Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 82
Filtrar
Mais filtros












Base de dados
Intervalo de ano de publicação
1.
J Cell Sci ; 137(19)2024 Oct 01.
Artigo em Inglês | MEDLINE | ID: mdl-39350674

RESUMO

SGEF (also known as ARHGEF26), a RhoG specific GEF, can form a ternary complex with the Scribble polarity complex proteins Scribble and Dlg1, which regulates the formation and maintenance of adherens junctions and barrier function of epithelial cells. Notably, silencing SGEF results in a dramatic downregulation of both E-cadherin and ZO-1 (also known as TJP1) protein levels. However, the molecular mechanisms involved in the regulation of this pathway are not known. Here, we describe a novel signaling pathway governed by the Scribble-SGEF-Dlg1 complex. Our results show that the three members of the ternary complex are required to maintain the stability of the apical junctions, ZO-1 protein levels and tight junction (TJ) permeability. In contrast, only SGEF is necessary to regulate E-cadherin levels. The absence of SGEF destabilizes the E-cadherin-catenin complex at the membrane, triggering a positive feedback loop that exacerbates the phenotype through the repression of E-cadherin transcription in a process that involves the internalization of E-cadherin by endocytosis, ß-catenin signaling and the transcriptional repressor Slug (also known as SNAI2).


Assuntos
Caderinas , Células Epiteliais , Proteínas de Membrana , Fatores de Troca de Nucleotídeo Guanina Rho , Fatores de Transcrição da Família Snail , Proteína da Zônula de Oclusão-1 , Caderinas/metabolismo , Caderinas/genética , Humanos , Células Epiteliais/metabolismo , Proteína da Zônula de Oclusão-1/metabolismo , Proteína da Zônula de Oclusão-1/genética , Proteínas de Membrana/metabolismo , Proteínas de Membrana/genética , Fatores de Transcrição da Família Snail/metabolismo , Fatores de Transcrição da Família Snail/genética , Fatores de Troca de Nucleotídeo Guanina Rho/metabolismo , Fatores de Troca de Nucleotídeo Guanina Rho/genética , Animais , Proteína 1 Homóloga a Discs-Large/metabolismo , Proteína 1 Homóloga a Discs-Large/genética , Proteínas Supressoras de Tumor/metabolismo , Proteínas Supressoras de Tumor/genética , Transcrição Gênica , Fatores de Transcrição/metabolismo , Fatores de Transcrição/genética , Células Madin Darby de Rim Canino , Junções Íntimas/metabolismo , Cães , Transdução de Sinais , Peptídeos e Proteínas de Sinalização Intracelular/metabolismo , Peptídeos e Proteínas de Sinalização Intracelular/genética , Estabilidade Proteica , beta Catenina/metabolismo , beta Catenina/genética
2.
Dev Biol ; 517: 28-38, 2024 Sep 16.
Artigo em Inglês | MEDLINE | ID: mdl-39293747

RESUMO

Cachexia and systemic organ wasting are metabolic syndrome often associated with cancer. However, the exact mechanism of cancer associated cachexia like syndrome still remain elusive. In this study, we utilized a scribble (scrib) knockdown induced hindgut tumor to investigate the role of JNK kinase in cachexia like syndrome. Scrib, a cell polarity regulator, also acts as a tumor suppressor gene. Its loss and mis-localization are reported in various type of malignant cancer-like breast, colon and prostate cancer. The scrib knockdown flies exhibited male lethality, reduced life span, systemic organ wasting and increased pJNK level in hindgut of female flies. Interestingly, knocking down of human JNK Kinase analogue, hep, in scrib knockdown background in hindgut leads to restoration of loss of scrib mediated lethality and systemic organ wasting. Our data showed that scrib loss in hindgut is capable of inducing cancer associated cachexia like syndrome. Here, we firstly report that blocking the JNK signaling pathway effectively rescued the cancer cachexia induced by scrib knockdown, along with its associated gut barrier disruption. These findings have significantly advanced our understanding of cancer cachexia and have potential implications for the development of therapeutic strategies. However, more research is needed to fully understand the complex mechanisms underlying this condition.

