Age related changes in 5-methylcytosine content in human peripheral leukocytes and placentas: an HPLC-based study.

The goal of the present study was to investigate inter-individual and age-dependent variation of global DNA methylation in human tissues. In this work, we examined 5-methyldeoxycytidine ((met)C) content by HPLC in human peripheral blood leukocytes obtained from 76 healthy individuals of ages varying from 4 to 94 years (yr), and 39 human placentas from various gestational stages. The HPLC analysis revealed a significant variation of (met)C across individuals and is consistent with the previous findings of age-dependent decrease of global methylation levels in human tissues. The age-dependent decrease of (met)C was relatively small, but statistically highly significant (p= 0.0002) in the aged group (65.9 +/- 8.9 [mean age +/- SD] yr; n = 22) in comparison to the young adult group (19.3 +/- 1.4 yr; n = 21). Males showed a subtle but statistically significant higher mean (met)C content than females. In contrast to the peripheral blood samples, DNA extracted from placentas exhibited gestational stage-dependent increase of methylation levels that appeared to inversely correlate with the expression levels of human endogenous retroviruses. These data may be helpful in further studies of DNA methylation, such as inheritance of epigenetic patterns, environment-induced changes, and involvement of epigenetic changes in disease.

Basal ganglia efferents to the brainstem centers controlling postural muscle tone and locomotion: a new concept for understanding motor disorders in basal ganglia dysfunction.

The present study is designed to elucidate how basal ganglia afferents from the substantia nigra pars reticulata (SNr) to the mesopontine tegmental area of the brainstem contribute to gait control and muscle-tone regulation. We used unanesthetized and acutely decerebrated cats (n=27) in which the striatum, thalamus and cerebral cortex were removed but the SNr was preserved. Repetitive stimulation (50 Hz, 10-60 microA, for 5-20 s) applied to a mesencephalic locomotor region (MLR), which corresponded to the cuneiform nucleus, and adjacent areas, evoked locomotor movements. On the other hand, stimulation of a muscle-tone inhibitory region in the pedunculopontine tegmental nucleus (PPN) suppressed postural muscle tone. An injection of either glutamatergic agonists (N-methyl-D-aspartic acid and kainic acid) or GABA antagonists (bicuculline and picrotoxin) into the MLR and PPN also induced locomotion and muscle-tone suppression, respectively. Repetitive electrical stimuli (50-100 Hz, 20-60 microA for 5-20 s) delivered to the SNr alone did not alter muscular activity. However stimulating the lateral part of the SNr attenuated and blocked PPN-induced muscle-tone suppression. Moreover, weaker stimulation of the medial part of the SNr reduced the number of step cycles and disturbed the rhythmic alternation of limb movements of MLR-induced locomotion. The onset of locomotion was delayed as the stimulus intensity was increased. At a higher strength SNr stimulation abolished the locomotion. An injection of bicuculline into either the PPN or the MLR diminished the SNr effects noted above. These results suggest that locomotion and postural muscle tone are subject to modulation by GABAergic nigrotegmental projections which have a partial functional topography: a lateral and medial SNr, for regulation of postural muscle tone and locomotion, respectively. We conclude that disorders of the basal ganglia may include dysfunction of the nigrotegmental (basal ganglia-brainstem) systems, which consequently leads to the production of abnormal muscle tone and gait disturbance.

Medullary reticulospinal tract mediating the generalized motor inhibition in cats: II. Functional organization within the medullary reticular formation with respect to postsynaptic inhibition of forelimb and hindlimb motoneurons.

