Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 9 de 9
Filtrar
Mais filtros












Base de dados
Intervalo de ano de publicação
1.
Nucleic Acids Res ; 46(12): 5886-5893, 2018 07 06.
Artigo em Inglês | MEDLINE | ID: mdl-29800233

RESUMO

Previous computational studies have shown that Cu+ can act as a substitute for H+ to support formation of cytosine (C) dimers with similar conformation to the hemi-protonated base pair found in i-motif DNA. Through a range of biophysical methods, we provide experimental evidence to support the hypothesis that Cu+ can mediate C-C base pairing in i-motif DNA and preserve i-motif structure. These effects can be reversed using a metal chelator, or exposure to ambient oxygen in the air that drives oxidation of Cu+ to Cu2+, a comparatively weak ligand. Herein, we present a dynamic and redox-sensitive system for conformational control of an i-motif forming DNA sequence in response to copper cations.


Assuntos
Cobre/química , DNA/química , Pareamento de Bases , Cátions , Citosina/química , Modelos Moleculares , Motivos de Nucleotídeos , Oxirredução
2.
Chemistry ; 24(17): 4436-4444, 2018 Mar 20.
Artigo em Inglês | MEDLINE | ID: mdl-29338100

RESUMO

Calix[4]arenes are unique macrocycles that through judicious functionalisation at the lower rim can be either fixed in one of four conformations or remain conformationally flexible. Introduction of propynyl or propenyl groups unexpectedly provides a new possibility; a unidirectional conformational switch, with the 1,3-alternate and 1,2-alternate conformers switching to the partial cone conformation, whilst the cone conformation is unchanged, under standard experimental conditions. Using 1 H NMR kinetic studies, rates of switching have been shown to be dependent on the starting conformation, upper-rim substituent, where reduction in bulk enables faster switching, solvent and temperature with 1,2-alternate conformations switching fastest. Ab initio calculations (DFT) confirmed the relative stabilities of the conformations and point towards the partial cone conformer being the most stable of the four. The potential impact on synthesis through the "click" reaction has been investigated and found not to be significant.

3.
Biochem Biophys Res Commun ; 447(1): 128-32, 2014 Apr 25.
Artigo em Inglês | MEDLINE | ID: mdl-24699415

RESUMO

The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5'-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3' using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K(+) ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.


Assuntos
Quadruplex G , Fator 2 Relacionado a NF-E2/química , Fator 2 Relacionado a NF-E2/genética , Regiões Promotoras Genéticas , Aminacrina/química , Sequência de Bases , Sítios de Ligação , Dicroísmo Circular , Ligantes , Ressonância Magnética Nuclear Biomolecular
4.
Chembiochem ; 14(16): 2160-8, 2013 Nov 04.
Artigo em Inglês | MEDLINE | ID: mdl-24115506

RESUMO

Bacillithiol (BSH) is the major low-molecular-weight (LMW) thiol in many low-G+C Gram-positive bacteria (Firmicutes). Evidence now emerging suggests that BSH functions as an important LMW thiol in redox regulation and xenobiotic detoxification, analogous to what is already known for glutathione and mycothiol in other microorganisms. The biophysical properties and cellular concentrations of such LMW thiols are important determinants of their biochemical efficiency both as biochemical nucleophiles and as redox buffers. Here, BSH has been characterised and compared with other LMW thiols in terms of its thiol pKa , redox potential and thiol-disulfide exchange reactivity. Both the thiol pKa and the standard thiol redox potential of BSH are shown to be significantly lower than those of glutathione whereas the reactivities of the two compounds in thiol-disulfide reactions are comparable. The cellular concentration of BSH in Bacillus subtilis varied over different growth phases and reached up to 5 mM, which is significantly greater than previously observed from single measurements taken during mid-exponential growth. These results demonstrate that the biophysical characteristics of BSH are distinctively different from those of GSH and that its cellular concentrations can reach levels much higher than previously reported.


Assuntos
Bacillus subtilis/química , Cisteína/análogos & derivados , Glucosamina/análogos & derivados , Aminas/química , Bacillus subtilis/metabolismo , Ácidos Carboxílicos/química , Cisteína/química , Glucosamina/química , Glutationa/química , Cinética , Oxirredução , Compostos de Sulfidrila/química
5.
Proc Natl Acad Sci U S A ; 107(22): 10080-5, 2010 Jun 01.
Artigo em Inglês | MEDLINE | ID: mdl-20479265

