Cluster of Differentiation 36 (CD36) Preferentially Mediates Intestinal Absorption of Dietary Z-Astaxanthin and Especially 9-Z-Isomer via Higher Binding Affinity.

Variances in the biological functions of astaxanthin geometric isomers (i.e., all-E, Z) are related to their intestinal absorption, but the mechanism of isomer absorption mediated by transporters remains unclear. Here, models of in vitro cell overexpression, in situ intestinal perfusion, and in vivo mouse inhibition were employed to investigate the impact of cluster of differentiation 36 (CD36) on the absorption of astaxanthin isomers. Cells overexpressing CD36 notably enhanced the uptake of Z-astaxanthin, particularly the 9-Z-isomer (47.76%). The absorption rate and permeability of Z-astaxanthin surpassed that of the all-E-isomer by the in situ model. Furthermore, the addition of the CD36-specific inhibitor sulfo-N-succinimidyl oleate significantly reduced the absorption of Z-astaxanthin in the mouse duodenum and jejunum, especially the 9-Z-isomer (57.66%). Molecular docking and surface plasmon resonance techniques further validated that 9-Z-astaxanthin binds to more amino acids of CD36 with higher affinity and in a fast-binding, fast-dissociating mode, thus favoring transport. Our findings elucidate, for the first time, the mechanism of the CD36-mediated transmembrane transport of astaxanthin geometric isomers.

Atf3-mediated metabolic reprogramming in hepatic macrophage orchestrates metabolic dysfunction-associated steatohepatitis.

Metabolic dysfunction-associated steatohepatitis (MASH) is regulated by complex interplay between the macrophages and surrounding cells in the liver. Here, we show that Atf3 regulates glucose-fatty acid cycle in macrophages attenuates hepatocyte steatosis, and fibrogenesis in hepatic stellate cells (HSCs). Overexpression of Atf3 in macrophages protects against the development of MASH in Western diet-fed mice, whereas Atf3 ablation has the opposite effect. Mechanistically, Atf3 improves the reduction of fatty acid oxidation induced by glucose via forkhead box O1 (FoxO1) and Cd36. Atf3 inhibits FoxO1 activity via blocking Hdac1-mediated FoxO1 deacetylation at K242, K245, and K262 and increases Zdhhc4/5-mediated CD36 palmitoylation at C3, C7, C464, and C466; furthermore, macrophage Atf3 decreases hepatocytes lipogenesis and HSCs activation via retinol binding protein 4 (Rbp4). Anti-Rbp4 can prevent MASH progression that is induced by Atf3 deficiency in macrophages. This study identifies Atf3 as a regulator of glucose-fatty acid cycle. Targeting macrophage Atf3 or Rbp4 may be a plausible therapeutic strategy for MASH.

Protein-energy restriction-induced lipid metabolism disruption causes stable-to-progressive disease shift in Mycobacterium avium-infected female mice.

BACKGROUND: Disease susceptibility and progression of Mycobacterium avium complex pulmonary disease (MAC-PD) is associated with multiple factors, including low body mass index (BMI). However, the specific impact of low BMI on MAC-PD progression remains poorly understood. This study aims to examine the progression of MAC-PD in the context of low BMI, utilising a disease-resistant mouse model. METHODS: We employed a MAC infection-resistant female A/J mouse model to compare the progression of MAC-PD under two dietary conditions: one group was fed a standard protein diet, representing protein-energy unrestricted conditions, and the other was fed a low protein diet (LPD), representing protein-energy restriction. FINDINGS: Our results reveal that protein-energy restriction significantly exacerbates MAC-PD progression by disrupting lipid metabolism. Mice fed an LPD showed elevated fatty acid levels and related gene expressions in lung tissues, similar to findings of increased fatty acids in the serum of patients who exhibited the MAC-PD progression. These mice also exhibited increased CD36 expression and lipid accumulation in macrophages upon MAC infection. In vitro experiments emphasised the crucial role of CD36-mediated palmitic acid uptake in bacterial proliferation. Importantly, in vivo studies demonstrated that administering anti-CD36 antibody to LPD-fed A/J mice reduced macrophage lipid accumulation and impeded bacterial growth, resulting in remarkable slowing disease progression. INTERPRETATION: Our findings indicate that the metabolic status of host immune cells critically influences MAC-PD progression. This study highlights the potential of adequate nutrient intake in preventing MAC-PD progression, suggesting that targeting CD36-mediated pathways might be a host-directed therapeutic strategy to managing MAC infection. FUNDING: This research was funded by the National Research Foundation of Korea, the Korea Research Institute of Bioscience and Biotechnology, and the Korea National Institute of Health.

