First Report of Phytophthora plurivora Causing Collar Rot on Common Alder in Spain.

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36'34″ N, 3°25'10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41'42″ N, 5°35'36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d-1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 µm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 µm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 µm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5' GAAGGTGAAGTCGTAACAAGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3') primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.

First Report of Heterobasidion annosum on Pinus pinaster in Spain.

The basidiomycete Heterobasidion annosum (Fr.) Bref. (=Fomes annosus (Fr.) Cooke), one of the most important pathogens in coniferous forests in Europe, Asia, and North America, causes root and butt rot. H. annosum was first recorded on Pinus pinaster Ait. (commonly known as Maritime pine) in France and Great Britain in 1961 (4) and Portugal in 1986 (2). P. pinaster is the most widespread conifer in Spain, with more than 700,000 and 600,000 ha in pure and mixed stands, respectively. Over the last few years, P. pinaster decline was observed in several stands in the center of the Iberian Peninsula. Unusual crown transparency, small needles, foliage discoloration, and early tree death are characteristic decline symptoms associated with the high mortality rate on this species. In June of 2010, 11 trees (40 to 60 years old) with a different degree of decline were felled in two zones (42°2'41″N, 3°18'14″W, elevation 1,096 m and 41°55'40″N, 3°12'3″W, elevation 1,128 m) and cut into sections (stump height, breast height, and near the top). Wood slices were removed from each section and taken to the laboratory. Samples were placed in moist chambers with optimal conditions of humidity and temperature to enhance pathogen growth. After 20 days of incubation in darkness at 25°C, H. annosum (anamorph Spiniger meineckellum [A. Olson] Stalpers) occurred on most of these slices. Conidiophores with subglobose to pyriform conidia (5.8 × 4.2 µm) were observed with a compound microscope. The fungus was isolated to extract DNA by disruption of the mycelium followed by washes with phenol/chloroform/isoamyl alcohol solution (25:24:1). DNA was precipitated with 20% polyethylene glycol solution. PCR was carried out according to the instructions of the manufacturer of Dynazyme II DNA polymerase (Finnzymes Ltd, Espoo, Finland) with ITS primers, 1F (5'-CTTGGTCATTTAGAGGAAGTAA-3') and 4 (5'-TCCTCCGCTTATTGATATGC-3'). After DNA purification, samples were sequenced (SECUGEN, Madrid, Spain) and aligned and corrected with Geneious Pro 5.3 to obtain the consensus sequences. Resulting DNA sequences of two isolates were deposited in GenBank (Nos. FR850494 and FR850495), and compared with a Blastn search at GenBank showing 100% identity and 100% coverage with H. annosum sensu stricto, former ISG-P (intersterility group of pines). For pathogenicity tests, 10 seedlings (2 year old) were inoculated with autoclaved P. pinaster wood chips colonized by H. annosum, and 10 control seedlings were inoculated with noncolonized wood chips. Inoculums were prepared by growing H. annosum on 4-mm-diameter wood chips placed on potato dextrose agar media for 3 weeks. The wood chips were put inside an oblique incision made at 6 cm above the soil line and wrapped with Parafilm. After 8 weeks in a growth chamber at 22.5°C with a 14-h photoperiod, the inoculated seedlings showed typical symptoms and 3 seedlings of 10 were dead. H. annosum was previously recorded on P. sylvestris in central Spain (1), causing needle drop, swelling at the stump height, and presence of dead trees by circular areas. This pathogen was also reported on P. nigra in northeastern Spain, associated with defoliation and mortality (3). To our knowledge, this is the first record of H. annosum on P. pinaster in Spain. References: (1) J. Benito-Martínez. An. Jardín Bot. Madrid 3:23, 1943. (2) N. Neves et al. EPPO Bull. 16:505, 1986. (3) J. Oliva et al. Bol. Sanidad Vegetal. Plagas. 34:415, 2008. (4) P. Spaulding. US Dep. Agric. Agric. Handb. 197:100, 1961.