CBX2 enhances the progression and TMZ chemoresistance of glioma via EZH2-mediated epigenetic silencing of PTEN expression.

Chromobox (CBX) 2, a member of the CBX protein family and a crucial component of the polycomb repressive complex (PRC), exerts significant influence on the epigenetic regulation of tumorigenesis, including glioma. However, the precise role of CBX2 in glioma has remained elusive. In our study, we observed a substantial upregulation of CBX2 expression in glioma, which displayed a strong correlation with pathological grade, chemoresistance, and unfavorable prognosis. Through a series of in vivo and in vitro experiments, we established that heightened CBX2 expression facilitated glioma cell proliferation and bolstered resistance to chemotherapy. Conversely, CBX2 knockdown led to a significant inhibition of glioma cell growth and a reduction in chemoresistance. Notably, our investigation uncovered the underlying mechanism by which CBX2 operates, primarily by inhibiting PTEN transcription and activating the AKT/mTOR signalling pathway. Conversely, silencing CBX2 curtailed cell proliferation and attenuated chemoresistance by impeding the activation of the PTEN/AKT/mTOR signalling pathway. Delving deeper into the molecular intricacies, we discovered that CBX2 can recruit EZH2 and modulate the trimethylation of histone H3 lysine 27 (H3K27me3) levels on the PTEN promoter, effectively suppressing PTEN transcription. Our research unveils a comprehensive understanding of how CBX2 impacts the tumorigenesis, progression, chemoresistance, and prognosis of glioma. Furthermore, it presents CBX2 as a promising therapeutic target for drug development and clinical management of glioma.

Highly stretchable, self-healing, antibacterial, conductive, and amylopectin-enhanced hydrogels with gallium droplets loading as strain sensors.

In this study, we address the challenge of developing highly conductive hydrogels with enhanced stretchability for use in wearable sensors, which are critical for the precise detection of human motion and subtle physiological strains. Our novel approach utilizes amylopectin, a biopolymer, for the uniform integration of liquid metal gallium into the hydrogel matrix. This integration results in a conductive hydrogel characterized by remarkable elasticity (up to 7100 % extensibility) and superior electrical conductance (Gauge Factor = 31.4), coupled with a minimal detection limit of less than 0.1 % and exceptional durability over 5000 cycles. The hydrogel demonstrates significant antibacterial activity, inhibiting microbial growth in moist environments, thus enhancing its applicability in medical settings. Employing a synthesis process that involves ambient condition polymerization of acrylic acid, facilitated by a hydrophobic associative framework, this hydrogel stands out for its rapid gelation and robust mechanical properties. The potential applications of this hydrogel extend beyond wearable sensors, promising advancements in human-computer interaction through technologies like wireless actuation of robotic systems. This study not only introduces a viable material for current wearable technologies but also sets a foundation for future innovations in bio-compatible sensors and interactive devices.

Volume-Metallization 3D-Printed Polymer Composites.

3D printing polymer or metal can achieve complicated structures while lacking multifunctional performance. Combined printing of polymer and metal is desirable and challenging due to their insurmountable mismatch in melting-point temperatures. Here, a novel volume-metallization 3D-printed polymer composite (VMPC) with bicontinuous phases for enabling coupled structure and function, which are prepared by infilling low-melting-point metal (LM) to controllable porous configuration is reported. Based on vacuum-assisted low-pressure conditions, LM is guided by atmospheric pressure action and overcomes surface tension to spread along the printed polymer pore channel, enabling the complete filling saturation of porous structures for enhanced tensile strength (up to 35.41 MPa), thermal (up to 25.29 Wm-1K-1) and electrical (>106 S m-1) conductivities. The designed 3D-printed microstructure-oriented can achieve synergistic anisotropy in mechanics (1.67), thermal (27.2), and electrical (>1012) conductivities. VMPC multifunction is demonstrated, including customized 3D electronics with elevated strength, electromagnetic wave-guided transport and signal amplification, heat dissipation device for chip temperature control, and storage components for thermoelectric generator energy conversion with light-heat-electricity.

