RESUMO
Revealing planktonic fungal ecology under coastal eutrophication is crucial to our understanding of microbial community shift in marine pollution background. We investigated the diversity, putative interspecies interactions, assembly processes and environmental responses of abundant and rare planktonic fungal communities along a eutrophication gradient present in the Beibu Gulf. The results showed that Dothideomycetes and Agaricomycetes were the predominant classes of abundant and rare fungi, respectively. We found that eutrophication significantly altered the planktonic fungal communities and affected the abundant taxa more than the rare taxa. The abundant and rare taxa were keystone members in the co-occurrence networks, and their interaction was enhanced with increasing nutrient concentrations. Stochastic processes dominated the community assembly of both abundant and rare planktonic fungi across the eutrophication gradient. Heterogeneous selection affected abundant taxa more than rare taxa, whereas homogenizing dispersal had a greater influence on rare taxa. Influences of environmental factors involving selection processes were detected, we found that abundant fungi were mainly influenced by carbon compounds, whereas rare taxa were simultaneously affected by carbon, nitrogen and phosphorus compounds in the Beibu Gulf. Overall, these findings highlight the distinct ecological adaptations of abundant and rare fungal communities to marine eutrophication.
Assuntos
Microbiota , Micobioma , Plâncton , Eutrofização , NitrogênioRESUMO
Mangroves are prone to receive pollutants and act as a sink for antibiotic resistance genes (ARGs). However, knowledge of the human health risk of ARGs and its influencing factors in mangrove ecosystems is limited, particularly at large scales. Here, we applied a high-throughput sequencing technique combined with an ARG risk assessment framework to investigate the profiles of ARGs and their public health risks from mangrove wetlands across South China. We detected 456 ARG subtypes, and found 71 of them were identified as high-risk ARGs, accounting for 0.25 % of the total ARG abundance. Both ARGs and bacterial communities showed a distance-decay biogeography, but ARGs had a steeper slope. Linear regression analysis between features of co-occurrence network and high-risk ARG abundance implies that greater connections in the network would result in higher health risk. Structural equation models showed that geographic distance and MGEs were the most influential factors that affected ARG patterns, ARGs and MGEs contributed the most to the health risk profiles in mangrove ecosystems. This work provides a novel understanding of biogeographic patterns and health risk assessment of ARGs in mangrove ecosystems and can have profound significance for mangrove environment management with regard to ARG risk control.
Assuntos
Antibacterianos , Genes Bacterianos , Humanos , Antibacterianos/farmacologia , Ecossistema , Resistência Microbiana a Medicamentos/genética , NutrientesRESUMO
Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.
RESUMO
Litter decomposition is the main process that affects nutrient cycling and carbon budgets in mixed forests. However, knowledge of the response of the soil microbial processes to the mixed-litter decomposition of fresh leaf, semi-decomposed leaf and fine root is limited. Thus, a laboratory microcosm experiment was performed to explore the mixed-litter effects of fresh leaf, semi-decomposed leaf and fine root on the soil enzyme activity and microbial community in an evergreen broadleaf karst forest in Southwest China. Fresh leaf litter, semi-decomposed litter and fine root in the Parakmeria nitida and Dayaoshania cotinifolia forests, which are unique protective species and dominant species in the evergreen broadleaf forest, were decomposed alone and in all possible combinations, respectively. Our results showed that the mass loss of fresh leaf litter in three mixed-litter treatment was significantly higher than that in two mixed-litter treatment in the P. nitida and D. cotinifolia forests. Mass loss of fine root in the single litter treatment was significantly lower in the P. nitida forest and higher in the D. cotinifolia forest compared to that in the other litter treatments. There were insignificant differences in the activities of ß-glucosidase (BG) and leucine aminopeptidase (LAP) between control and mixed-litter treatment in the P. nitida forest and between control and single litter treatment in the D. cotinifolia forest. The N-acetyl-ß-D-glucosaminidase (NAG) activity was significantly increased by the single litter decomposition of fresh leaf and fine root and three mixed-litter decomposition in the P. nitida and D. cotinifolia forests. The activity of acid phospomonoesterase (AP) in the decomposition of fresh leaf litter was lower in the P. nitida forest and higher in the D. cotinifolia forest compared to that in control. The most dominant soil bacteria were Proteobacteria in the P. nitida forest and were Actinobacteria and Proteobacteria in the D. cotinifolia forest. Shannon, Chao1, ACE and PD indexes in the mixed-litter decomposition of fresh leaf and semi-decomposition litter were higher than that in control in P. nitida forest. There were insignificant differences in observed species and indexes of Chao1, ACE and PD between litter treatments in the D. cotinifolia forest. Richness of mixed-litter significantly affected mass loss, soil enzyme activity and microbial diversity in the P. nitida forest. Litter N concentration and the presence of fresh leaf litter were significantly correlated with the mass loss and soil enzyme activity in the P. nitida and D. cotinifolia forests. These results indicated that the presence of fresh leaf litter showed a non-negligible influence on mixed-litter decomposition and soil enzyme activity, which might be partly explained by litter initial quality in the P. nitida and D. cotinifolia forests.