A CD36-dependent non-canonical lipid metabolism program promotes immune escape and resistance to hypomethylating agent therapy in AML.

Environmental lipids are essential for fueling tumor energetics, but whether these exogenous lipids transported into cancer cells facilitate immune escape remains unclear. Here, we find that CD36, a transporter for exogenous lipids, promotes acute myeloid leukemia (AML) immune evasion. We show that, separately from its established role in lipid oxidation, CD36 on AML cells senses oxidized low-density lipoprotein (OxLDL) to prime the TLR4-LYN-MYD88-nuclear factor κB (NF-κB) pathway, and exogenous palmitate transfer via CD36 further potentiates this innate immune pathway by supporting ZDHHC6-mediated MYD88 palmitoylation. Subsequently, NF-κB drives the expression of immunosuppressive genes that inhibit anti-tumor T cell responses. Notably, high-fat-diet or hypomethylating agent decitabine treatment boosts the immunosuppressive potential of AML cells by hijacking CD36-dependent innate immune signaling, leading to a dampened therapeutic effect. This work is of translational interest because lipid restriction by US Food and Drug Administration (FDA)-approved lipid-lowering statin drugs improves the efficacy of decitabine therapy by weakening leukemic CD36-mediated immunosuppression.

Regulation of PPARγ2 Stability and Activity by SHP-1.

The protein tyrosine phosphatase Src homology region 2 domain-containing phosphatase-1 (SHP-1) plays an important role in modulating glucose and lipid homeostasis. We previously suggested a potential role of SHP-1 in the regulation of peroxisome proliferator-activated receptor γ2 (PPARγ2) expression and activity but the mechanisms were unexplored. PPARγ2 is the master regulator of adipogenesis, but how its activity is regulated by tyrosine phosphorylation is largely unknown. Here, we found that SHP-1 binds to PPARγ2 primarily via its N-terminal SH2-domain. We confirmed the phosphorylation of PPARγ2 on tyrosine-residue 78 (Y78), which was reduced by SHP-1 in vitro resulting in decreased PPARγ2 stability. Loss of SHP-1 led to elevated, agonist-induced expression of the classical PPARγ2 targets FABP4 and CD36, concomitant with increased lipid content in cells expressing PPARγ2, an effect blunted by abrogation of PPARγ2 phosphorylation. Collectively, we discovered that SHP-1 affects the stability of PPARγ2 through dephosphorylation thereby influencing adipogenesis.

Sitagliptin alleviates renal steatosis and endoplasmic reticulum stress in high fat diet-induced obese rats by targeting SREBP-1/CD36 signaling pathway.

High fat diet (HFD) consumption can cause dysregulation of glucose and lipid metabolism, coupled with increased ectopic lipid deposition in renal tissue leading to steatosis and dysfunction. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor clinically used for type II diabetes therapy; however its effect on renal steatosis in obese state is still uncertain. Herein, obesity was induced by feeding male Wistar rats HFD for 18 weeks, thereafter received either drug vehicle, or sitagliptin (10 mg/kg, PO) along with HFD for further 6 weeks and compared with age-matched rats receiving normal chow diet (NCD). After 24 weeks, serum and kidneys were collected for histological and biochemical assessments. Compared to NCD-fed group, HFD-fed rats displayed marked weight gain, increased fat mass, insulin resistance, dyslipidemia, impaired kidney functions and renal histological alterations. Sitagliptin effectively ameliorated obesity and related metabolic perturbations and improved kidney architecture and function. There were increased levels of triglycerides and cluster of differentiation 36 (CD36) in kidneys of obese rats, that were lowered by sitagliptin therapy. Sitagliptin significantly repressed the expression of lipogenesis genes, while up-regulated genes involved in mitochondrial biogenesis and fatty acid oxidation in kidneys of HFD-fed rats. Sitagliptin was found to induce down-regulation of endoplasmic reticulum (ER) stress and apoptotic markers in kidneys of obese rats. These findings together may emphasize a novel concept that sitagliptin can be an effective therapeutic approach for halting obesity-related renal steatosis and CKD.

Pathomics and single-cell analysis of papillary thyroid carcinoma reveal the pro-metastatic influence of cancer-associated fibroblasts.