We compared postsynaptic inhibitory effects on forelimb motoneurons and those on hindlimb motoneurons during generalized motor inhibition evoked by stimulating the medullary reticular formation in decerebrate cats. Here, we address two questions. First, whether the medullary inhibitory effects upon forelimb motoneurons are equivalent to those upon hindlimb motoneurons. Second, whether there is a somatotopographical organization within the medullary reticular formation in terms of inhibitory connections with motoneurons. Repetitive stimulation (20-50 microA, 50-100 Hz) delivered to the dorsomedial medullary reticular formation bilaterally suppressed muscle tone of both the forelimbs and hindlimbs. The medullary stimulation hyperpolarized the membrane potentials of the forelimb (5.4+/-1.8 mV, n=46) and hindlimb (5.4+/-2.0 mV, n=59) motoneurons together with a decrease in input resistance. The degree of membrane hyperpolarization and input resistance was not different in the forelimb and hindlimb motoneurons. The medullary stimulation also depressed the capability of generating antidromic and orthodromic spikes in the motoneurons. Stimuli with pulse trains (one to three pulses, 5-10-ms intervals, 20-50 microA) applied to the medullary inhibitory region induced a mixture of excitatory and inhibitory postsynaptic potentials in the motoneurons. The most noteworthy potentials were the inhibitory postsynaptic potentials with a late latency. They were observed in most forelimb (n=57/58, 98.3%) and hindlimb (n=63/64, 98.4%) motoneurons. The inhibitory potentials in forelimb motoneurons had a latency of 25-30 ms and a peak latency of 35-40 ms, and those in hindlimb motoneurons had a latency of 30-35 ms and a peak latency of 50-60 ms. A difference was not observed in the location of the effective sites for evoking the inhibitory effects in the forelimb and hindlimb motoneurons. These sites were homogeneously distributed in the dorsomedial part of the medullary reticular formation corresponding to the location of the nucleus reticularis gigantocellularis. From these findings we suggest that there is an equivalent amount of the postsynaptic inhibitory effects exerted on forelimb and hindlimb motoneurons during medullary-induced generalized motor inhibition. In addition, the medullary reticular formation may be functionally organized as a homogeneous or non-specific region in terms of the medullary reticulospinal inhibitory connections with forelimb and hindlimb motoneurons.

Immunohistochemical characterization of hepatoblastomas in B6C3F1 mice treated with diethylnitrosamine and sodium phenobarbital.

Hepatoblastomas (HBs) were induced in B6C3F1 male mice by diethylnitrosamine (DEN) and sodium phenobarbital (PB). Six-week-old mice received a single intraperitoneal dose of DEN followed by a continuous treatment with PB in diet at a concentration of 0 (group 1) or 500 (group 2) ppm for 50 weeks. HBs were observed in 13 of 21 (62%) group 2 mice, with typical histologic features as reported previously, while no such tumors were observed in group 1. Seven of 13 (54%) HBs were found in and/or adjacent to hepatocellular adenomas (HCAs) or hepatocellular carcinomas (HCCs). Immunohistochemically, all HBs were positive for S-100 protein but negative for keratin, alpha-fetoprotein (AFP), albumin (ALB) and vimentin, while HCC cells occasionally reacted positively for AFP with a mosaic pattern. HCC and HCA cells were occasionally positive for ALB. Non-neoplastic hepatocytes and normal bile ducts were positively stained for ALB and keratin/S-100 protein, respectively. S-100 protein is known to be expressed in many mesenchymal tissues and neoplasms including neuroectodermal elements but negative in cells of the hepatic lineage. Thus, the present immunohistochemical results suggested that mesenchymal differentiation occurs in mouse HB cells as observed in human HBs, one of the most frequent infant liver tumors in humans. Although the susceptibility of mouse HBs to PB-promotion suggests a hepatocytic histogenesis, the present immunohistochemical results support the hypothesis that the mouse HB is derived from pluripotent endodermal stem-like cells.

Search for active endogenous retroviruses: identification and characterization of a HERV-E gene that is expressed in the pancreas and thyroid.

To elucidate possible physiological functions of human endogenous retroviruses (HERVs) and their role in the pathogenesis of human diseases, we have developed a strategy to identify transcriptionally active HERV genes. By this approach, we have identified and isolated an active HERV-E gene that was mapped to 17q11. Although the gene was predicted to produce no intact viral particles due to the presence of stop codons, long open reading frames were retained in each gag and pol region. Northern blot analyses revealed in the pancreas (and thyroid) two major transcripts, 3.3 and 4.1 kb in size, associated with 500- to 600-nucleotide-longer minor bands. Preferential expression in pancreas and thyroid gland tissues may suggest a role for this gene in physiological functions common to these tissues.

