Synthesis, Anti-TMV Activities, and Action Mechanisms of a Novel Cytidine Peptide Compound.

Cytidine has a broad range of applications in the pharmaceutical field as an intermediate of antitumor or antiviral agent. Here, a series of new cytidine peptide compounds were synthesized using cytidine and Boc group-protected amino acids and analyzed for their antiviral activities against tobacco mosaic virus (TMV). Among these compounds, the structure of an effective antiviral cytidine peptide SN11 was characterized by 1H NMR, 13C NMR, and high-resolution mass spectrometer. The compound SN11 has a molecular formula of C15H22N6O8 and is named 2-amino-N-(2- ((1- (3,4-dihydroxy-5-(hydroxymethyl) tetrahydrofuran-2-yl) -2-oxo-1,2-dihydropyrimidin-4-yl) amino) -2-oxyethyl) amino). The protection, inactivation, and curation activities of SN11 at a concentration of 500 µg/mL against TMV in Nicotiana glutinosa were 82.6%, 84.2%, and 72.8%, respectively. SN11 also effectively suppressed the systemic transportation of a recombinant TMV carrying GFP reporter gene (p35S-30B:GFP) in Nicotiana benthamiana by reducing viral accumulation to 71.3% in the upper uninoculated leaves and inhibited the systemic infection of TMV in Nicotiana tabacum plants. Furthermore, the results of RNA-seq showed that compound SN11 induced differential expression of genes involved in the biogenesis and function of ribosome, plant hormone signal transduction, plant pathogen interaction, and chromatin. These results validate the antiviral mechanisms of the cytidine peptide compound and provide a theoretical basis for their potential application in the management of plant virus diseases.

Combination of trimethoprim-sulfamethoxazole and mesenchymal stem cell therapy to treat toxoplasmic encephalitis after hematopoietic stem cell transplantation: A case report.

Toxoplasmosis, caused by the parasite Toxoplasma gondii, is a life-threatening infection that may occur following hematopoietic stem cell transplantation (HSCT). Toxoplasmic encephalitis (TE) is one of the most severe manifestations of this infection and often results in unsatisfactory therapeutic outcomes, especially regarding neurological damage. Recent studies have demonstrated that human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) can significantly aid in neural repair and remodeling. Furthermore, hUC-MSCs have been shown to reduce the risk of graft-versus-host disease (GVHD) associated with the reduction or discontinuation of immunosuppressive therapy. In this case report, we present a pediatric patient who developed TE as a complication of haploidentical HSCT. The patient received a combined treatment regimen of standard anti-Toxoplasma therapy and adjunctive hUC-MSC therapy. The outcomes were satisfactory. The patient regained consciousness, maintained a stable body temperature, and regained the ability to perform daily activities independently. Additionally, next-generation sequencing revealed a decrease in Toxoplasma DNA sequences in the blood and cerebrospinal fluid to undetectable levels. This case report underscores the potential of hUC-MSCs as a promising therapeutic modality for TE.

N6-Methyladenosine RNA Modification Regulates Maize Resistance to Maize Chlorotic Mottle Virus Infection.

Maize chlorotic mottle virus (MCMV) is one of the main viruses causing significant losses in maize. N6-methyladenosine (m6A) RNA modification has been proven to play important regulatory roles in plant development and stress response. In this study, we found that MCMV infection significantly up-regulated the m6A level in maize, and methylated RNA immunoprecipitation sequencing (MeRIP-seq) and RNA sequencing (RNA-seq) were performed to investigate the distribution of m6A modified peaks and gene expression patterns in MCMV-infected maize plants. The results showed that 1325 differentially methylated genes (DMGs) and 47 differentially methylated and expressed genes (DMEGs) were identified and analyzed. Moreover, the results of virus-induced gene silencing (VIGS) assays showed that ZmECT18 and ZmGST31 were required for MCMV infection, while silencing of ZmMTC, ZmSCI1 or ZmTIP1 significantly promoted MCMV infection in maize. Our findings provided novel insights into the regulatory roles of m6A modification in maize response to MCMV infection.

