Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Beneficial effects of exogenous iodine in lettuce plants subjected to salinity stress.

Salinity inhibits plant growth due to ionic and osmotic effects on metabolic processes and nutritional balance, leading to impaired physiological functions. Selenium (Se) and silicon (Si) can be partially alleviated by the effects wrought by NaCl on the plant metabolism. Iodine (I), applied as iodate (IO(3)(-)) in biofortification programmes, has been confirmed to improve the antioxidant response in lettuce plants. Thus, the aim of this study was to determine whether the application of IO(3)(-) can improve the response to severe salinity stress in lettuce (Lactuca sativa cv. Philipus). In this work, the application of IO(3)(-) (20-80 µM) in lettuce plants under salinity stress (100mM of NaCl) exerted a significantly positive effect on biomass and raised the levels of soluble sugars while lowering the Na(+) and Cl(-) concentrations as well as boosting the activity of antioxidant enzymes such as SOD, APX, DHAR and GR. Therefore, IO(3)(-) could be considered a possibly beneficial element to counteract the harmful effects of salinity stress.