3.
Am J Physiol Cell Physiol ; 327(5): C1323-C1334, 2024 Nov 01.
Artigo em Inglês | MEDLINE | ID: mdl-39279492

RESUMO

Cellular changes in carcinomas include alterations in cell proliferation, cell migration, cell-cell adhesion, and cellular polarity. In vitro studies have revealed that the water channels, aquaporin-1 (AQP1) and AQP3, can influence cell migration and cell-cell adhesion. Of note, we previously showed that AQP1 overexpression reduced levels of cell-cell adhesion proteins, whereas AQP3 increased levels when overexpressed in normal epithelial cells. Expression of AQP1 and AQP3 in breast carcinoma is associated with lymph node metastasis, recurrence, and poor survival of patients with breast cancer. In this study, we investigated if AQP1 and AQP3 affected cell polarity in breast cancer by studying the relationship between the major polarity protein Scribble and AQP1 and AQP3. In breast cancer tissue samples, the protein expression of AQP1, AQP3, and Scribble did not show an obvious correlation. However, in a GST pull-down assay, AQP1 and AQP3 interacted with Scribble. AQP1 overexpression reduced the size of 3D spheroids as well as reduced Scribble levels at cell-cell contacts, whereas AQP3 overexpression showed no significant change in spheroid size compared with control, AQP3 overexpression also reduced Scribble levels at cell-cell contacts. Of note, AQP1 overexpression increased cell migration and induced cell detachment and dissemination from migrating breast cancer cell sheets, whereas AQP3 overexpression did not. Thus, AQP1 and AQP3 differentially affect 3D-grown breast cancer spheroids, and especially AQP1 may contribute to cancer development and spread via negatively affecting cellular junctions and cell polarity proteins as well as increasing cell migration and cell detachment.NEW & NOTEWORTHY Overexpression of the water channels aquaporin-1 and aquaporin-3 reduced levels of the key polarity protein Scribble at cell-cell junctions, suggesting potential implications in breast cancer progression and metastasis.


Assuntos
Aquaporina 1 , Aquaporina 3 , Neoplasias da Mama , Polaridade Celular , Proteínas de Membrana , Proteínas Supressoras de Tumor , Feminino , Humanos , Aquaporina 1/metabolismo , Aquaporina 1/genética , Aquaporina 3/metabolismo , Aquaporina 3/genética , Neoplasias da Mama/patologia , Neoplasias da Mama/metabolismo , Neoplasias da Mama/genética , Adesão Celular , Linhagem Celular Tumoral , Movimento Celular , Células MCF-7 , Proteínas de Membrana/metabolismo , Proteínas de Membrana/genética , Esferoides Celulares/metabolismo , Esferoides Celulares/patologia , Proteínas Supressoras de Tumor/metabolismo , Proteínas Supressoras de Tumor/genética
4.
Med Image Anal ; 97: 103274, 2024 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-39043109

RESUMO

High performance of deep learning on medical image segmentation rely on large-scale pixel-level dense annotations, which poses a substantial burden on medical experts due to the laborious and time-consuming annotation process, particularly for 3D images. To reduce the labeling cost as well as maintain relatively satisfactory segmentation performance, weakly-supervised learning with sparse labels has attained increasing attentions. In this work, we present a scribble-based framework for medical image segmentation, called Dynamically Mixed Soft Pseudo-label Supervision (DMSPS). Concretely, we extend a backbone with an auxiliary decoder to form a dual-branch network to enhance the feature capture capability of the shared encoder. Considering that most pixels do not have labels and hard pseudo-labels tend to be over-confident to result in poor segmentation, we propose to use soft pseudo-labels generated by dynamically mixing the decoders' predictions as auxiliary supervision. To further enhance the model's performance, we adopt a two-stage approach where the sparse scribbles are expanded based on predictions with low uncertainties from the first-stage model, leading to more annotated pixels to train the second-stage model. Experiments on ACDC dataset for cardiac structure segmentation, WORD dataset for 3D abdominal organ segmentation and BraTS2020 dataset for 3D brain tumor segmentation showed that: (1) compared with the baseline, our method improved the average DSC from 50.46% to 89.51%, from 75.46% to 87.56% and from 52.61% to 76.53% on the three datasets, respectively; (2) DMSPS achieved better performance than five state-of-the-art scribble-supervised segmentation methods, and is generalizable to different segmentation backbones. The code is available online at: https://github.com/HiLab-git/DMSPS.