Early Post-Transplant Serum Ferritin Levels as Predictive Biomarkers for Severe Acute Graft-Versus-Host Disease in Pediatric Umbilical Cord Blood Transplantation for Acute Leukemia.

BACKGROUND Allogeneic hematopoietic stem cell transplantation (allo-HSCT) using umbilical cord blood is a valuable therapy option for patients with acute leukemia (AL). Acute graft-versus-host disease (aGVHD) remains the most frequently encountered complication. This study investigated risk factors for aGVHD and assessed whether post-transplant serum ferritin (SF) within 2 weeks is a potential biomarker for aGVHD in pediatric patients with AL undergoing umbilical cord blood transplantation (UCBT). MATERIAL AND METHODS We conducted a retrospective cohort study of 71 patients with AL who underwent UCBT at the Children's Hospital of Soochow University between 2017 and 2022. We evaluated several factors related to aGVHD. Univariate and multivariate analyses were performed using the proportional subdistribution hazard regression model of Fine and Gray. Analyses of overall survival (OS) were performed using the Kaplan-Meier method, and differences were compared using log-rank tests. RESULTS Of the 71 patients, 23 (32.4%) experienced grade II-IV aGVHD, of whom 18 (25.4%) developed grade III-IV aGVHD. Patients with grade II-IV and III-IV aGVHD had worse 5-year OS (69.4±10%, p=0.01; and 60.6±11.6, P=0.007, respectively). Conditioning intensity was a risk factor for grade III-IV aGVHD (HR: 0.34, 95% CI: 0.13-0.89, P=0.027). An SF level >1650 ng/mL within 2 weeks post-transplant was associated with an increased risk of severe aGVHD (HR: 3.61, 95% CI: 1.09-11.97, P=0.036). CONCLUSIONS Post-transplant SF within 2 weeks was a potential biomarker for developing severe aGVHD. Higher levels of post-transplant SF are associated with a higher incidence of grade II-IV aGVHD and grade III-IV aGVHD.

Transcriptional signatures of cortical structural changes in chronic insomnia disorder.

Chronic insomnia disorder (CID) is a multidimensional disease that may influence various levels of brain organization, spanning the macroscopic structural connectome to microscopic gene expression. However, the connection between genomic variations and morphological alterations in CID remains unclear. Here, we investigated brain structural changes in CID patients at the whole-brain level and whether these link to transcriptional characteristics. Brain structural data from 104 CID patients and 102 matched healthy controls (HC) were acquired to examine cortical structural alterations using morphometric similarity (MS) analysis. Partial least squares (PLS) regression and transcriptome data from the Allen Human Brain Atlas were used to extract genomes related to MS changes. Gene-category enrichment analysis (GCEA) was used to identify potential molecular mechanisms behind the observed structural changes. We found that CID patients exhibited MS reductions in the parietal and limbic regions, along with enhancements in the temporal and frontal regions compared to HCs (pFDR < .05). Subsequently, PLS and GCEA revealed that these MS alterations were spatially correlated with a set of genes, especially those significantly correlated with excitatory and inhibitory neurons and chronic neuroinflammation. This neuroimaging-transcriptomic study bridges the gap between cortical structural changes and the molecular mechanisms in CID patients, providing novel insight into the pathophysiology of insomnia and targeted treatments.

Identification of host gene regulation and resistance pathway dynamics at diverse infection stages of Rhizoctonia solani AG3-TB.

Rhizoctonia solani is a fungal pathogen that causes significant losses in agricultural production. Because of its rapid transmission and broad host range, the exploration of genes involved in defense responses to the infection of R. solani has become an important task. Here, we performed a time-course RNA-Seq experiment to explore crucial genes or pathways involved in host responses to R. solani AG3-TB infection at 6, 12, 24, 36, 48, and 72 hours post inoculation (hpi). GO and KEGG enrichment analysis revealed that most DEGs were enriched in the basal metabolism pathways, including carbohydrate metabolic processes and the biosynthesis of amino acids. Moreover, catalase (CAT) and superoxide dismutase (SOD) were up-regulated, and transcription factors (TFs) such as WRKY, AP2, and MYB were increased significantly compared to the control (0 hpi). Silencing of WRKY70 and catalase-3 exhibited elevated susceptibility to the fungal infection. To summarize, the TFs WRKY70 and WRKY75, genes involved in jasmonic acid (JA), salicylic acid (SA), and brassinosteroids (BR) signaling pathways, and defense-related enzymes may play crucial roles in the host responses to R. solani AG3-TB infection.