Enhanced stability and biocompatibility of HIPEs stabilized by cyclodextrin-metal organic frameworks with inclusion of resveratrol and soy protein isolate for ß-carotene delivery.

High internal phase Pickering emulsions (HIPEs) constitute a significant research domain within colloid interface chemistry, addressing the demand for robust emulsion systems across various applications. An innovative nanoparticle, synthesized from a cyclodextrin metal-organic framework encapsulated with a composite of resveratrol and soy isolate protein (RCS), was employed to fortify a high internal phase emulsion. The emulsion's three-dimensional printing capabilities, alongside the encapsulated delivery efficacy for ß-carotene, were thoroughly examined. Cyclodextrin metal-organic frameworks (CD-MOFs), facilitated by cellulose nanofibrils, were synthesized to yield particles at the nanoscale, maintaining a remarkable 97.67 % cellular viability at an elevated concentration of 1000 µg/ml. The RCS nanoparticles demonstrated thermal stability and antioxidant capacities surpassing those of CD-MOF. The integration of soybean isolate protein augmented both the hydrophobicity (from 21.95 ± 0.64° to 59.15 ± 0.78°) and the interfacial tension (from 14.36 ± 0.46 mN/m to 5.34 ± 0.81 mN/m) of the CD-MOF encapsulated with resveratrol, thereby enhancing the RCS nanoparticles' adsorption at the oil-water interface with greater stability. The durability of the RCS-stabilized high internal phase emulsions was contingent upon the RCS concentration. Emulsions stabilized with 5 wt%-RCS exhibited optimal physical and chemical robustness, demonstrating superior performance in emulsion 3D printing and ß-carotene encapsulation delivery. This investigation furnishes a novel perspective on the amalgamation of food customization and precision nutrition.

Fabrication and characterization of an alginate-based film incorporated with cinnamaldehyde for fruit preservation.

Sodium alginate (SA) is widely used in the food, biomedical, and chemical industries due to its biocompatibility, biodegradability, and excellent film-forming properties. This article introduces a simple method for preparing uniform alginate-based packaging materials with exceptional properties for fruit preservation. The alginate was uniformly crosslinked by gradually releasing calcium ions triggered by the sustained hydrolysis of gluconolactone (GDL). A cinnamaldehyde (CA) emulsion, stabilized by xanthan without the use of traditional surfactants, was tightly incorporated into the alginate film to enhance its antimicrobial, antioxidant, and UV shielding properties. The alginate-based film effectively blocked ultraviolet rays in the range of 400-200 nm, while allowing for a visible light transmittance of up to 70 %. Additionally, it showed an increased water contact angle and decreased water vapor permeability. The alginate-based film was also employed in the preparation of coated paper through the commonly used coating process in the papermaking industry. The alginate-based material displayed excellent antioxidant properties and antimicrobial activity against Escherichia coli, Staphylococcus aureus and Botrytis cinerea, successfully extending the shelf life of strawberries to 7 days at room temperature. This low-cost and facile method has the potential to drive advancements in the food and biomedical fields by tightly incorporating active oil onto a wide range of biomacromolecule substrates.

Curcumin-loaded keratin-chitosan hydrogels for enhanced peripheral nerve regeneration.

Peripheral nerve injury often leads to symptoms of motor and sensory impairment, and slow recovery of nerves after injury and limited treatment methods will aggravate symptoms or even lead to lifelong disability. Curcumin can promote peripheral nerve regeneration, but how to accurately deliver the appropriate concentration of curcumin in the local peripheral nerve remains to be solved. In this study, we designed a human hair keratin/chitosan (C/K) hydrogel with sodium tripolyphosphate ions crosslinked to deliver curcumin topically. Chitosan improves the mechanical properties of hydrogels and keratin improves the biocompatibility of hydrogels. C/K hydrogel showed good cytocompatibility, histocompatibility and degradability. In vitro experiments showed that hydrogels can continuously release curcumin for up to 10 days. In addition, a comprehensive analysis of behavioral, electrophysiological, histology, and target organ recovery results in animal experiments showed that locally delivered curcumin can enhance nerve regeneration in addition to hydrogels. In short, we provide a new method that combines the advantages of human hair keratin, chitosan, and curcumin for nerve damage repair.