Assuntos
Imageamento Tridimensional , Humanos , Imageamento Tridimensional/métodos , Aprendizado Profundo , Aprendizado de Máquina Supervisionado , Algoritmos , Processamento de Imagem Assistida por Computador/métodos , Interpretação de Imagem Assistida por Computador/métodos
5.
Int J Mol Sci ; 25(3)2024 Feb 05.
Artigo em Inglês | MEDLINE | ID: mdl-38339183

RESUMO

The main characteristic of polycystic kidney disease is the development of multiple fluid-filled renal cysts. The discovery of mislocalized sodium-potassium pump (Na,K-ATPase) in the apical membrane of cyst-lining epithelia alluded to reversal of polarity as a possible explanation for the fluid secretion. The topic of apical Na,K-ATPase in cysts remains controversial. We investigated the localization of the Na,K-ATPase and assessed the apical-basolateral polarization of cyst-lining epithelia by means of immunohistochemistry in kidney tissue from six polycystic kidney disease patients undergoing nephrectomy. The Na,K-ATPase α1 subunit was conventionally situated in the basolateral membrane of all immunoreactive cysts. Proteins of the Crumbs and partitioning defective (Par) complexes were localized to the apical membrane domain in cyst epithelial cells. The apical targeting protein Syntaxin-3 also immunolocalized to the apical domain of cyst-lining epithelial cells. Proteins of the basolateral Scribble complex immunolocalized to the basolateral domain of cysts. Thus, no deviations from the typical epithelial distribution of basic cell polarity proteins were observed in the cysts from the six patients. Furthermore, we confirmed that cysts can originate from virtually any tubular segment with preserved polarity. In conclusion, we find no evidence of a reversal in apical-basolateral polarity in cyst-lining epithelia in polycystic kidney disease.


Assuntos
Cistos , Doenças Renais Policísticas , Humanos , ATPase Trocadora de Sódio-Potássio/metabolismo , Polaridade Celular , Doenças Renais Policísticas/metabolismo , Epitélio/metabolismo , Membrana Celular/metabolismo , Proteínas Qa-SNARE/metabolismo , Cistos/metabolismo , Rim/metabolismo
6.
J Neurosci ; 44(4)2024 Jan 24.
Artigo em Inglês | MEDLINE | ID: mdl-38050135

RESUMO

N-methyl-D-aspartate receptors (NMDARs) are crucial for neuronal development and synaptic plasticity. Dysfunction of NMDARs is associated with multiple neurodevelopmental disorders, including epilepsy, autism spectrum disorder, and intellectual disability. Understanding the impact of genetic variants of NMDAR subunits can shed light on the mechanisms of disease. Here, we characterized the functional implications of a de novo mutation of the GluN2A subunit (P1199Rfs*32) resulting in the truncation of the C-terminal domain. The variant was identified in a male patient with epileptic encephalopathy, multiple seizure types, severe aphasia, and neurobehavioral changes. Given the known role of the CTD in NMDAR trafficking, we examined changes in receptor localization and abundance at the postsynaptic membrane using a combination of molecular assays in heterologous cells and rat primary neuronal cultures. We observed that the GluN2A P1199Rfs*32-containing receptors traffic efficiently to the postsynaptic membrane but have increased extra-synaptic expression relative to WT GluN2A-containing NMDARs. Using in silico predictions, we hypothesized that the mutant would lose all PDZ interactions, except for the recycling protein Scribble1. Indeed, we observed impaired binding to the scaffolding protein postsynaptic protein-95 (PSD-95); however, we found the mutant interacts with Scribble1, which facilitates the recycling of both the mutant and the WT GluN2A. Finally, we found that neurons expressing GluN2A P1199Rfs*32 have fewer synapses and decreased spine density, indicating compromised synaptic transmission in these neurons. Overall, our data show that GluN2A P1199Rfs*32 is a loss-of-function variant with altered membrane localization in neurons and provide mechanistic insight into disease etiology.


Assuntos
Transtorno do Espectro Autista , Epilepsia , Animais , Humanos , Masculino , Ratos , Transtorno do Espectro Autista/metabolismo , Epilepsia/genética , Epilepsia/metabolismo , Neurônios/fisiologia , Receptores de N-Metil-D-Aspartato/genética , Receptores de N-Metil-D-Aspartato/metabolismo , Transdução de Sinais , Sinapses/fisiologia
7.
Reprod Sci ; 31(1): 128-138, 2024 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-37603234