Greater expression of transforming growth factor alpha and proliferating cell nuclear antigen staining in mouse hepatoblastomas than hepatocellular carcinomas induced by a diethylnitrosamine-sodium phenobarbital regimen.

Transforming growth factor alpha (TGF-alpha) is a potent stimulator of normal hepatocyte proliferation, considered to have relationship to the liver regeneration or carcinogenesis. In this study, we investigated immunohistochemically the association between expression of TGF-alpha and cell proliferation activity in mouse hepatoblastomas (HBs) and hepatocellular carcinomas (HCCs) induced in B6C3F1 mice by diethylnitrosamine and sodium phenobarbital. The TGF-alpha-positive rate in HBs (29.2%) was significantly higher than that in HCCs (12.7%). Likewise, the proliferating cell nuclear antigen-positive rate (22.2%) was higher than the HCC value (14.5%). On the individual data for both TGF-alpha and PCNA, most of the HBs showed higher positive rates than HCCs. In HBs, TGF-alpha was localized only in the nuclei, whereas some HCC cells stained positive both in their nuclei and cytoplasm (0.6%). These results suggest expression of TGF-alpha and its localization might be linked to cell proliferation and play a role in malignant progression of mouse HBs.

N-phenylimidazolium triflate as a highly effective promoter for the interribonucleotide-bond formation via the phosphoramidite method.

N-Phenylimidazolium triflate has been invented as an extremely effective promoter for the construction of interribonucleotide linkage according to the phosphoramidite strategy.

Glucose alters the susceptibility of mesangial cells to contrast media.

RATIONALE AND OBJECTIVES: Diabetic patients frequently suffer contrast media-induced nephropathy. Hyperglycemia in diabetes mellitus causes gradual deterioration of glomerular mesangial cells (MCs) in the kidney. In this study, the authors investigated the response of rat MCs cultured in high-glucose medium to diatrizoate and iohexol, high- and low-osmolar contrast media, respectively. METHODS: Isolated rat MCs were precultured under basal-glucose (5.5 mmol/L) and high-glucose (30 and 55 mmol/L) conditions for 24 hours to mimic hyperglycemia in diabetes mellitus and then were exposed to diatrizoate (40 and 80 mg I/mL) and iohexol (80, 120, 160 mg I/mL) for 2 hours. The cytotoxic effects of diatrizoate and iohexol were monitored by neutral red uptake in MCs. The protective effects of an antioxidant, d-alpha-tocopherol (Toc), on cytotoxicity of the contrast media were determined when MCs were precultured with Toc under high-glucose conditions or were exposed to the contrast media together with Toc. Peroxide levels in the cells exposed to the contrast media were analyzed by flow cytometry using dichlorofluorescin diacetate. RESULTS: Exposure to both contrast media (diatrizoate and iohexol) induced a concentration-dependent decrease in viability of the cells precultured under basal-glucose conditions (5.5 mmol/L). Preculture under high-glucose conditions (30 and 55 mmol/L) augmented the cytotoxic effects of both contrast media. An increase in the intracellular peroxide level was detected after exposure to both contrast media. Preculture with Toc prevented augmentation of the cytotoxic effects of diatrizoate by the higher glucose concentration (55 mmol/L). The exposure to diatrizoate together with Toc also attenuated its cytotoxic effects. Toc showed no such protective effects against iohexol exposure. CONCLUSIONS: These findings suggest that high-glucose conditions enhance the susceptibility of MCs to the cytotoxic effects of both contrast media; the enhanced susceptibility was in part attributable to oxidative stress caused by high-glucose conditions; diatrizoate exerted the cytotoxic effects by means of oxidative stress; and iohexol appeared to exert its cytotoxicity in a manner different from diatrizoate.

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

Tuberous sclerosis: epileptogenicity and multimodal presurgical evaluations.

We report on a patient with tuberous sclerosis-related epilepsy who benefited from surgical treatment. Various presurgical evaluations, including positron emission tomography (PET), made it possible for us to localize the epileptic focus accurately. In this paper, we stress the importance of performing multimodal evaluations to determine which tubers really possess epileptogenicity. In addition, the implications of PET in tuberous sclerosis-related epilepsy are described.