ZmmiR398b negatively regulates maize resistance to sugarcane mosaic virus infection by targeting ZmCSD2/4/9.

MicroRNAs (miRNAs) are widely involved in various biological processes of plants and contribute to plant resistance against various pathogens. In this study, upon sugarcane mosaic virus (SCMV) infection, the accumulation of maize (Zea mays) miR398b (ZmmiR398b) was significantly reduced in resistant inbred line Chang7-2, while it was increased in susceptible inbred line Mo17. Degradome sequencing analysis coupled with transient co-expression assays revealed that ZmmiR398b can target Cu/Zn-superoxidase dismutase2 (ZmCSD2), ZmCSD4, and ZmCSD9 in vivo, of which the expression levels were all upregulated by SCMV infection in Chang7-2 and Mo17. Moreover, overexpressing ZmmiR398b (OE398b) exhibited increased susceptibility to SCMV infection, probably by increasing reactive oxygen species (ROS) accumulation, which were consistent with ZmCSD2/4/9-silenced maize plants. By contrast, silencing ZmmiR398b (STTM398b) through short tandem target mimic (STTM) technology enhanced maize resistance to SCMV infection and decreased ROS levels. Interestingly, copper (Cu)-gradient hydroponic experiments demonstrated that Cu deficiency promoted SCMV infection while Cu sufficiency inhibited SCMV infection by regulating accumulations of ZmmiR398b and ZmCSD2/4/9 in maize. These results revealed that manipulating the ZmmiR398b-ZmCSD2/4/9-ROS module provides a prospective strategy for developing SCMV-tolerant maize varieties.

First Report of Tomato Yellow Mottle-Associated Virus Infecting Tobacco in China.

Tomato yellow mottle-associated virus (TYMaV) belongs to the genus Cytorhabdovirus in the family Rhabdoviridae and has been reported to infect a variety of Solanaceae crops, such as Solanum lycopersicum, S. nigrum, Capsicum annuum and Nicotiana benthamiana (Li et al. 2022, Li et al. 2023, Xu et al. 2017, Zhou et al. 2019). In August 2022, about 500 out of 2000 tobacco (N. tabacum) plants showing leaf distortion, crinkling and mosaic symptoms were found in one tobacco growing field in Xingren City, Guizhou Province, China. To identify the causal pathogen(s), leaves from 20 symptomatic tobacco plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq) and assembly. Briefly, total RNA was extracted with TRIzol Reagent (Takara, Kusatsu, Japan). A small RNA cDNA library was constructed by the small RNA Sample Pre Kit. sRNA-Seq was performed with an Illumina NovaSeq 6000 platform. About 29 million reads were obtained and 334 contigs generated after removal of host-derived sequences. Among them, 31 unique contigs mapped to the TYMaV genome (NC_034240.1), covering 28.43% of the genome with the mean read coverage of 0.92%. Meanwhile, 226 contigs mapped to the genome of a potyvirus, chilli veinal mottle virus (ChiVMV, NC_005778.1), covering 88.79% of the genome with the mean read coverage of 0.83%. To verify the sRNA-Seq result for TYMaV identification, reverse transcription (RT)- PCR was performed with specific primers TYMaV-F (5'-CTGACGTAGTGTTGGCAGAT-3') and TYMaV-R (5'-AACCTCCATGCAGAACCATGG-3'). The expected-size 936-bp fragment was amplified from total RNA of all 20 samples. Dot enzyme-linked immunosorbent assays (Dot-ELISA) with antibody for TYMaV (kindly provided by Dr. Zhenggang Li from Guangdong Academy of Agricultural Sciences) were performed and further verified TYMaV infection. In addition, five asymptomatic tobacco plants from the same field as controls were used to detect TYMaV by RT-PCR and Dot-ELISA, and all samples showed negative test results. Subsequently, 17 primer pairs (Supplementary Table 1) were used to obtain the full-length sequence of TYMaV from a single positive tobacco sample by RT-PCR, followed by Sanger sequencing at Sangon Biotech (Shanghai, China). The resulting amplicon sequences were assembled into a nearly full-length genome sequence of a TYMaV isolate from tobacco in Guizhou (TYMaV-GZ). BLASTn analysis of the 13, 393 nt-long sequence (GeneBank accession number, PP444718) revealed 84.7% and 87.2% nt sequence identity with the TYMaV tomato isolate (KY075646.1) and the TYMaV S. nigrum isolate (MW527091.1), respectively. Moreover, five S. nigrum plants showing leaf crinkling and mosaic symptoms from tobacco fields tested positive for TYMaV by RT-PCR assay, suggesting a potential spread of TYMaV between tobacco and S. nigrum, which may serve as a reservoir for the virus in the tobacco fields. However, the transmission route of TYMaV remains unknown, and further verification is needed. To our knowledge, this is the first report of TYMaV infecting tobacco crop in China. It will be important to assess the potential economic importance of TYMaV to tobacco production in China and elsewhere, and to elucidate the respective roles of this virus and ChiVMV in the leaf distorting and yellowing symptoms.