RESUMO
Numerous studies have shown that changes in environmental factors can significantly impact and shift the structure of phytoplankton communities in marine ecosystems. However, little is known about the association between the ecological stoichiometry of seawater nutrients and phytoplankton community diversity and stability in subtropical bays. Therefore, we investigated the relationship between the phytoplankton community assemblage and seasonal variation in the Beibu Gulf, South China Sea. In this study, we found that the abundance of Bacillariophyceae in spring was relatively greater than in other seasons, whereas the abundance of Coscinodiscophyceae was relatively low in spring and winter but greatly increased in summer and autumn. Values of the alpha diversity indices gradually increased from spring to winter, revealing that seasonal variations shifted the phytoplankton community structure. The regression lines between the average variation degree and the Shannon index and Bray-Curtis dissimilarity values showed significantly positive correlations, indicating that high diversity was beneficial to maintaining community stability. In addition, the ecological stoichiometry of nutrients exhibited significantly positive associations with Shannon index and Bray-Curtis dissimilarity, demonstrating that ecological stoichiometry can significantly influence the alpha and beta diversity of phytoplankton communities. The C:N:P ratio was not statistically significantly correlated with average variation degree, suggesting that ecological stoichiometry rarely impacted the community stability. Temperature, nitrate, dissolved inorganic phosphorous, and total dissolved phosphorus were the main drivers of the phytoplankton community assemblage. The results of this study provide new perspectives about what influences phytoplankton community structure and the association between ecological stoichiometry, community diversity, and stability in response to environmental changes.
RESUMO
Small chromophytic phytoplankton (SCP) are anticipated to be more important for a significant proportion of primary production in estuarine-coastal ecosystems. However, responses of SCP community to coastal eutrophication are still unclear. In this study, we investigated diversity, co-occurrence and assembly features of SCP communities, as well as relationship with environmental factors in subtropical Beibu Gulf. The results exhibited that the alpha diversity and beta diversity of SCP communities were significantly different among eutrophic states. Co-occurrence network revealed a complex interaction that most amplicon sequence variants (ASVs) in modules of the network were specific to trophic states. Further, phylogenetic based ß-nearest taxon distance analyses revealed that stochastic processes mainly provided 69.26% contribution to SCP community assembly, whereas deterministic processes dominated community assembly in heavy eutrophic state. Overall, our findings elucidate the mechanism of diversity and assembly in SCP community and promote the understanding of SCP ecology related to subtropical coastal eutrophication.