Transcriptionally active HERV-K genes: identification, isolation, and chromosomal mapping.

Preceding the isolation of transcriptionally active HERV-K genes, expression status was examined by RT-PCR and sequence analysis of mRNA from various tissues. In addition to the detection of IDDMK(1,2)22/HERV-K18 expression in peripheral leukocytes, three novel members of the family, which are expressed in multiple tissues, were identified. The novel HERV-K genes (HGMW-approved symbols ERVK4 and ERVK5) were isolated from a BAC library using oligonucleotide probes and assigned by RH mapping to chromosomal regions 3q21-q25.2, 3cen-q13, and 1q21-q23. Although their expression could not be confirmed in any normal tissues by Northern blot analysis, substantial promoter activity of their 5' LTRs was demonstrated in luciferase assays using teratocarcinoma cell lines. Thus, they seem to have the potential to be actively transcribed. The results, combined with those of the expression analysis by RT-PCR and subsequent sequencing of cloned products, also suggest that LTR sequences with subtle base changes might play a role in gene regulation, such as tissue specificity of HERV-K expression.

Efficient liquid-phase synthesis of short-length nucleotides via the phosphoramidite method using stoichiometric amounts of reactants.

The condensation of a nucleoside phosphoramidite and a nucleoside by the aid of a suitable promoter in stoichiometric use is achieved in acetonitrile in the presence of molecular sieves 3A or 4A to give a desired coupling product in an excellent yield. This strategy is particularly useful for the large-scale synthesis of short nucleotides.

Identification of nonsynonymous polymorphisms in the superantigen-coding region of IDDMK1,2 22 and a pilot study on the association between IDDMK1,2 22 and type 1 diabetes.

To investigate the possible involvement of IDDMK1,2 22/HERV-K18 in childhood type I diabetes mellitus, we identified two nonsynonymous A/G polymorphisms in the superantigen-coding region of IDDMK1,2 22 at the 290- and 461-nucleotide (nt) positions from the initial methionine codon and compared their frequencies in 74 Japanese patients with type 1 diabetes and in 54 nondiabetic controls. Although the G substitution was observed more frequently at either site in the patients than it was in the controls (7% vs. 4% at 290 nt, and 29% vs. 20% at 461 nt), the differences were not statistically significant. A weak significance of difference in the frequency of 461G was obtained only in an early-onset group of patients manifesting the disease at 5 years of age or less (n = 24) when compared with controls (38% vs. 20%; P = 0.03). However, in addition to the common absence of a particular allele among the expected four alleles, remarkable differences in allele frequencies were present between Japanese and European populations. This first trial investigating the association of IDDMK1,12 22 with type 1 diabetes presents intriguing suggestions for the role of this region in the etiology of autoimmune and infectious diseases.

Immunohistochemical localization of transforming growth factor alpha in chemically induced rat hepatocellular carcinomas with reference to differentiation and proliferation.

Hepatocellular carcinomas (HCCs) were induced in male Fischer 344 rats with dietary 3'-methyl-4-(dimethylamino)-azobenzene treatment and were classified into solid, glandular (well- or poorly differentiated), and trabecular types. Investigation of cell proliferation kinetics and immunohistochemical localization of transforming growth factor alpha (TGF-alpha) demonstrated all solid (n = 24) and poorly differentiated glandular type (n = 6) HCCs to have TGF-alpha-positive nuclei. Nuclear staining of TGF-alpha was also observed in 13 of 28 (46%) trabecular-type HCCs, whereas 12 (43%) exhibited cytoplasmic staining, and 3 (11%) were negative. As for well-differentiated glandular HCCs, 7 of 20 (35%) were positively stained in their nucleus, another 7 (35%) demonstrated antibody binding in the cytoplasm, and 6 (30%) were negative. The order for growth rate evaluated by bromodeoxyuridine (BrdU) labeling was solid (38.22%), poorly differentiated glandular (26.82%), trabecular (7.98%), and well-differentiated glandular (2.57%) types. For trabecular HCCs with nuclear, cytoplasmic, or negative TGF reactions, values were 13.39% (n = 13), 3.61% (n = 12), and 2.01% (n = 3), respectively. Likewise, BrdU-labeling indices for the counterpart groups of well-differentiated glandular type HCCs were 4.53, 1.91, and 1.29%, respectively. The results indicate that TGF-alpha expression might be linked to histopathological differentiation and cell proliferation in rat HCCs.