Transcriptome analysis and functional verification reveal the roles of copper in resistance to potato virus Y infection in tobacco.

Potato virus Y (PVY) is one of the most important pathogens in the genus Potyvirus that seriously harms agricultural production. Copper (Cu), as a micronutrient, is closely related to plant immune response. In this study, we found that foliar application of Cu could inhibit PVY infection to some extent, especially at 7 days post inoculation (dpi). To explore the effect of Cu on PVY infection, transcriptome sequencing analysis was performed on PVY-infected tobacco with or without Cu application. Several key pathways regulated by Cu were identified, including plant-pathogen interaction, inorganic ion transport and metabolism, and photosynthesis. Moreover, the results of virus-induced gene silencing (VIGS) assays revealed that NbMLP423, NbPIP2, NbFd and NbEXPA played positive roles in resistance to PVY infection in Nicotiana benthamiana. In addition, transgenic tobacco plants overexpressing NtEXPA11 showed increased resistance to PVY infection. These results contribute to clarify the role and regulatory mechanism of Cu against PVY infection, and provide candidate genes for disease resistance breeding.

Self-Catalyzed, Visible-Light-Induced Selective C3-H Aroylation of Quinoxalin-2(1H)-ones with Arylaldehydes by Air as an Oxidant.

A self-catalyzed, visible-light-induced, directly selective C3-H aroylation of quinoxalin-2(1H)-ones via energy transfer and hydrogen atom transfer (HAT) catalysis has been developed. The method is highly atom-economical, eco-friendly, and easy to handle. Notably, the reaction proceeded efficiently with ambient air as the sole oxidant at room temperature.

Unveiling novel anti-viral mechanisms of ε-poly-l-lysine on tobacco mosaic virus-infected Nicotiana tabacum through microRNA and transcriptome sequencing.

MicroRNAs (miRNAs) play important roles in plant defense against various pathogens. ε-poly-l-lysine (ε-PL), a natural anti-microbial peptide produced by microorganisms, effectively suppresses tobacco mosaic virus (TMV) infection. To investigate the anti-viral mechanism of ε-PL, the expression profiles of miRNAs in TMV-infected Nicotiana tabacum after ε-PL treatment were analyzed. The results showed that the expression levels of 328 miRNAs were significantly altered by ε-PL. Degradome sequencing was used to identify their target genes. Integrative analysis of miRNAs target genes and gene-enriched GO/KEGG pathways indicated that ε-PL regulates the expression of miRNAs involved in critical pathways of plant hormone signal transduction, host defense response, and plant pathogen interaction. Subsequently, virus induced gene silencing combined with the short tandem targets mimic technology was used to analyze the function of these miRNAs and their target genes. The results indicated that silencing miR319 and miR164 reduced TMV accumulation in N. benthamiana, indicating the essential roles of these miRNAs and their target genes during ε-PL-mediated anti-viral responses. Collectively, this study reveals that microbial source metabolites can inhibit plant viruses by regulating crucial host miRNAs and further elucidate anti-viral mechanisms of ε-PL.