BACKGROUND: Papillary thyroid carcinoma (PTC) is globally prevalent and associated with an increased risk of lymph node metastasis (LNM). The role of cancer-associated fibroblasts (CAFs) in PTC remains unclear. METHODS: We collected postoperative pathological hematoxylin-eosin (HE) slides from 984 included patients with PTC to analyze the density of CAF infiltration at the invasive front of the tumor using QuPath software. The relationship between CAF density and LNM was assessed. Single-cell RNA sequencing (scRNA-seq) data from GSE193581 and GSE184362 datasets were integrated to analyze CAF infiltration in PTC. A comprehensive suite of in vitro experiments, encompassing EdU labeling, wound scratch assays, Transwell assays, and flow cytometry, were conducted to elucidate the regulatory role of CD36+CAF in two PTC cell lines, TPC1 and K1. RESULTS: A significant correlation was observed between high fibrosis density at the invasive front of the tumor and LNM. Analysis of scRNA-seq data revealed metastasis-associated myoCAFs with robust intercellular interactions. A diagnostic model based on metastasis-associated myoCAF genes was established and refined through deep learning methods. CD36 positive expression in CAFs can significantly promote the proliferation, migration, and invasion abilities of PTC cells, while inhibiting the apoptosis of PTC cells. CONCLUSION: This study addresses the significant issue of LNM risk in PTC. Analysis of postoperative HE pathological slides from a substantial patient cohort reveals a notable association between high fibrosis density at the invasive front of the tumor and LNM. Integration of scRNA-seq data comprehensively analyzes CAF infiltration in PTC, identifying metastasis-associated myoCAFs with strong intercellular interactions. In vitro experimental results indicate that CD36 positive expression in CAFs plays a promoting role in the progression of PTC. Overall, these findings provide crucial insights into the function of CAF subset in PTC metastasis.

Release of CD36-associated cell-free mitochondrial DNA and RNA as a hallmark of space environment response.

A detailed understanding of how spaceflight affects human health is essential for long-term space exploration. Liquid biopsies allow for minimally-invasive multi-omics assessments that can resolve the molecular heterogeneity of internal tissues. Here, we report initial results from the JAXA Cell-Free Epigenome Study, a liquid biopsy study with six astronauts who resided on the International Space Station (ISS) for more than 120 days. Analysis of plasma cell-free RNA (cfRNA) collected before, during, and after spaceflight confirms previously reported mitochondrial dysregulation in space. Screening with 361 cell surface marker antibodies identifies a mitochondrial DNA-enriched fraction associated with the scavenger receptor CD36. RNA-sequencing of the CD36 fraction reveals tissue-enriched RNA species, suggesting the plasma mitochondrial components originated from various tissues. We compare our plasma cfRNA data to mouse plasma cfRNA data from a previous JAXA mission, which had used on-board artificial gravity, and discover a link between microgravity and the observed mitochondrial responses.

CD36 deletion prevents white matter injury by modulating microglia polarization through the Traf5-MAPK signal pathway.

BACKGROUND: White matter injury (WMI) represents a significant etiological factor contributing to neurological impairment subsequent to Traumatic Brain Injury (TBI). CD36 receptors are recognized as pivotal participants in the pathogenesis of neurological disorders, including stroke and spinal cord injury. Furthermore, dynamic fluctuations in the phenotypic polarization of microglial cells have been intimately associated with the regenerative processes within the injured tissue following TBI. Nevertheless, there is a paucity of research addressing the impact of CD36 receptors on WMI and microglial polarization. This investigation aims to elucidate the functional role and mechanistic underpinnings of CD36 in modulating microglial polarization and WMI following TBI. METHODS: TBI models were induced in murine subjects via controlled cortical impact (CCI). The spatiotemporal patterns of CD36 expression were examined through quantitative polymerase chain reaction (qPCR), Western blot analysis, and immunofluorescence staining. The extent of white matter injury was assessed via transmission electron microscopy, Luxol Fast Blue (LFB) staining, and immunofluorescence staining. Transcriptome sequencing was employed to dissect the molecular mechanisms underlying CD36 down-regulation and its influence on white matter damage. Microglial polarization status was ascertained using qPCR, Western blot analysis, and immunofluorescence staining. In vitro, a Transwell co-culture system was employed to investigate the impact of CD36-dependent microglial polarization on oligodendrocytes subjected to oxygen-glucose deprivation (OGD). RESULTS: Western blot and qPCR analyses revealed that CD36 expression reached its zenith at 7 days post-TBI and remained sustained at this level thereafter. Immunofluorescence staining exhibited robust CD36 expression in astrocytes and microglia following TBI. Genetic deletion of CD36 ameliorated TBI-induced white matter injury, as evidenced by a reduced SMI-32/MBP ratio and G-ratio. Transcriptome sequencing unveiled differentially expressed genes enriched in processes linked to microglial activation, regulation of neuroinflammation, and the TNF signaling pathway. Additionally, bioinformatics analysis pinpointed the Traf5-p38 axis as a critical signaling pathway. In vivo and in vitro experiments indicated that inhibition of the CD36-Traf5-MAPK axis curtailed microglial polarization toward the pro-inflammatory phenotype. In a Transwell co-culture system, BV2 cells treated with LPS + IFN-γ exacerbated the damage of post-OGD oligodendrocytes, which could be rectified through CD36 knockdown in BV2 cells. CONCLUSIONS: This study illuminates that the suppression of CD36 mitigates WMI by constraining microglial polarization towards the pro-inflammatory phenotype through the down-regulation of the Traf5-MAPK signaling pathway. Our findings present a potential therapeutic strategy for averting neuroinflammatory responses and ensuing WMI damage resulting from TBI.