Hydrophobic association-improved multi-functional hydrogels with liquid metal droplets stabilized by xanthan gum and PEDOT:PSS for strain sensors.

The synthesis of liquid metal-infused hydrogels, typically constituted by polyacrylamide networks crosslinked through covalent bonds, often encounters a conundrum: they exhibit restricted extensibility and a diminished capacity for self-repair, owing to the inherently irreversible nature of the covalent linkages. This study introduces a hydrophobically associated hydrogel embedding gallium (Ga)-droplets, realized through the in situ free radical copolymerization of hydrophobic hexadecyl methacrylate (HMA) and hydrophilic acrylamide (AM) in a milieu containing xanthan gum (XG) and PEDOT:PSS, which co-stabilizes the Ga-droplets. The Ga-droplets, synergistically functioning as conductive agents alongside PEDOT:PSS, also expedite the hydrogel's formation. The resultant XG/PEDOT:PSS-Ga-P(AM-HMA) hydrogel is distinguished by its remarkable extensibility (2950 %), exceptional toughness (3.28 MJ/m3), superior adherence to hydrophobic, smooth substrates, and an innate ability for hydrophobic-driven self-healing. As a strain sensing medium, this hydrogel-based sensor exhibits heightened sensitivity (gauge factor = 12.66), low detection threshold (0.1 %), and robust durability (>500 cycles). Furthermore, the inclusion of glycerol endows the XG/PEDOT:PSS-Ga-P(AM-HMA) hydrogel with anti-freezing properties without compromising its mechanical integrity and sensing acumen. This sensor adeptly captures a spectrum of human movements, from the nuanced radial pulse to extensive joint articulations. This research heralds a novel approach for fabricating multifaceted PAM-based hydrogels with toughness and superior sensing capabilities.

Transparent, super stretchable, freezing-tolerant, self-healing ionic conductive cellulose based eutectogel for multi-functional sensors.

In this study, we propose a non - toxic and low-cost fabrication of cellulose-based eutectogel through the ZnCl2/H2O/H3PO4 deep eutectic solvent (DES) to dissolve cellulose followed by free-radical polymerization of acrylamide. Particularly, the introduction of cellulose enhances the mechanical properties of eutectogels while eliminating the environmental concerns of the traditional nanocellulose fabrication process. Owing to the dynamic transfer of ions in the eutectogel network, the prepared eutectogels exhibit adjustable conductivity (0.9- 1.37 Sm-1, 15 °C) and stretching sensitivity (Gauge factor = 5.4). The resulting DES - cellulose-based eutectogels (DCEs) exhibited ultra stretchability (4086 %), high toughness (261.3 MJ/m3), excellent ionic conductivity (1.64 Sm-1, 20 °C), high transparency (>85 %), outstanding antifreezing performance (<-80 °C), and other comprehensive characteristics. The DCEs had been proven to have multiple sensitivities to external stimuli, like temperature, strain, and pressure. As a result, the DCEs can be assembled into multifunctional sensors. Moreover, this work also demonstrated the satisfactory performance of DCEs in flexible electroluminescent devices. The low cost and high efficiency made the preparation method of this experiment an efficient strategy for developing high-performance cellulose-based eutectogels, which would greatly promote the application of such materials in areas such as artificial skin for soft robots and other wearable devices.

Mechanistic insight into the degradation of sulfadiazine by electro-Fenton system: Role of different reactive species.