Molecular characterization and pathogenicity of a novel monopartite geminivirus infecting tobacco in China.

The occurrence of geminiviruses causes significant economic losses in many economically important crops. In this study, a novel geminivirus isolated from tobacco in Sichuan province of China, named tomato leaf curl Chuxiong virus (TLCCxV), was characterized by small RNA-based deep sequencing. The full-length of TLCCxV genome was determined to be 2744 nucleotides (nt) encoding six open reading frames. Phylogenetic and genome-wide pairwise identity analysis revealed that TLCCxV shared less than 91% identities with reported geminiviruses. A TLCCxV infectious clone was constructed and successfully infected Nicotiana benthamiana, N. tabacum, N. glutinosa, Solanum lycopersicum and Petunia hybrida plants. Furthermore, expression of the V2, C1 and C4 proteins through a potato virus X vector caused severe chlorosis or necrosis symptom in N. benthamiana. Taken together, we identified a new geminivirus in tobacco plants, and found that V2, C1 and C4 contribute to symptom development.

Antiviral Mechanisms of Anisomycin Produced by Streptomyces albulus SN40 on Potato Virus Y.

Microbial secondary metabolites produced by Streptomyces have diverse application prospects in the control of plant diseases. Herein, the fermentation filtrate of Streptomyces SN40 effectively inhibited the infection of tobacco mosaic virus (TMV) in Nicotiana glutinosa and systemic infection of potato virus Y (PVY) in Nicotiana benthamiana. Additionally, metabolomic analysis indicated that anisomycin (C14H19NO4) and trans-3-indoleacrylic acid (C11H9NO2) were highly abundant in the crude extract and that anisomycin effectively suppressed the infection of TMV as well as PVY. Subsequently, transcriptomic analysis was conducted to elucidate its mechanisms on the induction of host defense responses. Furthermore, the results of molecular docking suggested that anisomycin can potentially bind with the helicase domain (Hel) of TMV replicase, TMV coat protein (CP), and PVY helper component proteinase (HC-Pro). This study demonstrates new functions of anisomycin in virus inhibition and provides important theoretical significance for the development of new biological pesticides to control diverse plant viruses.

Top-down and bottom-up alterations of connectivity patterns of the suprachiasmatic nucleus in chronic insomnia disorder.

The importance of the suprachiasmatic nucleus (SCN, also called the master circadian clock) in regulating sleep and wakefulness has been confirmed by multiple animal research. However, human studies of SCN in vivo are still nascent. Recently, the development of resting-state functional magnetic resonance imaging (fMRI) has made it possible to study SCN-related connectivity changes in patients with chronic insomnia disorder (CID). Hence, this study aimed to explore whether sleep-wake circuitry (i.e., communication between the SCN and other brain regions) is disrupted in human insomnia. Forty-two patients with CID and 37 healthy controls (HCs) underwent fMRI scanning. Resting-state functional connectivity (rsFC) and Granger causality analysis (GCA) were performed to find abnormal functional and causal connectivity of the SCN in CID patients. In addition, correlation analyses were conducted to detect associations between features of disrupted connectivity and clinical symptoms. Compared to HCs, CID patients showed enhanced rsFC of the SCN-left dorsolateral prefrontal cortex (DLPFC), as well as reduced rsFC of the SCN-bilateral medial prefrontal cortex (MPFC); these altered cortical regions belong to the "top-down" circuit. Moreover, CID patients exhibited disrupted functional and causal connectivity between the SCN and the locus coeruleus (LC) and the raphe nucleus (RN); these altered subcortical regions constitute the "bottom-up" pathway. Importantly, the decreased causal connectivity from the LC-to-SCN was associated with the duration of disease in CID patients. These findings suggest that the disruption of the SCN-centered "top-down" cognitive process and "bottom-up" wake-promoting pathway may be intimately tied to the neuropathology of CID.