Assuntos
Ecossistema , Fitoplâncton , Eutrofização , Filogenia , Fitoplâncton/fisiologia , Processos EstocásticosRESUMO
Accumulating research evidence has revealed that harmful algal blooms (HABs) can substantially affect the community structures of phytoplankton and heterotrophic bacteria in marine ecosystems. However, little is known about their species-specific interactions between phytoplankton and heterotrophic bacteria during the HABs period and about their interaction shifts in response to blooms. From this perspective, we investigated the co-occurrence of chromophytic phytoplankton and Vibrio during Phaeocystis globosa blooms in the Beibu Gulf. The results showed that Vibrio communities were distinct during the blooms, and P. globosa blooms resulted in a decline in phytoplankton alpha diversity, revealing that the blooms could affect their community compositions. The regression lines between the Shannon indices and Bray-Curtis distances of phytoplankton and Vibrio showed positive correlations with each other (p < 0.001), suggesting that they may have intrageneric symbiotic interactions overall. In addition, network analysis further demonstrated that relationships between phytoplankton and Vibrio were dominated by positive correlations, and more interaction modules were observed during the blooms, revealing that the blooms intensified synergistic association and mutual symbiotic interactions between them. Environmental factors (SiO32-, NH4+, NO3- and TN,) and P. globosa density more deeply affected network interactions between phytoplankton and Vibrio during the periods of P. globosa blooms than those before the blooms and after the blooms. This study provided new insight to elucidate community structure and interaction relationships between phytoplankton and Vibrio in response to P. globosa blooms and their ecological effects in marine ecosystems.
Assuntos
Haptófitas , Vibrio , Ecossistema , Proliferação Nociva de Algas , FitoplânctonRESUMO
Vibrio are widely distributed in aquatic environments and strongly associated with eutrophic environments and human health through the consumption of contaminated seafood. However, the response of the Vibrio community to seasonal variation in eutrophic environments is poorly understood. In this study, we used a Vibrio-specific 16S rRNA sequencing approach to reveal the seasonal distribution pattern and diversity of the Vibrio community in the Maowei Sea, Beibu Gulf of China. The Shannon diversity of the Vibrio community was highest in the summer, while ß-diversity analysis showed that Vibrio community structures were significantly different between seasons. Distance-based redundancy analysis (dbRDA) and Mantel test analysis suggested that total dissolved nitrogen (TDN), total dissolved phosphorus (TDP), dissolved inorganic nitrogen (DIN), salinity, and temperature were the key environmental factors shaping the Vibrio community structure, indicating a strong filtering effect of trophic condition on Vibrio communities. Furthermore, through random forest analysis, V. fluvialis, V. alginolyticus, V. proteolyticus, V. splendidus, and the other eight Vibrio species were more sensitive to eutrophic changes. This study revealed seasonal changes in Vibrio communities and the influence of environmental variation on Vibrio community composition, contributing to a better understanding of their potential ecological roles in a subtropical inland bay.
RESUMO
In this study, we investigated the specific bacterial distribution and the response of bacterial communities to shifts in environmental factors in the subtropical Beibu Gulf, southern China. The abundances of Actinobacteria, Bacilli, Planctomycetia, Thermoleophilia, Anaerolineae, and Synechococcophycideae were significantly higher in high eutrophic samples than in medium eutrophic and oligotrophic samples. Bacterial alpha-diversity was found greater in high eutrophication samples than in the other samples. Besides, Ponticaulis koreensis, Nautella italic, Anaerospora hongkongensis, Candidatus Aquiluna rubra, and Roseovarius pacificus were sensitive to trophic variation and thus could be used as eco-markers. In addition, the relative abundances of functional genes involving carbohydrate and amino acid metabolism were very high among the samples. We also found temperature, Chl-a, TDN and NO3- were the main environmental drivers of bacterial community structure. Overall, this study provides new insight into the composition of bacterial community and function response to gradients of eutrophication in Beibu Gulf.