RESUMO

Despite its prevalence and the severity of symptoms, little is known about the pathogenesis and etiology of adenomyosis. In our previous study, Scribble localization has been found to be partially translocated to cytoplasm; however, its regulatory mechanism is known. In consideration of the important role of supraphysiologic estrogen production in the endometrium in the development of adenomyosis, we analyzed the effect and mechanism of estrogen on Scribble localization in vivo and in vitro. Firstly, we found Scribble translocation from the basolateral membrane to the cytoplasm was easily to be seen in women and mice with adenomyosis (68% vs 27%, 60% vs 10% separately). After treatment with the S-palmitoylation inhibitor 2-bromopalmitate for 48H, cytoplasmic enrichment of Scribble and the reduced level of palm-Scribble was observed by immunofluorescence, Western blot, and acyl-biotin exchange palmitoylation assay. High estrogen exposure could not only induce partially cytoplasmic translocation of Scribble but also decrease the expression level of palm-Scribble, which can be recovered by estrogen receptor inhibitor ICI182,780. Based on following experiments, we found that estrogen regulated Scribble localization by APT through S-palmitoylation of Scribble protein. At last, IHC was performed to verify the expression of APT1 and APT2 in human clinical tissue specimens and found that they were all increased dramatically. Furthermore, positive correlations were found between APT1 or APT2 and aromatase P450. Therefore, our research may provide a new understanding of the pathogenesis of adenomyosis.


Assuntos
Adenomiose , Feminino , Humanos , Animais , Camundongos , Adenomiose/metabolismo , Lipoilação , Endométrio/metabolismo , Estrogênios/metabolismo , Células Epiteliais/metabolismo
8.
Cell Rep ; 42(11): 113303, 2023 11 28.
Artigo em Inglês | MEDLINE | ID: mdl-37924514

RESUMO

Tumor-suppressive cell competition (TSCC) is a conserved surveillance mechanism in which neighboring cells actively eliminate oncogenic cells. Despite overwhelming studies showing that the unfolded protein response (UPR) is dysregulated in various tumors, it remains debatable whether the UPR restrains or promotes tumorigenesis. Here, using Drosophila eye epithelium as a model, we uncover a surprising decisive role of the Ire1 branch of the UPR in regulating cell polarity gene scribble (scrib) loss-induced TSCC. Both mutation and hyperactivation of Ire1 accelerate elimination of scrib clones via inducing apoptosis and autophagy, respectively. Unexpectedly, relative Ire1 activity is also crucial for determining loser cell fate, as dysregulating Ire1 signaling in the surrounding healthy cells reversed the "loser" status of scrib clones by decreasing their apoptosis. Furthermore, we show that Ire1 is required for cell competition in mammalian cells. Together, these findings provide molecular insights into scrib-mediated TSCC and highlight Ire1 as a key determinant of loser cell fate.


Assuntos
Proteínas de Drosophila , Neoplasias , Animais , Competição entre as Células , Drosophila/metabolismo , Proteínas de Drosophila/genética , Proteínas de Drosophila/metabolismo , Mamíferos/metabolismo , Neoplasias/genética , Neoplasias/patologia , Transdução de Sinais/genética , Resposta a Proteínas não Dobradas
9.
Dis Model Mech ; 16(8)2023 08 01.
Artigo em Inglês | MEDLINE | ID: mdl-37589075

RESUMO

Planar cell polarity (PCP) plays critical roles in developmental and homeostatic processes. Membrane presentation of PCP complexes containing Van Gogh-like (VANGL) transmembrane proteins is central to PCP and can be directed by the scaffold protein scribble (SCRIB). The role atypical linear ubiquitin (Met1-Ub) chains might play in PCP is unknown. Here, HEK293 cell-based interactomic analyses of the Met1-Ub deubiquitinase OTULIN revealed that OTULIN can interact with SCRIB. Moreover, Met1-Ub chains associated with VANGL2 and PRICKLE1, but not SCRIB, can direct VANGL2 surface presentation. Mouse embryos lacking Otulin showed variable neural tube malformations, including rare open neural tubes, a deficit associated with PCP disruption in mice. In Madin-Darby canine kidney cells, in which the enrichment of VANGL2-GFP proteins at cell-cell contacts represents activated PCP complexes, endogenous OTULIN was recruited to these sites. In the human MDA-MB-231 breast cancer cell model, OTULIN loss caused deficits in Wnt5a-induced filopodia extension and trafficking of transfected HA-VANGL2. Taken together, these findings support a role for linear (de)ubiquitination in PCP signaling. The association of Met1-Ub chains with PCP complex components offers new opportunities for integrating PCP signaling with OTULIN-dependent immune and inflammatory pathways.


