individual and combined protective mechanism of probiotic and Bidens pilosa on the performance and gut health of chickens during Eimeria tenella infection over a 29-day experimental trial. METHODS AND RESULTS: A total of one hundred and fifty 1-day-old chickens were equally distributed into five treatment groups with three biological replicates: two groups were allocated as control groups (control group untreated unchallenged, CG and control positive untreated challenged, CPG) and three groups were fed diets with probiotic (PG), B. pilosa (BPG) and probiotic + B. pilosa (PG + BPG) and challenged with E. tenella. Birds of all groups were assessed for pre and post-infection body weights, oocysts shedding, caecal lesion scores and mRNA expression levels of apoptosis related proteins (Bcl-2, Bax and caspase-3), antioxidant enzymes (CAT and SOD 1), pro-inflammatory cytokines (IL-6 and IL-8) and tight junction proteins (CLDN 1 and ZO 1). Our results revealed that during infection (day 21-29), E. tenella challenged chickens significantly decreased the body weight compared with uninfected control chickens; however, there was no significant effect on body weight of chickens fed with probiotic, B. pilosa and probiotic + B. pilosa was observed. Eimeria tenella challenged untreated birds increased (P < 0·05) oocysts shedding, destructive ratio of caeca and mortality as compared to treated challenged birds. CPG group up-regulated the mRNA expression levels of anti-apoptosis protein Bcl-2 while down-regulated the pro-apoptosis protein Bax relative to PG, BPG and PG + BPG groups. Moreover chickens fed probiotic, B. pilosa and probiotic + B. pilosa diets enhanced the activities of antioxidant enzymes, pro-inflammatory cytokines and tight junction proteins with the comparison of control positive untreated challenged chickens. CONCLUSION: These findings elaborated that feed supplementation of probiotic and B. pilosa (individually or in combination) appeared to be effective in inhibiting the occurrence of disease and decreasing the severity of Eimeria infection in chickens. SIGNIFICANCE AND IMPACT OF THE STUDY: This study explained the underlying anti-coccidial mechanism in which probiotic and B. pilosa (individually and/or in combination) improve the performance of chicken and protect against gut inflammatory responses caused by E. tenella.

MiRNA-488-3p inhibits malignant progression of NSCLC by modulating ADAM9.

OBJECTIVE: The purpose of this study was to investigate the role of microRNA-488-3p in the proliferation, invasion and migration of lung cancer cells and to further explore the potential regulatory mechanisms. PATIENTS AND METHODS: MicroRNA-488-3p expression in 46 pairs of tumor tissue and paracancerous tissue specimens collected from non-small cell lung cancer (NSCLC) patients were measured through quantitative real-time polymerase chain reaction (qRT-PCR) method, and the interplay between microRNA-488-3p expression and some clinical indicators of these subjects was also analyzed. In addition, microRNA-488-3p overexpression models were constructed in NSCLC cell lines, and then Cell Counting Kit-8 (CCK-8) test and transwell assays were carried out to evaluate the effect of microRNA-488-3p on the NSCLC cell functions. Furthermore, bioinformatics analysis and luciferase reporter gene assay were carried out to uncover the potential interaction between microRNA-488-3p and its downstream gene ADAM9. RESULTS: QPCR results revealed that microRNA-488-3p showed a significant lower expression in NSCLC tissue samples than in adjacent normal ones. In comparison to patients with high expression of microRNA-488-3, patients with low expression of microRNA-488-3 exhibited higher incidence of lymph node or distant metastasis and lower survival rate. In vitro cell experiments showed that, in comparison to control group, overexpression of microRNA-488-3p significantly weakened the proliferation ability as well as the invasion and migration of NSCLC cells. Subsequently, a significant increase in ADAM9 expression in NSCLC tissue samples was found, which indicated its negative correlation with microRNA-488-3p. In addition, cell recovery experiment demonstrated that overexpression of ADAM9 could counteract the impact of microRNA-488-3p upregulation on the proliferation and invasion ability of NSCLC cells, and the two may thus together affect the malignant progression of NSCLC. CONCLUSIONS: It can be concluded that microRNA-488-3p, which is associated with the incidence of metastasis in NSCLC patients, can inhibit the malignant progression of NSCLC cells by modulating ADAM9 expression.