Esmolol versus diltiazem in the treatment of postoperative atrial fibrillation/atrial flutter after open heart surgery.

BACKGROUND: Supraventricular tachyarrhythmias are common after open heart surgery. Possible causative factors for these arrhythmias include operative trauma, atrial ischemia, electrolyte imbalances, pericardial irritation, and excess catecholamines. Two agents commonly used to control ventricular rate in atrial fibrillation or atrial flutter (AF/AFL) are beta-blockers and calcium channel blockers. METHODS AND RESULTS: This randomized study was designed to compare the safety and efficacy of intravenous diltiazem versus intravenous esmolol in patients with postoperative AF/AFL after coronary bypass surgery and/or valve replacement surgery. A comparative cost analysis was also performed. Thirty patients received either esmolol (n = 15) or diltiazem (n = 15) for AF/AFL. During the first 6 hours of treatment, 66.6% of esmolol-treated patients converted to sinus rhythm compared with 13.3% of the diltiazem-treated patients (P <.05). At 24 hours, 66.6% of the diltiazem group converted to SR compared with 80% of the esmolol group (not significant). Drug-induced side effects, time to rate control (<90 beats/min), number of patients requiring cardioversion, and length of hospitalization were similar for the two groups. The drug cost/successfully treated patient for esmolol versus diltiazem was $254 versus $437 at 6 hours and $529 versus $262 at 24 hours. CONCLUSIONS: Although this is a small study, it suggests that esmolol is more effective in converting patients to normal sinus rhythm than diltiazem during the initial dosing period. No differences in conversion rates were observed between the two groups after 24 hours. Additional studies are needed to confirm whether esmolol is the initial drug of choice in patients with postoperative AF/AFL after coronary bypass surgery.

Identification of the TCL6 genes within the breakpoint cluster region on chromosome 14q32 in T-cell leukemia.

A region on chromosome 14q32.1 is often involved in chromosomal translocations and inversions with one of the T-cell receptor loci in T-cell lymphoproliferative diseases. The breakpoints of the different rearrangements segregate into two clusters; a cluster due to inversion on the centromeric side and a cluster due to simple balanced translocations on the telomeric side. If the target gene activated by these different types of chromosomal rearrangements is the same, the gene must be localized between the two clusters of breakpoints in a region of around 160 kb. Within this breakpoint cluster region, we isolated two genes; namely, TCL1 and TML1/TCL1b genes. In the course of characterizing the TML1 gene, we further identified a third novel gene, which we named TCL6 (T-cell leukemia/lymphoma 6), from a region 7 kb upstream of the TML1 locus. The TCL6 gene expressed at least 11 isoforms through very complex alternative-splicing, including splicing with the TML1 gene. Those isoforms encode at least five open reading frames (ORFs) with no homology to known sequences. The localization of the proteins corresponding to these ORF was determined by fusing green fluorescence protein at the carboxyl terminal of each ORF. ORF141 and ORF72 were observed in the cytoplasmic region, while ORF105, ORF119, and ORF163 were predominantly localized in the nuclear region. Since the TCL6 gene was expressed in T-cell leukemia carrying a t(14;14)(q11;q32.1) chromosome translocation and was not expressed in normal T-cells (just like the TML1 and TCL1 genes), it is also a candidate gene potentially involved in leukemogenesis. Oncogene (2000).

Glomerulonephritis with fibrillary deposition in a transgenic mouse carrying the human prototype c-Ha-ras gene (rasH2 mouse).