Assuntos
Polaridade Celular , Endopeptidases , Proteínas de Membrana , Animais , Cães , Feminino , Humanos , Camundongos , Células HEK293 , Ubiquitina , Ubiquitinação , Células Madin Darby de Rim Canino , Células MDA-MB-231 , Endopeptidases/metabolismo , Proteínas de Membrana/metabolismo
10.
Biochim Biophys Acta Mol Basis Dis ; 1869(8): 166823, 2023 12.
Artigo em Inglês | MEDLINE | ID: mdl-37632981

RESUMO

BACKGROUNDS AND AIMS: Liver cancer is the sixth most common type of cancer and the fifth leading cause of cancer mortality worldwide. Scribble has been shown to function as a neoplastic tumor suppressor gene in most tumors. Our previous studies reported that down-regulation or mislocalization of Scribble was sufficient to initiate mammary tumorigenesis and NSCLC. Recently, it was reported that Scribble was highly expressed in hepatocellular carcinoma (HCC). We aim to study how it was up-regulated and the contradictory role of Scribble in HCC. METHODS AND RESULTS: Using a mouse model of carbon tetrachloride (CCl4)-induced liver fibrosis system, we showed that Scribble was over-expressed and which may protect the mice against hepatic fibrosis. Unexpectedly, we found out the potential for Scribble to act as a tumor driver at the advanced stage of N-nitrosodiethylamine (DEN) plus CCl4 induced HCC mice model in vivo. In addition, we observed even higher expression of Scribble in HCC tumors harboring elevated levels of wild-type p53. Most importantly, nuclear translocated Scribble could interact with p53, which lead to enhanced stability and transcriptional activity of p53. Mechanistically, our data suggested that Scribble might drive HCC progression by promoting metabolic regulation of p53 through p53-upregulated modulator of apoptosis (PUMA)-mediated Warburg effect. CONCLUSIONS: Our data identified the molecular basis of hepatic fibrosis-specific gene expression of polarity gene, such as Scribble. Interestingly, with the progression from fibrosis to cirrhosis to HCC, its nuclear translocation promoted a wild-type p53-mediated cancer metabolic switch and tumor progression in HCC. Taken together, we demonstrated that Scribble was up-regulated and served a protective role in liver fibrosis, while also apparently acting as a tumor driver in fibrosis-dependent hepatocarcinogenesis.


Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , Neoplasias Pulmonares , Animais , Carcinoma Hepatocelular/induzido quimicamente , Carcinoma Hepatocelular/genética , Proteína Supressora de Tumor p53/genética , Neoplasias Hepáticas/genética , Proteínas Reguladoras de Apoptose , Carcinogênese/genética , Cirrose Hepática/genética , Apoptose , Modelos Animais de Doenças , Glicólise
11.
Biochim Biophys Acta Mol Cell Res ; 1870(7): 119536, 2023 10.
Artigo em Inglês | MEDLINE | ID: mdl-37437846

RESUMO

Cell polarity refers to the asymmetric distribution of biomacromolecules that enable the correct orientation of a cell in a particular direction. It is thus an essential component for appropriate tissue development and function. Viral infections can lead to dysregulation of polarity. This is associated with a poor prognosis due to viral interference with core cell polarity regulatory scaffolding proteins that often feature PDZ (PSD-95, DLG, and ZO-1) domains including Scrib, Dlg, Pals1, PatJ, Par3 and Par6. PDZ domains are also promiscuous, binding to several different partners through their C-terminal region which contain PDZ-binding motifs (PBM). Numerous viruses encode viral effector proteins that target cell polarity regulators for their benefit and include papillomaviruses, flaviviruses and coronaviruses. A better understanding of the mechanisms of action utilised by viral effector proteins to subvert host cell polarity sigalling will provide avenues for future therapeutic intervention, while at the same time enhance our understanding of cell polarity regulation and its role tissue homeostasis.


Assuntos
Polaridade Celular , Transdução de Sinais
12.
Acta Pharmacol Sin ; 44(11): 2307-2321, 2023 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-37402999

RESUMO

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.