[Analysis of quantitative changes of γδT cells in the peripheral blood of patients with chronic brucellosis].

Objective: To investigate the quantitative changes of γδT cells in peripheral blood before and after anti-Brucella treatment in patients with chronic brucellosis. Methods: A prospective design was used to 88 patients with chronic brucellosis who were admitted to the Second People's Hospital of Tianjin from September 2012 to April 2018. The patients took anti-brucella drugs, And the changes in the number of γδT cell, CD3(+), CD4(+), CD8(+)T lymphocytes and CD4/8 in peripheral blood before treatment, 6 weeks and 12 weeks after treatment were analyzed. Thirty volunteers were selected as the healthy control group from Tianjin Second People's Hospital employee health checkup in 2014. Results: After 6 weeks antibacterial therapy, the counts of CD3(+), CD4(+) and CD8(+)T lymphocytes were significantly lower than before treatment in patients with chronic brucellosis (P<0.05) . After 12 weeks antibacterial therapy, the counts of γδT cell, CD3(+), CD4(+) and CD8(+)T lymphocytes were significantly lower than before treatment (P<0.05) , but CD4/8 was higher than before treatment in patients with chronic brucellosis (P<0.05) . Compared with healthy control group, after 6 weeks antibacterial treatment, the γδT cell count was still significantly higher, but the CD4(+)T lymphocyte count was lower (P<0.05) . After 12 weeks treatment, the γδT cell count was still significantly higher than that of the healthy control group (P<0.01) . Conclusion: γδ T cells, CD4(+), CD8(+) and CD3(+)T lymphocytes may play a role in human body resistance to chronic Brucella infection.

MRI can be used to differentiate between primary fallopian tube carcinoma and epithelial ovarian cancer.

AIM: To investigate typical features of primary fallopian tube carcinoma (PFTC) on magnetic resonance imaging (MRI) to differentiate it from epithelial ovarian cancer (EOC). MATERIALS AND METHODS: Twenty-one patients with PFTC and 35 patients with EOC were included. The clinical and pathological features of patients were analysed. The following MRI features were compared: maximal diameter, laterality, configuration, shape, signal intensity, enhancement pattern, hydrosalpinx, intrauterine fluid accumulation, rim enhancement, and apparent diffusion coefficient (ADC) values within the solid components of tumours in PFTC and EOC. RESULTS: The maximal diameter of PFTC was 4.50±2.10 cm. The shapes of PFTC were mural papillary nodules (2/21, 10%), sausage-like (8/21, 38%), nodular (3/21, 14%), or irregular (8/21, 38%). Enhancement was mild (10/21, 48%), moderate (8/21, 38%), or marked (3/21, 14%). Associated hydrosalpinx and intrauterine fluid accumulation were observed in six (29%) and three (10%) cases, respectively. Significant differences between PFTC and EOC were found in the International Federation of Gynecology and Obstetrics (FIGO) stage, maximal diameter, shape, enhancement pattern, hydrosalpinx, and intrauterine fluid accumulation (p=0.002, 0.004<0.001, <0.001, and 0.048, respectively). Rim enhancement was more prevalent, thicker, and exhibited higher continuity in PFTC than in EOC (p=0.002, <0.001, and 0.002, respectively). CONCLUSIONS: Rim enhancement is a useful feature in distinguishing PFTC from EOC, particularly when continuous or seen in combination with a sausage-like shape, hydrosalpinx or intrauterine fluid accumulation. When the tumour is associated with other MRI signs, for example, (i) hydrosalpinx with mural papillary nodules or sausage-like shape with mild-to-moderate enhancement of solid components, (ii) hydrosalpinx, or (iii) intrauterine fluid accumulation, the diagnosis of PFTC should be considered.

Relationships of Sex Hormone Levels with Activity of Daily Living in Chinese Female Centenarians.