Sulfadiazine (SDZ), a widely used effective antibiotic, is resistant to conventional biological treatment, which is concerning since untreated SDZ discharge can pose a significant environmental risk. Electro-Fenton (EF) technology is a promising advanced oxidation technology for efficiently removing SDZ. However, due to the limitations of traditional experimental methods, there is a lack of in-depth study on the mechanism of ·OH-dominated SDZ degradation in EF process. In this study, an EF system was established for SDZ degradation and the transformation products (TPs) were detected by mass spectrometry. Dynamic thermodynamic, kinetic and wave function analysis of reactants, transition states and intermediates were proposed by density functional theory calculations, which was applied to elucidate the underlying mechanism of SDZ degradation. Experimental results showed that amino, benzene, and pyrimidine sites in SDZ were oxidized by ·OH, producing TPs through hydrogen abstraction and addition reactions. ·OH was kinetically more likely to attack SDZ- than SDZ. Fe(IV) dominated the single-electron transfer oxidation reaction of SDZ, and the formed organic radicals can spontaneously generate the de-SO2 product via Smiles rearrangement. Toxicity experiments showed the toxicity of SDZ and TPs can be greatly reduced. The results of this study promote the understanding of SDZ degradation mechanism in-depth. ENVIRONMENTAL IMPLICATION: Sulfadiazine (SDZ) is one of the antibiotics widely used around the world. However, it has posed a significant environmental risk due to its overuse and cannot be efficiently removed by traditional treatment methods. The lack of in-depth study on SDZ degradation mechanism under reactive species limits the improvement of SDZ degradation efficiency. Therefore, this work focused on SDZ degradation mechanism in-depth under electro-Fenton system through reactive species investigation, mass spectrometry analysis, and theoretical calculation. The results in this study can provide a theoretical basis for improving the SDZ degradation efficiency which will contribute to solving SDZ pollution problems.

Hydraulic-driven adaptable morphing active-cooling elastomer with bioinspired bicontinuous phases.

The active-cooling elastomer concept, originating from vascular thermoregulation for soft biological tissue, is expected to develop an effective heat dissipation method for human skin, flexible electronics, and soft robots due to the desired interface mechanical compliance. However, its low thermal conduction and poor adaptation limit its cooling effects. Inspired by the bone structure, this work reports a simple yet versatile method of fabricating arbitrary-geometry liquid metal skeleton-based elastomer with bicontinuous Gyroid-shaped phases, exhibiting high thermal conductivity (up to 27.1 W/mK) and stretchability (strain limit >600%). Enlightened by the vasodilation principle for blood flow regulation, we also establish a hydraulic-driven conformal morphing strategy for better thermoregulation by modulating the hydraulic pressure of channels to adapt the complicated shape with large surface roughness (even a concave body). The liquid metal active-cooling elastomer, integrated with the flexible thermoelectric device, is demonstrated with various applications in the soft gripper, thermal-energy harvesting, and head thermoregulation.

A comprehensive review of the literature on CD10: its function, clinical application, and prospects.

CD10, a zinc-dependent metalloprotease found on the cell surface, plays a pivotal role in an array of physiological and pathological processes including cardiovascular regulation, immune function, fetal development, pain response, oncogenesis, and aging. Recognized as a biomarker for hematopoietic and tissue stem cells, CD10 has garnered attention for its prognostic potential in the progression of leukemia and various solid tumors. Recent studies underscore its regulatory significance and therapeutic promise in combating Alzheimer's disease (AD), and it is noted for its protective role in preventing heart failure (HF), obesity, and type-2 diabetes. Furthermore, CD10/substance P interaction has also been shown to contribute to the pain signaling regulation and immunomodulation in diseases such as complex regional pain syndrome (CRPS) and osteoarthritis (OA). The emergence of COVID-19 has sparked interest in CD10's involvement in the disease's pathogenesis. Given its association with multiple disease states, CD10 is a prime therapeutic target; inhibitors targeting CD10 are now being advanced as therapeutic agents. This review compiles recent and earlier literature on CD10, elucidating its physicochemical attributes, tissue-specific expression, and molecular functions. Furthermore, it details the association of CD10 with various diseases and the clinical advancements of its inhibitors, providing a comprehensive overview of its growing significance in medical research.