Assuntos
Neoplasias da Mama , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Feminino , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Neoplasias da Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Processamento Alternativo , Éxons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Proteínas Supressoras de Tumor/metabolismo
13.
Proc Natl Acad Sci U S A ; 120(23): e2220851120, 2023 06 06.
Artigo em Inglês | MEDLINE | ID: mdl-37252981

RESUMO

G protein-coupled receptors, including PTHR, are pivotal for controlling metabolic processes ranging from serum phosphate and vitamin D levels to glucose uptake, and cytoplasmic interactors may modulate their signaling, trafficking, and function. We now show that direct interaction with Scribble, a cell polarity-regulating adaptor protein, modulates PTHR activity. Scribble is a crucial regulator for establishing and developing tissue architecture, and its dysregulation is involved in various disease conditions, including tumor expansion and viral infections. Scribble co-localizes with PTHR at basal and lateral surfaces in polarized cells. Using X-ray crystallography, we show that colocalization is mediated by engaging a short sequence motif at the PTHR C-terminus using Scribble PDZ1 and PDZ3 domain, with binding affinities of 31.7 and 13.4 µM, respectively. Since PTHR controls metabolic functions by actions on renal proximal tubules, we engineered mice to selectively knockout Scribble in proximal tubules. The loss of Scribble impacted serum phosphate and vitamin D levels and caused significant plasma phosphate elevation and increased aggregate vitamin D3 levels, whereas blood glucose levels remained unchanged. Collectively these results identify Scribble as a vital regulator of PTHR-mediated signaling and function. Our findings reveal an unexpected link between renal metabolism and cell polarity signaling.


Assuntos
Fosfatos , Vitamina D , Camundongos , Animais , Ligação Proteica , Vitaminas , Receptores de Hormônios Paratireóideos/metabolismo , Homeostase , Hormônio Paratireóideo/metabolismo , Receptor Tipo 1 de Hormônio Paratireóideo/metabolismo , Peptídeos e Proteínas de Sinalização Intracelular/metabolismo
14.
J Cell Sci ; 136(7)2023 04 01.
Artigo em Inglês | MEDLINE | ID: mdl-37039101

RESUMO

Finely tuned regulation of transport protein localization is vital for epithelial function. The Na+-HCO3- co-transporter NBCn1 (also known as SLC4A7) is a key contributor to epithelial pH homeostasis, yet the regulation of its subcellular localization is not understood. Here, we show that a predicted N-terminal ß-sheet and short C-terminal α-helical motif are essential for NBCn1 plasma membrane localization in epithelial cells. This localization was abolished by cell-cell contact disruption, and co-immunoprecipitation (co-IP) and proximity ligation (PLA) revealed NBCn1 interaction with E-cadherin and DLG1, linking it to adherens junctions and the Scribble complex. NBCn1 also interacted with RhoA and localized to lamellipodia and filopodia in migrating cells. Finally, analysis of native and GFP-tagged NBCn1 localization, subcellular fractionation, co-IP with Arl13B and CEP164, and PLA of NBCn1 and tubulin in mitotic spindles led to the surprising conclusion that NBCn1 additionally localizes to centrosomes and primary cilia in non-dividing, polarized epithelial cells, and to the spindle, centrosomes and midbodies during mitosis. We propose that NBCn1 traffics between lateral junctions, the leading edge and cell division machinery in Rab11 endosomes, adding new insight to the role of NBCn1 in cell cycle progression.


Assuntos
Membrana Celular , Centrossomo , Cílios , Simportadores de Sódio-Bicarbonato , Fuso Acromático , Humanos , Animais , Ratos , Membrana Celular/química , Cílios/química , Centrossomo/química , Fuso Acromático/química , Simportadores de Sódio-Bicarbonato/análise , Simportadores de Sódio-Bicarbonato/metabolismo , Ciclo Celular , AMP Cíclico/metabolismo , Polaridade Celular , Células Epiteliais/metabolismo
15.
J Clin Med ; 12(2)2023 Jan 04.
Artigo em Inglês | MEDLINE | ID: mdl-36675340

RESUMO

BACKGROUND: Treatment and outcomes of breast cancer, one of the most prevalent female cancers, have improved in recent decades. However, metastatic breast cancer remains incurable in most cases, and new therapies are needed to ameliorate prognosis. Planar cell polarity (PCP) is a characteristic of epithelial cells that form layers and is integral to the communication of these cells with neighboring cells. Dysfunction of PCP is observed in cancers and may confer a targetable vulnerability. METHODS: The breast cancer cohorts from The Cancer Genome Atlas (TCGA) and the METABRIC study were interrogated for molecular alterations in genes of the PCP pathway. The groups with the most prevalent alterations were characterized, and survival was compared with counterparts not possessing PCP alterations. Breast cancer cell lines with PCP alterations from the Cancer Cell Line Encyclopedia (CCLE) were interrogated for sensitivity to drugs affecting PCP. RESULTS: Among genes of the PCP pathway, VANGL2, NOS1AP and SCRIB display amplifications in a sizable minority of breast cancers. Concomitant up-regulation at the mRNA level can be observed mostly in basal cancers, but it does not correlate well with the amplification status of the genes, as it can also be observed in non-amplified cases. In an exploration of cell line models, two of the four breast cancer cell line models with amplifications in VANGL2, NOS1AP and SCRIB display sensitivity to drugs inhibiting acyl-transferase porcupine interfering with the WNT pathway. This sensitivity suggests a possible therapeutic role of these inhibitors in cancers bearing the amplifications. CONCLUSION: Molecular alterations in PCP genes can be observed in breast cancers with a predilection for the basal sub-type. An imperfect correlation of copy number alterations with mRNA expression suggests that post-translational modifications are important in PCP regulation. Inhibitors of acyl-transferase porcupine may be rational candidates for combination therapy development in PCP-altered breast cancers.