BACKGROUND: Activity of daily living declines in female elderly, which not only increases hospitalization and mortality rates, but also aggravates individual and societal burden. Large samples are needed to elucidate the relationships of plasma sex hormone levels with activity of daily living in Chinese female centenarians to better understand the effects of hormone-replacing therapy. OBJECTIVE: As the first time in the world, the current study was designed to investigate the relationships of plasma sex hormone levels with activity of daily living in Chinese female centenarians. PARTICIPANTS: China Hainan Centenarian Cohort Study was carried out in 18 cities and counties of Hainan Province. MAIN MEASURES: Home interview, physical examination and blood analysis were carried out in 583 female centenarians following standard procedures. Barthel Index was used to assess the activity of daily living. KEY RESULTS: Median age of all female centenarians was 102 years, with the range from 100 to 115 years. Median values of Barthel Index were 85(60-90). In multivariate linear regression analyses, Barthel Index values were inversely associated with plasma luteinizing hormone (LH), follicle-simulating hormone (FSH), testosterone, progesterone and estradiol levels (P<0.05 for all). CONCLUSION: Plasma sex hormone levels, including LH, FSH, testosterone, progesterone and estradiol, had significant relationships with activity of daily living in Chinese female centenarians.

Characterization of three regulatory genes involved in enduracidin biosynthesis and improvement of enduracidin production in Streptomyces fungicidicus.

AIMS: To increase enduracidin production in Streptomyces fungicidicus ATCC 31731 by overexpressing positive regulators in enduracidin biosynthesis. METHODS AND RESULTS: Genes orf22 and orf42 were knocked out by in-frame deletion based on CRISPR/Cas9 strategy, while the orf41 gene was inactivated by replacing it with the apramycin resistance gene cassette aac(3)IV using a fast screening blue/white system. The integrative plasmid pSET152ermE was used for the overexpression of orf22, orf41 and orf42 individually. The constructed plasmids were transformed into wild-type strain Streptomyces fungicidicus ATCC 31731. Three gene inactivation mutants Δorf22, Δorf41 and Δorf42 and three recombinant strains overexpressing orf22, orf41 and orf42 were all fermented and the enduracidin production of each strain was detected and compared by HPLC analysis. Two resulting engineered strains were generated through overexpression of gene orf22 and orf42 in Streptomyces fungicidicus, respectively, and in these strains the enduracidins titres were increased by approximately 4·0-fold and 2·3-fold higher than that of the wild-type strain. CONCLUSIONS: The functions of three regulatory genes orf22, orf41 and orf42 in the enduracidin gene cluster in Streptomyces fungicidicus ATCC 31731 were examined. The orf22 gene, encoding a SARP family protein, was proposed to act in a positive manner. The proteins encoded by genes orf41 and orf42 were proposed to compose a two-component regulation system, in which the response protein Orf41 was characterized as a repressor, and the kinase Orf42 was shown to be an activator. The production of enduracidins was improved considerably by overexpression of the two positive regulatory genes orf22 and orf42 respectively. SIGNIFICANCE AND IMPACT OF THE STUDY: The production of enduracidins was successfully improved by manipulating the regulatory genes involving in enduracidin biosynthesis, providing an efficient approach to improve enduracidin production further for fermentation industry and synthetic biological research.

Serum Homocysteine Levels Had Important Associations with Activity and Quality of Daily Living in Chinese Centenarians.