Whole-transcriptome characterization and functional analysis of lncRNA-miRNA-mRNA regulatory networks responsive to sugarcane mosaic virus in maize resistant and susceptible inbred lines.

Sugarcane mosaic virus (SCMV) is one of the most important pathogens causing maize dwarf mosaic disease, which seriously affects the yield and quality of maize. Currently, the molecular mechanism of non-coding RNAs (ncRNAs) responding to SCMV infection in maize is still uncovered. In this study, a total of 112 differentially expressed (DE)-long non-coding RNAs (lncRNAs), 24 DE-microRNAs (miRNAs), and 1822 DE-messenger RNAs (mRNAs), and 363 DE-lncRNAs, 230 DE-miRNAs, and 4376 DE-mRNAs were identified in maize resistant (Chang7-2) and susceptible (Mo17) inbred lines in response to SCMV infection through whole-transcriptome RNA sequencing, respectively. Moreover, 4874 mRNAs potentially targeted by 635 miRNAs were obtained by degradome sequencing. Subsequently, several crucial SCMV-responsive lncRNA-miRNA-mRNA networks were established, of which the expression levels of lncRNA10865-miR166j-3p-HDZ25/69 (class III homeodomain-leucine zipper 25/69) module, and lncRNA14234-miR394a-5p-SPL11 (squamosal promoter-binding protein-like 11) module were further verified. Additionally, silencing lncRNA10865 increased the accumulations of SCMV and miR166j-3p, while silencing lncRNA14234 decreased the accumulations of SCMV and SPL11 targeted by miR394a-5p. This study revealed the interactions of lncRNAs, miRNAs and mRNAs in maize resistant and susceptible materials, providing novel clues to reveal the mechanism of maize in resistance to SCMV from the perspective of competing endogenous RNA (ceRNA) regulatory networks.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Transcriptome sequencing and functional verification revealed the roles of exogenous magnesium in tobacco anti-PVY infection.

Potato virus Y (PVY) infection causes necrosis and curling of leaves, which seriously affect the yield and quality of Solanaceous crops. The roles of nutrient elements in the regulation of plant resistance to virus infection has been widely reported, while the mechanisms are poorly studied. Previous studies in our laboratory have demonstrated that foliar spraying of MgSO4 could induce Nicotiana tabacum resistance to PVY by increasing the activity of defense-related enzymes. Consistent with the results, we found that exogenous magnesium (Mg) had a certain effect on N. tabacum anti-PVY infection. Meanwhile, Illumina RNA sequencing revealed that Mg induced resistance to PVY infection was mainly by regulating carbohydrate metabolism and transportation, nitrogen metabolism, Ca2+ signal transduction and oxidative phosphorylation. Moreover, we used virus-induced gene silencing assays to verify the function of homologs of five N. tabacum genes involved in above pathways in N. benthamiana. The results showed that NbTPS and NbGBE were conducive to PVY infection, while NbPPases and NbNR were related to resistance to PVY infection. These results suggested a novel strategy for resistance to PVY infection and provided a theoretical basis for virus-resistance breeding.

Neuroimaging profiles of the negative affective network predict anxiety severity in patients with chronic insomnia disorder: A machine learning study.