Assuntos
Eutrofização , Alphaproteobacteria , China , Firmicutes , RhodobacteraceaeRESUMO
Members of the genus Vibrio are ubiquitous in aquatic environments and can be found either in a culturable or a viable but nonculturable (VBNC) state. Despite widespread concerns as to how to define the occurrence and dynamics of Vibrio populations by culture-independent approaches, further physiological research and relevant biotechnological developments will require the isolation and cultivation of the microbes from various environments. The present work provides data and perspectives on our understanding of culturable Vibrio community structure and diversity in the Beibu Gulf. Finally, we isolated 1,037 strains of Vibrio from 45 samples and identified 18 different species. Vibrio alginolyticus, V. cyclitrophicus, V. tasmaniensis, V. brasiliensis, and V. splendidus were the dominant species that had regional distribution characteristics. The correlation between the quantitative distribution and community structure of culturable Vibrio and environmental factors varied with the Vibrio species and geographical locations. Among them, salinity, nitrogen, and phosphorus were the main factors affecting the diversity of culturable Vibrio. These results help to fill a knowledge gap on Vibrio diversity and provide data for predicting and controlling pathogenic Vibrio outbreaks in the Beibu Gulf.
Assuntos
Biodiversidade , Filogenia , Vibrio/classificação , Vibrio/isolamento & purificação , Microbiologia da Água , China , Fósforo , RNA Ribossômico 16S , Salinidade , Vibrio/genética , Vibrio/fisiologiaRESUMO
Understanding the effects of eutrophication on heterotrophic bacteria, a primary responder to eutrophication, is critical for predicting the responses of ecosystems to marine environmental pollution. Vibrio are indigenous in coastal water and of significance to geochemical cycling and public health. In this study, we investigated the diversity and assembly features of Vibrio, as well as their relationship with the environmental factors in the subtropical Beibu Gulf. We found that the alpha diversity of Vibrio increased in parallel with the trophic state they occupy. A Mantel test indicated that the trophic state was correlated to Vibrio beta diversity and the correlation gradually strengthened at higher trophic states. Variation partitioning analysis suggested that the geographic distance was an important factor impacting the variables of Vibrio communities in all the samples, but nutrients exerted more influence in the more highly eutrophic samples. Our results demonstrated that stochastic processes govern the turnover of marine Vibrio communities in the Beibu Gulf and that ecological drift was the most important process for assembly of the Vibrio communities.
Assuntos
Ecossistema , Vibrio , Eutrofização , Processos Estocásticos , Vibrio/genéticaRESUMO
Phaeocystis globosa blooms are recognized as playing an essential role in shaping the structure of the marine community and its functions in marine ecosystems. In this study, we observed variation in the alpha diversity and composition of marine free-living bacteria during P. globosa blooms and identified key microbial community assembly patterns during the blooms. The results showed that the Shannon index was higher before the blooming of P. globosa in the subtropical bay. Marinobacterium (γ-proteobacteria), Erythrobacter (α-proteobacteria), and Persicobacter (Cytophagales) were defined as the most important genera, and they were more correlated with environmental factors at the terminal stage of P. globosa blooms. Furthermore, different community assembly processes were observed. Both the mean nearest relatedness index (NRI) and nearest taxon index (NTI) revealed the dominance of deterministic factors in the non-blooming and blooming periods of P. globosa, while the bacterial communities in marine waters after the blooms tended to be controlled by stochastic factors. Our findings revealed that the assembly of the bacterial community in marine P. globosa blooms is a complex process with mixture effects of marine microbiomes and environmental parameters.