BACKGROUND: Population aging is an important problem worldwide, with activity and quality of daily living commonly reduced in elderly people. leading to increased hospitalization and mortality rates, and substantial individual and social burdens. OBJECTIVE: This study was designed to investigate the associations of serum homocysteine levels with activity and quality of daily living in Chinese centenarians for the first time. PARTICIPANTS: The China Hainan Centenarian Cohort Study was performed in 18 cities and counties of Hainan Province. MAIN MEASURES: Home interview, physical examination and blood analysis were performed in 787 centenarians following standard procedures. KEY RESULTS: The median age was 102 years, ranging between 100 and 115 years. There were 634 females (80.6%) and 153 males (19.4%) in all. The median level of serum homocysteine was 23.80 (18.80-29.90) umol/L, whereas median values of Barthel Index and EuroQol 5 Dimensions were 85(60-95) and 0.661(0.558-0.766), respectively. The centenarians with serum homocysteine levels ≥23.8µmol/L were more likely to had lower values of Barthel Index and EuroQol 5 Dimensions than those with serum homocysteine levels <23.8µmol/L (P<0.05 for all). In multivariate linear regression analyses, serum homocysteine levels were significantly associated with Barthel Index and EuroQol 5 Dimensions (P<0.05 for all). CONCLUSIONS: Serum homocysteine levels had important associations with activity and quality of daily living in Chinese centenarians. Future research should focus on the value of intervening in serum homocysteine levels by supplying folic acid (vitamin B9) and vitamin B12 on improving activity and quality of daily living in elderly people.

Health-related quality of life in children with osteogenesis imperfecta: a large-sample study.

In this large-sample study, we demonstrated that osteogenesis imperfecta (OI) significantly impaired the quality of life (QoL) in children. Moderate/severe OI patients had worse QoL scores than patients with mild OI. Furthermore, the QoL for OI patients was correlated with the presence of pathogenic gene mutations. INTRODUCTION: Osteogenesis imperfecta (OI) is a hereditary disease characterized by multiple fragility fractures and progressive skeletal deformities. No detailed investigations about the quality of life (QoL) have been carried out in a large sample of patients with OI. We evaluated the QoL and its influencing factors in a large and well-characterized OI cohort. METHODS: We used a validated questionnaire of PedsQL 4.0 to evaluate the health-related quality of life (HRQoL) of children and adolescents with OI. We compared HRQoL among patients with OI types I, III, and IV. The relationship between HRQoL and pathogenic mutations in candidate OI genes was investigated. We also evaluated the influencing factors of HRQoL in OI patients. RESULTS: A total of 138 children with OI and 138 healthy controls were enrolled in this study. The HRQoL scores of OI patients were 64.4 ± 30.0, 71.9 ± 22.2, 75.7 ± 24.8, 63.7 ± 24.5, and 68.9 ± 22.0 in physical, emotional, social, school functioning, and total score, respectively, which were significantly lower than those of healthy children (86.5 ± 12.7, 83.3 ± 16.0, 92.1 ± 11.8, 87.5 ± 11.8, and 87.3 ± 10.7, all p < 0.01). Moderate and severe OI (type III/IV) patients had poorer HRQoL scores than patients with mild OI (type I). Gene mutations inducing qualitative defects in type I collagen led to worse HRQoL scores than those with quantitative defects in type I collagen, except in emotional functioning. The total HRQoL score was positively correlated with family income, lumbar, and femoral bone mineral density (BMD) Z-scores and negatively correlated with disease severity and fracture frequency. CONCLUSION: HRQoL was significantly impaired in OI patients, and patients with more severe OI had poorer HRQoL scores. For the first time, we found that children with qualitative defects in type I collagen had poorer HRQoL scores than those with quantitative defects in type I collagen.

Effects of HIF-1α on diabetic retinopathy angiogenesis and VEGF expression.

OBJECTIVE: To investigate the effect of hypoxia inducing factor (HIF)-1α on the expression of vascular endothelial growth factor (VEGF) and angiogenesis in diabetic retinopathy. PATIENTS AND METHODS: 8-week healthy SD rats were used for the experiments. Under systemic anesthesia condition, control rats received a saline injection into the left ocular body (control A group), and 2 µl antisense oligonucleotides (ASODN) (10 µmol/L) into right eye (control B group). Model rats received a saline injection into the left eye (model A group), and 2 µl ASODN (10 µmol/L) into the right eye (model B group). Rats received an intraocular injection of HIF-1α ASODN for 2, 4, and 6 weeks (A1, A2, A3, B1, B2, B3, respectively). Retinal vessel development was observed by ADP staining. Vascular endothelial cells penetrating retinal inner membrane were counted. Immunohistochemistry was used to detect expressions of VEGF and HIF-1α proteins in the retina. RESULTS: Prominent angiogenesis and hyperplasia were found in model A group. Relatively fewer newly formed vessels were shown in model group B. However, no significant change of retinal vascular morphology was presented in control group. Of note, the vascular endothelial cell counts, VEGF and HIF-1α contents were significantly increased in model group (p < 0.05). After treatment with HIF-1α ASODN, lower endothelial cell counts was found in model B group (p < 0.05 comparing to model A). VEGF expression in model B group was significantly decreased, among which, model B3 was observed with lower cell counts than model B1 or B2 (p < 0.05 comparing to model A). Injection of HIF-1α ASODN significantly suppressed HIF-1α level in model B in a time-dependent manner. CONCLUSIONS: Retinal angiogenesis is closely related with increasing level of HIF-1α. Inhibition of HIF-1α suppressed VEGF expression and deterred angiogenesis in a time-dependent manner. This provided novel insights for treating diabetic retinopathy.