[Corrigendum] Long non­coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway.

Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re­examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF­7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'­AGACCATGTGGACCTGTCACTG­3', and reverse, 5'­GTTTGGAGTGGTAGAAATCTGTC­3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'­GAGGCAAAAGTCCTGTGTTCCAACT­3', and reverse, 5'­AAGAAATCCCTGTGGTTGCAGCAGCT­3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti­GAPDH antibodies was incorrectly stated as AbMart Bio­tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033­1042, 2019; DOI: 10.3892/ijo.2019.4679].

Using chitosan nanofibers to synergistically construct a highly stretchable multi-functional liquid mental-based hydrogel for assembling strain sensor with high sensitivity and broad working range.

Liquid metal (LM) microdroplets have garnered significant interest as conductive materials for initiating free radical polymerization in the development of conductive hydrogels suited for strain sensors. However, crafting multi-functional conductive hydrogels that boast both high stretchability and superior sensing capabilities remains as a challenge. In this study, we have successfully synthesized LM-based conductive hydrogels characterized by remarkable stretchability and sensing performance employing acrylic acid (AA) to evenly distribute chitosan nanofibers (CSFs) and to subsequently catalyze the free radical polymerization of AA. The resultant polymer network was crosslinked within situ polyacrylic acid (PAA), facilitated by Ga3+ in conjunction with guar gum (GG)-stabilized Ga droplets. The strategic interplay between the rigid, and protonated CSFs and the pliable PAA matrix, coupled with the ionic crosslinking of Ga3+, endows the resulting GG-Ga-CSF-PAA hydrogel with high stretchability (3700 %), ultrafast self-healing, robust moldability, and strong adhesiveness. When deployed as a strain sensing material, this hydrogel exhibits a high gauge factor (38.8), a minimal detection threshold, enduring durability, and a broad operational range. This versatility enables the hydrogel-based strain sensor to monitor a wide spectrum of human motions. Remarkably, the hydrogel maintains its stretchability and sensing efficacy under extreme temperatures after a simple glycerol solution treatment.

Using chitosan nanofibers to simultaneously improve the toughness and sensing performance of chitosan-based ionic conductive hydrogels.

Conductive hydrogels, especially polysaccharide-based ionic conductive hydrogels, have received increasing interest in the field of wearable sensors due to their similarity to human skin. Nevertheless, it is still a challenging task to simultaneously prepare a self-healed and adhesive conductive hydrogel with good toughness, temperature tolerance and high sensing performance, especially with high sensitivity and a low detection limit. Herein, we developed a new strategy to improve the toughness and sensing performance of a multifunctional conductive hydrogel by simultaneously using dissolved chitosan (CS) and solid chitosan nanofibers (CSFs) to induce the formation of hierarchical polymeric networks in the hydrogel. The tensile strength and elongation at break of the hydrogel could be improved from 70.3 kPa and 1005 % to 173.9 kPa and 1477 %, respectively, simply by introducing CSFs to the hydrogel, and its self-healing, adhesive and antibacterial properties were effectively retained. When serving as a resistive sensing material, the introduction of CSFs increased the gauge factor of the hydrogel-based strain sensor from 8.25 to 14.27. Moreover, the hydrogel-based strain sensor showed an ultralow detection limit of 0.2 %, excellent durability and stability (1000 cycles) and could be used to detect various human activities. In addition, the hydrogel prepared by using a water-glycerol binary solvent system showed temperature-tolerant performance and possessed adequate sensitivity when serving as a resistive sensing material. Therefore, this work provides a new way to prepare multifunctional conductive hydrogels with good toughness, sensing performance and temperature tolerance to expand the application range of hydrogel-based strain sensors.

Schiff base and coordinate bonds cross-linked chitosan-based eutectogels with ultrafast self-healing, self-adhesive, and anti-freezing capabilities for motion detection.