RESUMO

High-affinity, high-selectivity protein-protein interactions that are critical for cell survival present an evolutionary paradox: How does selectivity evolve when acquired mutations risk a lethal loss of high-affinity binding? A detailed understanding of selectivity in such complexes requires structural information on weak, noncognate complexes which can be difficult to obtain due to their transient and dynamic nature. Using NMR-based docking as a guide, we deployed a disulfide-trapping strategy on a noncognate complex between the colicin E9 endonuclease (E9 DNase) and immunity protein 2 (Im2), which is seven orders of magnitude weaker binding than the cognate femtomolar E9 DNase-Im9 interaction. The 1.77 A crystal structure of the E9 DNase-Im2 complex reveals an entirely noncovalent interface where the intersubunit disulfide merely supports the crystal lattice. In combination with computational alanine scanning of interfacial residues, the structure reveals that the driving force for binding is so strong that a severely unfavorable specificity contact is tolerated at the interface and as a result the complex becomes weakened through "frustration." As well as rationalizing past mutational and thermodynamic data, comparing our noncognate structure with previous cognate complexes highlights the importance of loop regions in developing selectivity and accentuates the multiple roles of buried water molecules that stabilize, ameliorate, or aggravate interfacial contacts. The study provides direct support for dual-recognition in colicin DNase-Im protein complexes and shows that weakened noncognate complexes are primed for high-affinity binding, which can be achieved by economical mutation of a limited number of residues at the interface.


Assuntos
Domínios e Motivos de Interação entre Proteínas , Sequência de Aminoácidos , Substituição de Aminoácidos , Sítios de Ligação/genética , Colicinas/química , Colicinas/genética , Colicinas/metabolismo , Cristalografia por Raios X , Dissulfetos/química , Endodesoxirribonucleases/química , Endodesoxirribonucleases/genética , Endodesoxirribonucleases/metabolismo , Modelos Moleculares , Dados de Sequência Molecular , Complexos Multiproteicos/química , Mutagênese Sítio-Dirigida , Ressonância Magnética Nuclear Biomolecular , Proteínas Recombinantes/química , Proteínas Recombinantes/genética , Proteínas Recombinantes/metabolismo , Homologia de Sequência de Aminoácidos , Termodinâmica
6.
J Org Chem ; 70(21): 8556-9, 2005 Oct 14.
Artigo em Inglês | MEDLINE | ID: mdl-16209607

RESUMO

Described herein is the synthesis of 3-C-carboxy-5-deoxy-L-xylose (aceric acid), a rare branched-chain sugar found in the complex pectic polysaccharide rhamnogalacturonan-II. The key synthetic step in the construction of aceric acid was the stereoselective addition of 2-trimethylsilyl thiazole to 5-deoxy-1,2-O-isopropylidene-alpha-L-erythro-pentofuran-3-ulose (2), which was prepared from L-xylose. The thiazole group was efficiently converted into the required carboxyl group via conventional transformations. Aceric acid was also synthesized by dihydroxylation of a 3-C-methylene derivative of 2 followed by oxidation of the resulting hydroxylmethyl group. The C-2 epimer of aceric acid was also synthesized using thiazole addition chemistry, starting from L-arabinose.


Assuntos
Carboidratos/síntese química , Pectinas/química , Açúcares Ácidos/química , Açúcares Ácidos/síntese química , Xilose/análogos & derivados , Estrutura Molecular , Xilose/síntese química , Xilose/química
7.
J Bacteriol ; 187(19): 6733-41, 2005 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-16166536

RESUMO

The mechanism by which enzymatic E colicins such as colicin E3 (ColE3) and ColE9 cross the outer membrane, periplasm, and cytoplasmic membrane to reach the cytoplasm and thus kill Escherichia coli cells is unique in prokaryotic biology but is poorly understood. This requires an interaction between TolB in the periplasm and three essential residues, D35, S37, and W39, of a pentapeptide sequence called the TolB box located in the N-terminal translocation domain of the enzymatic E colicins. Here we used site-directed mutagenesis to demonstrate that the TolB box sequence in ColE9 is actually larger than the pentapeptide and extends from residues 34 to 46. The affinity of the TolB box mutants for TolB was determined by surface plasmon resonance to confirm that the loss of biological activity in all except one (N44A) of the extended TolB box mutants correlates with a reduced affinity of binding to TolB. We used a PCR mutagenesis protocol to isolate residues that restored activity to the inactive ColE9 D35A, S37A, and W39A mutants. A serine residue at position 35, a threonine residue at position 37, and phenylalanine or tyrosine residues at position 39 restored biological activity of the mutant ColE9. The average area predicted to be buried upon folding (AABUF) was correlated with the activity of the variants at positions 35, 37, and 39 of the TolB box. All active variants had AABUF profiles that were similar to the wild-type residues at those positions and provided information on the size, stereochemistry, and potential folding pattern of the residues of the TolB Box.


Assuntos
Colicinas/metabolismo , Proteínas de Escherichia coli/metabolismo , Escherichia coli/metabolismo , Proteínas Periplásmicas/metabolismo , Sequência de Aminoácidos , Transporte Biológico/fisiologia , Colicinas/genética , Escherichia coli/genética , Proteínas de Escherichia coli/química , Proteínas de Escherichia coli/genética , Dados de Sequência Molecular , Mutagênese Sítio-Dirigida , Proteínas Periplásmicas/química , Proteínas Periplásmicas/genética , Ligação Proteica , Estrutura Terciária de Proteína
8.
Biochemistry ; 44(34): 11496-507, 2005 Aug 30.
Artigo em Inglês | MEDLINE | ID: mdl-16114886