16.
FEBS J ; 290(11): 2868-2880, 2023 06.
Artigo em Inglês | MEDLINE | ID: mdl-36609831

RESUMO

The cell polarity regulator Scribble has been shown to be a critical regulator of the establishment and development of tissue architecture, and its dysregulation promotes or suppresses tumour development in a context-dependent manner. Scribble activity is subverted by numerous viruses. This includes human papillomaviruses (HPVs), who target Scribble via the E6 protein. Binding of E6 from high-risk HPV strains to Scribble via a C-terminal PDZ-binding motif leads to Scribble degradation in vivo. However, the precise molecular basis for Scribble-E6 interactions remains to be defined. We now show that Scribble PDZ1 and PDZ3 are the major interactors of HPV E6 from multiple high-risk strains, with each E6 protein displaying a unique interaction profile. We then determined crystal structures of Scribble PDZ1 and PDZ3 domains in complex with the PDZ-binding motif (PBM) motifs of E6 from HPV strains 16, 18 and 66. Our findings reveal distinct interaction patterns for each E6 PBM motif from a given HPV strain, suggesting that a complex molecular interplay exists that underpins the overt Scribble-HPV E6 interaction and controls E6 carcinogenic potential.


Assuntos
Proteínas Oncogênicas Virais , Infecções por Papillomavirus , Humanos , Papillomavirus Humano , Infecções por Papillomavirus/metabolismo , Domínios PDZ , Ligação Proteica , Proteínas Oncogênicas Virais/genética , Proteínas Oncogênicas Virais/metabolismo
17.
J Cell Sci ; 136(2)2023 01 15.
Artigo em Inglês | MEDLINE | ID: mdl-36661138

RESUMO

The fate of the two daughter cells is intimately connected to their positioning, which is in turn regulated by cell junction remodelling and orientation of the mitotic spindle. How multiple cues are integrated to dictate the ultimate positioning of daughters is not clear. Here, we identify novel mechanisms of regulation of daughter positioning in single MCF10A cells. The polarity protein, Scribble cooperates with E-cadherin for sequential roles in daughter positioning. First Scribble stabilises E-cadherin at the mitotic cortex as well as the retraction fibres, to mediate spindle orientation. Second, Scribble re-locates to the junction between the two daughters to allow a new E-cadherin-based-interface to form between them, influencing the width of the nascent daughter-daughter junction and subsequent cell positioning. Thus, E-cadherin and Scribble dynamically relocate to different intracellular sites during cell division to orient the mitotic spindle and control placement of the daughter cells after cell division. This article has an associated First Person interview with the first author of the paper.


Assuntos
Caderinas , Fuso Acromático , Humanos , Caderinas/genética , Caderinas/metabolismo , Divisão Celular/genética , Polaridade Celular/fisiologia , Junções Intercelulares/metabolismo , Fuso Acromático/metabolismo
18.
Biochem Soc Trans ; 51(1): 415-426, 2023 02 27.
Artigo em Inglês | MEDLINE | ID: mdl-36606695

RESUMO

Scribble is a scaffolding protein that regulates key events such as cell polarity, tumorigenesis and neuronal signalling. Scribble belongs to the LAP family which comprise of 16 Leucine Rich Repeats (LRR) at the N-terminus, two LAP Specific Domains (LAPSD) and four PSD-95/Discs-large/ZO-1 (PDZ) domains at the C-terminus. The four PDZ domains have been shown to be key for a range of protein-protein interactions and have been identified to be crucial mediators for the vast majority of Scribble interactions, particularly via PDZ Binding Motifs (PBMs) often found at the C-terminus of interacting proteins. Dysregulation of Scribble is associated with poor prognosis in viral infections due to subversion of multiple cell signalling pathways by viral effector proteins. Here, we review the molecular details of the interplay between Scribble and viral effector proteins that provide insight into the potential modes of regulation of Scribble mediated polarity signalling.