RESUMO
BACKGROUND: Starch is a very abundant and renewable carbohydrate and is an important feedstock for industrial applications. The conventional starch liquefaction and saccharification processes are energy-intensive, complicated, and not environmentally friendly. Raw starch-digesting glucoamylases are capable of directly hydrolyzing raw starch to glucose at low temperatures, which significantly simplifies processing and reduces the cost of producing starch-based products. RESULTS: A novel raw starch-digesting glucoamylase PoGA15A with high enzymatic activity was purified from Penicillium oxalicum GXU20 and biochemically characterized. The PoGA15A enzyme had a molecular weight of 75.4 kDa, and was most active at pH 4.5 and 65 °C. The enzyme showed remarkably broad pH stability (pH 2.0-10.5) and substrate specificity, and was able to degrade various types of raw starches at 40 °C. Its adsorption ability for different raw starches was consistent with its degrading capacities for the corresponding substrate. The cDNA encoding the enzyme was cloned and heterologously expressed in Pichia pastoris. The recombinant enzyme could quickly and efficiently hydrolyze different concentrations of raw corn and cassava flours (50, 100, and 150 g/L) with the addition of α-amylase at 40 °C. Furthermore, when used in the simultaneous saccharification and fermentation of 150 g/L raw flours to ethanol with the addition of α-amylase, the ethanol yield reached 61.0 g/L with a high fermentation efficiency of 95.1 % after 48 h when raw corn flour was used as the substrate. An ethanol yield of 57.0 g/L and 93.5 % of fermentation efficiency were achieved with raw cassava flour after 36 h. In addition, the starch-binding domain deletion analysis revealed that SBD plays a very important role in raw starch hydrolysis by the enzyme PoGA15A. CONCLUSIONS: A novel raw starch-digesting glucoamylase from P. oxalicum, with high enzymatic activity, was biochemically, molecularly, and genetically identified. Its efficient hydrolysis of raw starches and its high efficiency during the direct conversion of raw corn and cassava flours via simultaneous saccharification and fermentation to ethanol suggests that the enzyme has a number of potential applications in industrial starch processing and starch-based ethanol production.
RESUMO
In this work, Aspergillus aculeatus M105 was obtained to produce high extracellular fructooligosaccharide-producing enzyme activity. The maximum yields of fructooligosaccharides produced by its extracellular enzymes and immobilized cells were 67.54 and 65.47% (w/w), respectively. A fructosyltransferase (FTase), AaFT32A, was purified from M105. The optimal pH and temperature of AaFT32A were pH 5.0-6.0 and 65 °C, respectively. The Km, Vmax, and kcat values for the transfructosylating activity of AaFT32A were 2267 mM, 1347 µmol/min/mg protein, and 1550.2 s(-1), respectively, and those values for the hydrolytic activity of AaFT32A were 6.10 mM, 32.44 µmol/min/mg protein, and 37.3 s(-1), respectively. The sequence of AaFT32A deduced from the cloned gene shared 99.4% identity with a FTase from Aspergillus japonicus CB05 and a fructofuranosidase from Aspergillus niger and 96.5% identity with a FTase (Aspacl_37092) from A. aculeatus ATCC 16872. The fungal strain and its FTase may have potential applications in the prebiotics industry.
Assuntos
Aspergillus/enzimologia , Células Imobilizadas , Proteínas Fúngicas/metabolismo , Hexosiltransferases/metabolismo , Oligossacarídeos/biossíntese , Aspergillus/genética , Cromatografia Líquida de Alta Pressão , Clonagem Molecular , Proteínas Fúngicas/genética , Hexosiltransferases/genética , Concentração de Íons de Hidrogênio , Cinética , Espectrometria de Massas , TemperaturaRESUMO
A newly isolated strain Penicillium sp. GXU20 produced a raw starch-degrading enzyme which showed optimum activity towards raw cassava starch at pH 4.5 and 50 °C. Maximum raw cassava starch-degrading enzyme (RCSDE) activity of 20 U/ml was achieved when GXU20 was cultivated under optimized conditions using wheat bran (3.0% w/v) and soybean meal (2.5% w/v) as carbon and nitrogen sources at pH 5.0 and 28 °C. This represented about a sixfold increment as compared with the activity obtained under basal conditions. Starch hydrolysis degree of 95% of raw cassava flour (150 g/l) was achieved after 72 h of digestion by crude RCSDE (30 U/g flour). Ethanol yield reached 53.3 g/l with fermentation efficiency of 92% after 48 h of simultaneous saccharification and fermentation of raw cassava flour at 150 g/l using the RCSDE (30 U/g flour), carried out at pH 4.0 and 40 °C. This strain and its RCSDE have potential applications in processing of raw cassava starch to ethanol.