RESUMO

The 61-kDa colicin E9 protein toxin enters the cytoplasm of susceptible cells by interacting with outer membrane and periplasmic helper proteins and kills them by hydrolyzing their DNA. The membrane translocation function is located in the N-terminal domain of the colicin, with a key signal sequence being a pentapeptide region that governs the interaction with the helper protein TolB (the TolB box). Previous NMR studies [Collins et al. (2002) J. Mol. Biol. 318, 787-904; MacDonald et al. (2004), J. Biomol. NMR 30, 81-96] have shown that the N-terminal 83 residues of colicin E9, which includes the TolB box, is intrinsically disordered and contains clusters of interacting side chains. To further define the properties of this region of colicin E9, we have investigated the effects on the dynamical and TolB-binding properties of three mutations of colicin E9 that inactivate it as a toxin. The mutations were contained in a fusion protein consisting of residues 1-61 of colicin E9 connected to the N terminus of the E9 DNase by an eight-residue linking sequence. The NMR data reveals that the mutations cause major alterations to the properties of some of the clusters, consistent with some form of association between them and other more distant parts of the amino acid sequence, particularly toward the N terminus of the protein. However, (15)N T(2) measurements indicates that residues 5-13 of the fusion protein bound to the 43-kDa TolB remain as flexible as they are in the free protein. The NMR data point to considerable dynamic ordering within the intrinsically disordered translocation domain of the colicin that is important for creating the TolB-binding site. Furthermore, amino acid sequence considerations suggest that the clusters of amino acids occur because of the size and polarities of the side chains forming them influenced by the propensities of the residues within the clusters and those immediately surrounding them in sequence space to form beta turns.


Assuntos
Colicinas/química , Colicinas/metabolismo , Proteínas de Escherichia coli/química , Proteínas de Escherichia coli/metabolismo , Proteínas Periplásmicas/química , Proteínas Periplásmicas/metabolismo , Sequência de Aminoácidos , Substituição de Aminoácidos , Sítios de Ligação , Colicinas/genética , Escherichia coli/genética , Escherichia coli/metabolismo , Proteínas de Escherichia coli/genética , Dados de Sequência Molecular , Mutagênese Sítio-Dirigida , Proteínas Recombinantes de Fusão/química , Proteínas Recombinantes de Fusão/metabolismo , Relação Estrutura-Atividade
9.
J Biomol NMR ; 30(1): 81-96, 2004 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-15452437

RESUMO

The 61 kDa colicin E9 protein toxin enters the cytoplasm of susceptible cells by interacting with outer membrane and periplasmic helper proteins, and kills them by hydrolysing their DNA. The membrane translocation function is located in the N-terminal domain of the colicin, with a key signal sequence being a pentapeptide region that governs the interaction with the helper protein TolB (the TolB box). Previous NMR studies (Collins et al., 2002 J. Mol. Biol. 318, 787-804) have shown that the N-terminal 83 residues of colicin E9, which includes the TolB box, is largely unstructured and highly flexible. In order to further define the properties of this region we have studied a fusion protein containing residues 1-61 of colicin E9 connected to the N-terminus of the E9 DNase by an eight-residue linking sequence. 53 of the expected 58 backbone NH resonances for the first 61 residues and all of the expected 7 backbone NH resonances of the linking sequence were assigned with 3D (1)H-(13)C-(15)N NMR experiments, and the backbone dynamics of these regions investigated through measurement of (1)H-(15)N relaxation properties. Reduced spectral density mapping, extended Lipari-Szabo modelling, and fitting backbone R(2) relaxation rates to a polymer dynamics model identifies three clusters of interacting residues, each containing a tryptophan. Each of these clusters is perturbed by TolB binding to the intact colicin, showing that the significant region for TolB binding extends beyond the recognized five amino acids of the TolB box and demonstrating that the binding epitope for TolB involves a considerable degree of order within an otherwise disordered and flexible domain. Abbreviations : Im9, the immunity protein for colicin E9; E9 DNase, the endonuclease domain of colicin E9; HSQC, heteronuclear single quantum coherence; ppm, parts per million; DSS, 2,2-(dimethylsilyl)propanesulfonic acid; TSP, sodium 3-trimethylsilypropionate; T(1 - 61)-DNase fusion protein, residues 1-61 of colicin E9 connected to the N-terminus of the E9 DNase by an eight residue thrombin cleavage sequence.


Assuntos
Colicinas/química , Colicinas/metabolismo , Epitopos/metabolismo , Proteínas de Escherichia coli/química , Proteínas de Escherichia coli/metabolismo , Sequência de Aminoácidos , Sítios de Ligação , Transporte Biológico Ativo , Isótopos de Carbono , Colicinas/genética , Desoxirribonucleases/metabolismo , Escherichia coli/genética , Escherichia coli/metabolismo , Proteínas de Escherichia coli/genética , Peso Molecular , Isótopos de Nitrogênio , Ressonância Magnética Nuclear Biomolecular , Ligação Proteica , Conformação Proteica , Estrutura Terciária de Proteína , Teoria Quântica
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...