Ion conductors offer great potential for diverse electric applications. However, most of the ion conductors were fabricated from non - degradable petroleum-based polymers with non or low biodegradability, which inevitably leads to resource depletion and waste accumulation. Fabricating ion conductors based on renewable, and sustainable materials is highly desirable and valuable. Herein, a series of eutectogels were designed through dual-dynamic-bond cross-linking among ferric iron (Fe3+), protocatechualdehyde (PA), and chitosan (CS) in 1 - allyl-3 - methylimidazole chloride ionic liquid/urea (AmimCl/urea) eutectic-based ionic liquid. Due to the presence of AmimCl/urea eutectic-based ionic liquid, the obtained CS - PA@Fe eutectogels showed excellent ionic conductivity, superior anti-freezing properties that could maintain flexibility and high electrical properties at -20 °C. Dual-dynamic-bond cross-linking of catechol-Fe coordinate and dynamic Schiff base bonds equip CS - PA@Fe eutectogels with excellent injectable, and self-healing abilities. Additionally, due to the presence of phenolic hydroxyl groups of PA, the obtained CS - PA@Fe eutectogels present good adhesiveness. Based on the CS - PA@Fe eutectogels, multifunctional flexible strain sensors with high sensitivity, stability, as well as rapid response speed at wide operating temperature ranges were successfully fabricated. Thus, this study offers a promising strategy for fabricating naturally occurring biopolymers based eutectogels, which show great potential as high-performance flexible strain sensors for next-generation wearable electronic devices.

Lignosulfonate sodium and ionic liquid synergistically promote tough hydrogels for intelligent wearable human-machine interaction.

Flexible wearable devices are garnering significant interest, with conductive hydrogels emerging as a particularly notable category. While many of these hydrogels offer impressive conductivity, they often lack the innate ability to adhere autonomously to human skin. The ideal hydrogel should possess both superior adhesion properties and a wide responsive range. This study introduces a novel double-network conductive hydrogel, synthesized from lignosulfonate sodium and ionic liquid using a one-pot method. The gel's mechanical robustness (fracture elongation of ∼3500 % and tensile strength of ∼130 kPa) and exceptional conductivity sensing performance arise from the synergistic effects of electrostatic interactions, dynamic hydrogen bonding, and a three-dimensional network structure. Additionally, the phenolic hydroxyl and sulfonic groups from lignosulfonate sodium imbue the hydrogel with adhesive qualities, allowing it to easily bond with varied material surfaces. This hydrogel excels in human physiological signal detection and wireless monitoring, demonstrating a rapid response time (149 ms) and high sensitivity (a maximum gauge factor of 10.9 for strains between 400 and 600 %). Given these properties, the flexible, self-adhesive, and conductive hydrogel showcases immense promise for future applications in wearable devices and wireless transmission sensing.

TEMPO bacterial cellulose and MXene nanosheets synergistically promote tough hydrogels for intelligent wearable human-machine interaction.

Conductive hydrogels have received increasing attention in the field of wearable electronics, but they also face many challenges such as temperature tolerance, biocompatibility, and stability of mechanical properties. In this paper, a double network hydrogel of MXene/TEMPO bacterial cellulose (TOBC) system is proposed. Through solvent replacement, the hydrogel exhibits wide temperature tolerance (-20-60 °C) and stable mechanical properties. A large number of hydrogen bonds, MXene/TOBC dynamic three-dimensional network system, and micellar interactions endow the hydrogel with excellent mechanical properties (elongation at break ~2800 %, strength at break ~420 kPa) and self-healing ability. The introduction of tannic acid prevents the oxidation of MXene and the loss of electrical properties of the hydrogel. In addition, the sensor can also quickly (74 ms) and sensitive (gauge factor = 15.65) wirelessly monitor human motion, and the biocompatibility can well avoid the stimulation when it comes into contact with the human body. This series of research work reveals the fabrication of MXene-like flexible wearable electronic devices based on self-healing, good cell compatibility, high sensitivity, wide temperature tolerance and durability, which can be used in smart wearable, wireless monitoring, human-machine Interaction and other aspects show great application potential.