Assuntos
Polaridade Celular , Transformação Celular Neoplásica , Humanos , Polaridade Celular/fisiologia , Ligação Proteica
19.
Placenta ; 141: 26-34, 2023 09 26.
Artigo em Inglês | MEDLINE | ID: mdl-36443107

RESUMO

Maintenance of cell polarity and the structure of the apical surface of epithelial cells is a tightly regulated process necessary for tissue homeostasis. The syncytiotrophoblast of the human placenta is an entirely unique epithelial layer. It is a single giant multinucleate syncytial layer that comprises the maternal-facing surface of the human placenta. Like other epithelia, the syncytiotrophoblast is highly polarized with the apical surface dominated by microvillar membrane protrusions. Syncytiotrophoblast dysfunction is a key feature of pregnancy complications like preeclampsia. Preeclampsia is commonly associated with a heightened maternal immune response and pro-inflammatory environment. Importantly, reports have observed disruption of syncytiotrophoblast apical microvilli in placentas from preeclamptic pregnancies, indicating a loss of apical polarity, but little is known about how the syncytiotrophoblast regulates polarity. Here, we review the evolutionarily conserved mechanisms that regulate apical-basal polarization in epithelial cells, and the emerging evidence that PAR polarity complex components are critical regulators of syncytiotrophoblast homeostasis and apical membrane structure. Pro-inflammatory cytokines have been shown to disrupt the expression of polarity regulating proteins. We also discuss initial data showing that syncytiotrophoblast apical polarity can be disrupted by the addition of the pro-inflammatory cytokine tumor necrosis factor-α, revealing that physiologically relevant signals can modulate syncytiotrophoblast polarization. Since disrupted polarity is a feature of preeclampsia, further elucidation of the syncytiotrophoblast-specific polarity signaling network and testing whether the disruption of polarity-factor signaling networks may contribute to the development of preeclampsia is warranted.


Assuntos
Pré-Eclâmpsia , Trofoblastos , Feminino , Humanos , Gravidez , Polaridade Celular/fisiologia , Homeostase , Placenta/metabolismo , Pré-Eclâmpsia/metabolismo , Trofoblastos/metabolismo
20.
Am J Physiol Cell Physiol ; 324(2): C307-C319, 2023 02 01.
Artigo em Inglês | MEDLINE | ID: mdl-36468842

RESUMO

Breast carcinomas originate from cells in the terminal duct-lobular unit. Carcinomas are associated with increased cell proliferation and migration, altered cellular adhesion, as well as loss of epithelial polarity. In breast cancer, aberrant and high levels of aquaporin-5 (AQP5) are associated with increased metastasis, poor prognosis, and cancer recurrence. AQP5 increases the proliferation and migration of cancer cells, and ectopic expression of AQP5 in normal epithelial cells reduces cell-cell adhesion and increases cell detachment and dissemination from migrating cell sheets, the latter via AQP5-mediated activation of the Ras pathway. Here, we investigated if AQP5 also affects cellular polarity by examining the relationship between the essential polarity protein Scribble and AQP5. In tissue samples from invasive lobular and ductal carcinomas, the majority of cells with high AQP5 expression displayed low Scribble levels, indicating an inverse relationship. Probing for interactions via a Glutathione S-transferase pull-down experiment revealed that AQP5 and Scribble interacted. Moreover, overexpression of AQP5 in the breast cancer cell line MCF7 reduced both size and circularity of three-dimensional (3-D) spheroids and induced cell detachment and dissemination from migrating cell sheets. In addition, Scribble levels were reduced. An AQP5 mutant cell line, which cannot activate Ras (AQP5S156A) signaling, displayed unchanged spheroid size and circularity and an intermediate level of Scribble, indicating that the effect of AQP5 on Scribble is, at least in part, dependent on AQP5-mediated activation of Ras. Thus, our results suggest that high AQP5 expression negatively regulates the essential polarity protein Scribble and thus, can affect cellular polarity in breast cancer.


Assuntos
Aquaporina 5 , Neoplasias da Mama , Feminino , Humanos , Aquaporina 5/genética , Aquaporina 5/metabolismo , Neoplasias da Mama/patologia , Linhagem Celular , Polaridade Celular , Células Epiteliais/metabolismo
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...