Glomerulonephritis was observed in a 34-week-old transgenic CB6F1 mouse carrying the human prototype c-Ha-ras gene (rasH2 mouse) from a medium-term carcinogenicity study of N-methyl-N-nitrosourea (MNU). Lesions were characterized by severe diffuse enlargement and prominent hyalinization of glomeruli. The hyaline material was positive for periodic acid-Schiff but negative for amyloid by the Congo red method. Immunohistochemically, affected glomeruli were positive for polyclonal anti-mouse IgG. Ultrastructurally, there were characteristic subendothelial and mesangial deposits composed of fibrils showing a fingerprint pattern. Lamellae were 7.5-14.3 nm in diameter and formed multilayered structures. In addition to the renal lesions, a lymphoma was observed in the thymus, with metastasis to the spleen and some lymph nodes. However, there was no glomerulonephritis in 32 other mice bearing thymic lymphomas and in more than 40 males and females given MNU in the same study. Thus, the lesions in this mouse may have been spontaneous. Glomerulonephritis was not found in more than 120 other male and female rasH2 mice in our facility. This is the first report of glomerulonephritis in a rasH2 mouse, a promising candidate for medium-term carcinogenicity risk assessment.

A patient with mitochondrial myopathy associated with isolated succinate dehydrogenase deficiency.

We report on a boy with normal mental development who had muscle hypotonia and congenital dislocation of the hip and knee joints. Histochemical and biochemical examinations of his muscle specimen revealed no succinate dehydrogenase (SDH) activity. Since the NADH cytochrome c reductase and cytochrome c oxidase activities were normal, we concluded that he had an isolated SDH deficiency. Our patient provides further evidence for the clinical variability of this disorder.

Establishment and characterization of a cell line from a chemically-induced mouse hepatoblastoma.

We established a cell line (MHB-2) from a hepatoblastoma (HB) induced by diethylnitrosamine (DEN) and sodium phenobarbital (PB) in male B6C3F1 mice and examined the biological characteristics of MHB-2. MHB-2 cells grew as monolayers in culture and showed a spindle or polygonal shape. Immunohistochemically, the original tumor cells and MHB-2 cells were negative for keratin, alpha-fetoprotein and albumin. Electron microscopically, MHB-2 cells had irregular-shaped nuclei with prominent nucleoli, abundant free ribosomes, myelinosomes, desmosomes and surface microvilli. Growth of this cell line was significantly accelerated by hepatocyte growth factor (HGF) and expression of its receptor c-met was confirmed by the reverse transcription-polymerase chain reaction (RT-PCR). MHB-2, however, was not found to be tumorigenic when transplanted into the subcutaneous tissue of syngeneic, nude or scid mice. To our knowledge, this is the first report on the establishment of a cell line derived from a mouse HB. MHB-2 would be useful for further studies to clarify the biological characteristics of mouse HB.

The decrease in total collagen fibers in the liver by hepatocyte growth factor after formation of cirrhosis induced by thioacetamide.

Liver cirrhosis is an inveterate disease accompanying fibrosis, hepatocyte damage, and liver dysfunction. In this study, the therapeutic effects of recombinant human hepatocyte growth factor (rhHGF) on liver cirrhosis were examined in rats administered thioacetamide (TAA). Repeated administration of TAA for 10 weeks to rats induced liver cirrhosis with collagen nodes and pseudo-lobe generation, a condition that was pathologically similar to that in humans. Administration of rhHGF after the formation of liver cirrhosis markedly decreased the incidence of pathological fibrosis and the degree of fibrosis as measured by a computed image analysis system. Continuous administration of rhHGF by infusion pump was more effective than bolus administration. Northern blotting analysis showed that rhHGF reduced mRNA levels of procollagen alpha2(I), alpha1(IV), and transforming growth factor-beta1 (TGF-beta1) that were stimulated in the TAA-treated liver. The labeling index of hepatocytes increased following administration of rhHGF in this model. These observations suggest that the pathological recession of liver fibrosis is the result of the reduction of TGF-beta1 and collagen synthesis and, in part, of the stimulation of mitosis of hepatocytes directly by rhHGF and indirectly by TGF-beta1 reduction in the cirrhotic liver. These results demonstrate the usefulness of rhHGF as a therapeutic agent in liver cirrhosis.