[Photochemical induced vestibular ischemiawith icy water test in guinea pigs].

Objective:To ascertain the effects of a new method of photochemical reaction in vestibular function in guinea pigs.Method:Local photochemical reaction was initiated by systemic injection of rose bengal(20mg), photoillumination of the vestibule through medial wall of epitympanum for 30 minutes was started immediately after the injection of rose bengal, with a optic fiber connected to a xenon light (wavelength, 540nm; photointense, 500-600 mW/cm ²). There were 20 guinea pigs divided random equally into 2 groups. Group 1 was injected with rose bengal. Group 2 was control, injected with physiological saline solution. The ice caloric tests were performed on the second day.Result:The test group (7 ears) and the control group (6 ears) with test nystagmus showed mean frequencies were（2.0±0.33）times/s and（3.7±0.33）times/s,the mean amplitude were (3.1±0.39)mm and (3.5±0.54)mm,and the mean duration were (44.7±17.22)s and (62.0±7.22)s respectively.The nystagmus frequency difference was statistically significant, but the amplitude and the duration of the nystagmus were not significantly different. There was no obvious spontaneous nystagmus in the two groups, and there were negative results of ice water test (3 ears in the test group and 4 ears in the control group).Conclusion:Photochemical reaction can induce the ischemic state of the vestibule system in guinea pig, and produce an acute vestibular dysfunction, and ice water test shows that the frequency of nystagmus is reduced.

Novel compound heterozygous mutations in SERPINH1 cause rare autosomal recessive osteogenesis imperfecta type X.

We identified novel compound heterozygous mutations in SERPINH1 in a Chinese boy suffering from recurrent fractures, femoral deformities, and growth retardation, which resulted in extremely rare autosomal recessive OI type X. Long-term treatment of BPs was effective in increasing BMD Z-score, reducing fracture incidence and reshaping vertebrae compression. INTRODUCTION: Osteogenesis imperfecta (OI) is a heritable bone disorder characterized by low bone mineral density, recurrent fractures, and progressive bone deformities. Mutation in serpin peptidase inhibitor clade H, member 1 (SERPINH1), which encodes heat shock protein 47 (HSP47), leads to rare autosomal recessive OI type X. We aimed to detect the phenotype and the pathogenic mutation of OI type X in a boy from a non-consanguineous Chinese family. METHODS: We investigated the pathogenic mutations and analyzed their relationship with the phenotype in the patient using next-generation sequencing (NGS) and Sanger sequencing. Moreover, the efficacy of long-term bisphosphonate treatment in this patient was evaluated. RESULTS: The patient suffered from multiple fractures, low bone mass, and bone deformities in the femur, without dentinogenesis imperfecta or hearing loss. Compound heterozygous variants were found in SERPINH1 as follows: c.149 T>G in exon 2 and c.1214G>A in exon 5. His parents were heterozygous carriers of each of these mutations, respectively. Bisphosphonates could be helpful in increasing BMD Z-score, reducing bone fracture risk and reshaping the compressed vertebral bodies of this patient. CONCLUSION: We reported novel compound heterozygous mutations in SERPINH1 in a Chinese OI patient for the first time, which expanded the spectrum of phenotype and genotype of extremely rare OI type X.

Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing.

In Table 2:Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

Down-regulation of single-stranded DNA-binding protein 1 expression induced by HCMV infection promotes lipid accumulation in cells.

The objective of this study was to observe the infection of human cytomegalovirus (HCMV) to human umbilical vein endothelial cells, and its effect on the expression of single-stranded DNA-binding protein (SSBP1) and on lipid metabolism in endothelial cells. We screened the differential expression of mRNAs after HCMV infection by suppression subtractive hybridization and the expression levels of SSBP1 mRNA and protein after HCMV infection by real-time PCR and western blot. After verification of successful infection by indirect immunofluorescent staining and RT-PCR, we found a differential expression of lipid metabolism-related genes including LDLR, SCARB, CETP, HMGCR, ApoB and LPL induced by HCMV infection. The expression levels of SSBP1 mRNA and protein after HCMV infection were significantly down-regulated. Furthermore, we found that upregulation of SSBP1 inhibited the expression of atherosclerosis-associated LDLR, SCARB, HMGCR, CETP as well as the accumulation of lipids in the cells. The results showed that the inhibition of SSBP1 by HCMV infection promotes lipid accumulation in the cells.

Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing.

The achievement of more accurate diagnosis would greatly benefit the management of patients with osteogenesis imperfecta (OI). In this study, we present the largest OI sample in China as screened by next generation sequencing. In particular, we successfully identified 81 variants, which included 45 novel variants. We further did a genotype-phenotype analysis, which helps make a better understanding of OI. INTRODUCTION: This study aims to reveal the gene mutation spectrum and the genotype-phenotype relationship among Chinese OI patients by next generation sequencing (NGS). METHODS: We developed a NGS-based panel for targeted sequencing of all exons of 14 genes related to OI, and performed diagnostic gene sequencing for a cohort of 103 Chinese OI patients from 101 unrelated families. Mutations identified by NGS were further confirmed by Sanger sequencing and co-segregation analysis. RESULTS: Of the 103 patients from 101 unrelated OI families, we identified 79 mutations, including 43 novel mutations (11 frameshift, 17 missense, 5 nonsense, 9 splice site, and 1 chromosome translocation) in 90 patients (87.4%). Mutations in genes encoding type I collagen, COL1A1 (n = 37), and COL1A2 (n = 29) accounts for 73.3% of all molecularly diagnosed patients, followed by IFITM5 (n = 9, 10%), SERPINF1 (n = 4, 4.4%), WNT1 (n = 4, 4.4%), FKBP10 (n = 3, 3.3%), TMEM38B (n = 3, 3.3%), and PLOD2 (n = 1, 1.1%). This corresponds to 75 autosomal dominant inherited (AD) OI patients and 15 autosomal recessive (AR) inherited patients. Compared with AD inherited OI patients, AR inherited patients had lower bone mineral density (BMD) at spine (P = 0.05) and less frequent blue sclera (P = 0.001). Patients with type I collagen qualitative defects had lower femoral neck BMD Z-score (P = 0.034) and were shorter compared with patients with type I collagen quantitative defects (P = 0.022). CONCLUSION: We revealed the gene mutation spectrum in Chinese OI patients, and novel mutations identified here expanded the mutation catalog and genotype and phenotype relationships among OI patients.

A genome-wide association study reveals candidate genes for the supernumerary nipple phenotype in sheep (Ovis aries).

Genome-wide association studies (GWASs) have been widely applied in livestock to identify genes associated with traits of economic interest. Here, we conducted the first GWAS of the supernumerary nipple phenotype in Wadi sheep, a native Chinese sheep breed, based on Ovine Infinium HD SNP BeadChip genotypes in a total of 144 ewes (75 cases with four teats, including two normal and two supernumerary teats, and 69 control cases with two teats). We detected 63 significant SNPs at the chromosome-wise threshold. Additionally, one candidate region (chr1: 170.723-170.734 Mb) was identified by haplotype-based association tests, with one SNP (rs413490006) surrounding functional genes BBX and CD47 on chromosome 1 being commonly identified as significant by the two mentioned analyses. Moreover, Gene Ontology enrichment for the significant SNPs identified by the GWAS analysis was functionally clustered into the categories of receptor activity and synaptic membrane. In addition, pathway mapping revealed four promising pathways (Wnt, oxytocin, MAPK and axon guidance) involved in the development of the supernumerary nipple phenotype. Our results provide novel and important insights into the genetic mechanisms underlying the phenotype of supernumerary nipples in mammals, including humans. These findings may be useful for future breeding and genetics in sheep and other livestock.