AKD Emulsions Stabilized by Guar Gel: A Highly Efficient Agent to Improve the Hydrophobicity of Cellulose Paper.

The aim of the present study was to investigate highly efficient alkyl ketene dimer (AKD) emulsions to improve the hydrophobicity of cellulose paper. AKD emulsions stabilized by guar gel were obtained; the guar gel was prepared by hydrogen bond cross-linking sodium tetraborate and guar gum. The cross-linking was confirmed by combining FTIR and SEM. The effect of guar gel on the performance of the AKD emulsions was also studied by testing AKD emulsions stabilized by different guar gel concentrations. The results showed that with increasing guar gel concentration, the stability of the AKD emulsions improved, the droplet diameter decreased, and the hydrophobicity and water resistance of the sized packaging paper were gradually enhanced. Through SEM, the guar gel film covering the AKD emulsion droplet surface and the three-dimensional structure in the aqueous dispersion phase were assessed. This study constructed a scientific and efficient preparation method for AKD emulsions and provided a new method for the application of carbohydrate polymer gels which may avoid the adverse effect of surfactant on paper sizing and environmental problems caused by surfactant bioaccumulation.

Establishing a Corrugated Carbon Network with a Crack Structure in a Hydrogel for Improving Sensing Performance.

Electronic conductive hydrogels have prompted immense research interest as flexible sensing materials. However, establishing a continuous electronic conductive network within a hydrogel is still highly challenging. Herein, we develop a new strategy to establish a continuous corrugated carbon network within a hydrogel by embedding carbonized crepe paper into the hydrogel with its corrugations perpendicular to the stretching direction using a casting technique. The corrugated carbon network within the as-prepared composite hydrogel serves as a rigid conductive network to simultaneously improve the tensile strength and conductivity of the composite hydrogel. The composite hydrogel also generates a crack structure when it is stretched, enabling the composite hydrogel to show ultrahigh sensitivity (gauge factor = 59.7 and 114 at strain ranges of 0-60 and 60-100%, respectively). The composite hydrogel also shows an ultralow detection limit of 0.1%, an ultrafast response/recovery time of 75/95 ms, and good stability and durability (5000 cycles at 10% strain) when used as a resistive strain sensing material. Moreover, the good stretchability, adhesiveness, and self-healing ability of the hydrogel were also effectively retained after the corrugated carbon network was introduced into the hydrogel. Because of its outstanding sensing performance, the composite hydrogel has potential applications in sensing various human activities, including accurately recording subtle variations in wrist pulse waves and small-/large-scale complex human activities. Our work provides a new approach to develop economical, environmentally friendly, and reliable electronic conductive hydrogels with ultrahigh sensing performance for the future development of electronic skin and wearable devices.

Ultrastable Emulsion Stabilized by the Konjac Glucomannan-Xanthan Gum Complex.

Surfactant-free emulsions are currently gaining increased interest due to their technofunctional, health-promoting, economic, biocompatible, and sustainable characteristics. Herein, we report an ultrastable, surfactant-free emulsion stabilized by the konjac glucomannan (KGM)-xanthan gum (XG) complex. The results suggested that KGM-XG tended to adsorb onto the oil/water interface, causing a reduction in interfacial tension. The emulsion droplets were less than 1 µm in diameter and had a narrow size distribution. Using laser confocal microscopy and cryo-SEM, it was observed that KGM-XG generated a compact film on the surface of emulsion droplets while simultaneously constructing a three-dimensional network in the continuous phase. Both of these factors contributed to the stability of the emulsion. The present study presents a straightforward approach for producing highly stable emulsions stabilized by polysaccharides. These emulsions can be effectively utilized to enhance the water resistance of cellulose paper, which is extensively employed in the packaging industry.