BACKGROUND: Sleep is instrumental in safeguarding emotional well-being. While the susceptibility to both insomnia and anxiety has been demonstrated to involve intricate brain systems, the neuroimaging profile of chronic insomnia disorder with comorbid anxiety symptoms (CID-A) remains unexplored. Employing machine learning methodologies, this study aims to elucidate the distinct neural substrates underlying CID-A and to investigate whether these cerebral markers can prognosticate anxiety symptoms in patients with insomnia. METHODS: Functional magnetic resonance imaging (fMRI) data were procured from a relatively large cohort (dataset 1) comprised of 47 CID-A patients, 49 CID patients without anxiety (CID-NA), and 48 good sleeper controls (GSC). Aberrant cerebral functional alterations were assessed through functional connectivity strength (FCS) and resting-state functional connectivity (rsFC). Subsequently, Support Vector Regression (SVR) models were constructed to predict anxiety symptoms in CID patients based on neuroimaging features, which were validated utilizing an external cohort (dataset 2). RESULTS: In comparison to CID-NA and GSC subjects, CID-A patients exhibited heightened FCS in the right dorsomedial prefrontal cortex (DMPFC), a central hub within the negative affective network. Moreover, the SVR models revealed that DMPFC-related rsFC/FCS features could be employed to predict anxiety symptoms in two independent cohorts of CID patients. LIMITATION: Modifications in brain functionality might vary across insomnia subtypes. CONCLUSION: The present findings suggest a potential negative affective network model for the neuropathophysiology of CID accompanied by anxiety. Importantly, the negative affective network pattern may serve as a predictor for anxiety symptoms in CID patients.

Two-Dimensional Graphitic Carbon Nitride for Improving the Performance of Organic Solar Cells.

Organic solar cells (OSCs) have attracted lots of attention owing to their low cost, lightweight, and flexibility properties. Nowadays, the performance of OSCs is continuously improving with the development of active layer materials. However, the traditional hole transport layer (HTL) material Poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) presents insufficient conductivity and rapid degradation, which decreases the efficiency and stability of OSCs. To conquer the challenge, the two-dimensional (2D) graphitic carbon nitride (g-C3N4) nanomaterials incorporated into the PEDOT:PSS as hybrid HTL are reported. The addition of g-C3N4 into PEDOT:PSS enables the thickness of the HTL to decrease for enhancing the transmittance of the film and increase the conductivity of PEDOT:PSS. Thus, the device exhibts improved charge transport and suppressed carrier recombination, leading to the increase in short-circuit current density and power conversion efficiency of the devices. This work demonstrates that the incorporation of 2D g-C3N4 into PEDOT:PSS for D18:Y6 and PM6:L8-BO-based OSCs can significantly improve the device efficiency to 17.48% and 18.47% with the enhancement of 7.04% and 8.46%, respectively.

Transcriptomic and Functional Analyses Reveal the Different Roles of Vitamins C, E, and K in Regulating Viral Infections in Maize.

Maize lethal necrosis (MLN), one of the most important maize viral diseases, is caused by maize chlorotic mottle virus (MCMV) infection in combination with a potyvirid, such as sugarcane mosaic virus (SCMV). However, the resistance mechanism of maize to MLN remains largely unknown. In this study, we obtained isoform expression profiles of maize after SCMV and MCMV single and synergistic infection (S + M) via comparative analysis of SMRT- and Illumina-based RNA sequencing. A total of 15,508, 7567, and 2378 differentially expressed isoforms (DEIs) were identified in S + M, MCMV, and SCMV libraries, which were primarily involved in photosynthesis, reactive oxygen species (ROS) scavenging, and some pathways related to disease resistance. The results of virus-induced gene silencing (VIGS) assays revealed that silencing of a vitamin C biosynthesis-related gene, ZmGalDH or ZmAPX1, promoted viral infections, while silencing ZmTAT or ZmNQO1, the gene involved in vitamin E or K biosynthesis, inhibited MCMV and S + M infections, likely by regulating the expressions of pathogenesis-related (PR) genes. Moreover, the relationship between viral infections and expression of the above four genes in ten maize inbred lines was determined. We further demonstrated that the exogenous application of vitamin C could effectively suppress viral infections, while vitamins E and K promoted MCMV infection. These findings provide novel insights into the gene regulatory networks of maize in response to MLN, and the roles of vitamins C, E, and K in conditioning viral infections in maize.