A novel large fragment deletion in PLS3 causes rare X-linked early-onset osteoporosis and response to zoledronic acid.

We identified a novel large fragment deletion from intron 9 to 3'UTR in PLS3 (E10-E16del) in one Chinese boy with X-linked early-onset osteoporosis and vertebral fractures, which expanded the pathogenic spectrum of X-linked early-onset osteoporosis. Treatment with zoledronic acid was beneficial for increasing BMD and reshaping the vertebral bodies of this patient. INTRODUCTION: X-linked early-onset osteoporosis is a rare disease, which is characterized by low bone mineral density (BMD), vertebral compression fractures (VCFs), and/or long bone fractures. We aimed to detect the phenotype and the underlying pathogenic mutation of X-linked early-onset osteoporosis in a boy from a nonconsanguineous Chinese family. METHODS: We investigated the pathogenic mutation of the patient with X-linked early-onset osteoporosis by targeted next-generation sequencing and confirmed it by Sanger sequencing. We also observed the effects of zoledronic acid on fracture frequency and BMD of the patient. RESULTS: Low BMD and multiple VCFs were the main phenotypes of X-linked early-onset osteoporosis. We identified a total of 12,229 bp deletion in PLS3, involving intron 9 to the 3'UTR (E10-E16 del). This large fragment deletion might be mediated by Alu repeats and microhomology of 26 bp at each breakpoint junction. Zoledronic acid treatment could significantly increase the Z-score of BMD and reshape the compressed vertebral bodies. CONCLUSION: We identified a large fragment deletion mutation in PLS3 for the first time and elucidated the possible mechanism of the deletion, which led to X-linked early-onset osteoporosis and multiple vertebral fractures. Our findings would enrich the etiology spectrum of this rare disease.

The antibacterial activity and modes of LI-F type antimicrobial peptides against Bacillus cereus in vitro.

AIMS: LI-Fs are a family of highly potent cyclic lipodepsipeptide antibiotics with a broad antimicrobial spectrum (Gram-positive bacteria and fungi). In this study, LI-F-type antimicrobial peptides (AMP-jsa9) composing of LI-F03a, LI-F03b, LI-F04a, LI-F04b and LI-F05b were isolated from Paenibacillus polymyxa JSA-9. To better understand the antimicrobial mechanism of AMP-jsa9, the potency and action(s) of AMP-jsa9 against Bacillus cereus were examined. METHODS AND RESULTS: Flow cytometry, confocal laser microscopy, scanning electron microscopy, transmission electron microscopy (TEM) and atomic force microscopy observation, as well as determination of peptidoglycan and cell wall-associated protein and other methods were used. The results indicate that AMP-jsa9 exhibits strong, broad-spectrum antimicrobial activity. Moreover, AMP-jsa9 targets the cell wall and membrane of B. cereus to impair membrane integrity, increase membrane permeability and enhance cytoplasm leakage (e.g. K+ , protein, nucleic acid). This leads to bacterial cells with irregular, withered and coarse surfaces. In addition, AMP-jsa9 is also able to bind to DNA and break down B. cereus biofilms. CONCLUSIONS: In this study, the action mechanism of LI-Fs against B. cereus was clarified in details. SIGNIFICANCE AND IMPACT OF THE STUDY: The results of this study provide a theoretical basis for utilizing AMP-jsa9 or similar analogues as natural and effective preservatives in the food and feed industries. These efforts could also stimulate research activities interested in understanding the specific effects of other antimicrobial agents.