Unveiling the hidden role of the interaction between CD36 and FcγRIIb: implications for autoimmune disorders.

BACKGROUND: The role of the scavenger receptor CD36 in cell metabolism and the immune response has been investigated mainly in macrophages, dendritic cells, and T cells. However, its involvement in B cells has not been comprehensively examined. METHODS: To investigate the function of CD36 in B cells, we exposed Cd36fl/flMB1cre mice, which lack CD36 specifically in B cells, to apoptotic cells to trigger an autoimmune response. To validate the proteins that interact with CD36 in primary B cells, we conducted mass spectrometry analysis following anti-CD36 immunoprecipitation. Immunofluorescence and co-immunoprecipitation were used to confirm the protein interactions. RESULTS: The data revealed that mice lacking CD36 in B cells exhibited a reduction in germinal center B cells and anti-DNA antibodies in vivo. Mass spectrometry analysis identified 30 potential candidates that potentially interact with CD36. Furthermore, the interaction between CD36 and the inhibitory Fc receptor FcγRIIb was first discovered by mass spectrometry and confirmed through immunofluorescence and co-immunoprecipitation techniques. Finally, deletion of FcγRIIb in mice led to decreased expression of CD36 in marginal zone B cells, germinal center B cells, and plasma cells. CONCLUSIONS: Our data indicate that CD36 in B cells is a critical regulator of autoimmunity. The interaction of CD36-FcγRIIb has the potential to serve as a therapeutic target for the treatment of autoimmune disorders.

The CD36 scavenger receptor Bez regulates lipid redistribution from fat body to ovaries in Drosophila.

Lipid distribution in an organism is mediated by the interplay between lipoprotein particles, lipoprotein receptors and class B scavenger receptors of the CD36 family. CD36 is a multifunctional protein mediating lipid uptake, mobilization and signaling at the plasma membrane and inside of the cell. The CD36 protein family has 14 members in Drosophila melanogaster, which allows for the differentiated analysis of their functions. Here, we unravel a role for the so far uncharacterized scavenger receptor Bez in lipid export from Drosophila adipocytes. Bez shares the lipid binding residue with CD36 and is expressed at the plasma membrane of the embryonic, larval and adult fat body. Bez loss of function lowers the organismal availability of storage lipids and blocks the maturation of egg chambers in ovaries. We demonstrate that Bez interacts with the APOB homolog Lipophorin at the plasma membrane of adipocytes and trace the Bez-dependent transfer of an alkyne-labeled fatty acid from adipocytes to Lipophorin. Our study demonstrates how lipids are distributed by scavenger receptor-lipoprotein interplay and contribute to the metabolic control of development.

Whole-body deletion of Endospanin 1 protects from obesity-associated deleterious metabolic alterations.

The importance of the proper localization of most receptors at the cell surface is often underestimated, although this feature is essential for optimal receptor response. Endospanin 1 (Endo1) (also known as OBRGRP or LEPROT) is a protein generated from the same gene as the human leptin receptor and regulates the trafficking of proteins to the surface, including the leptin receptor. The systemic role of Endo1 on whole-body metabolism has not been studied so far. Here, we report that general Endo1-KO mice fed a high-fat diet develop metabolically healthy obesity with lipid repartitioning in organs and preferential accumulation of fat in adipose tissue, limited systematic inflammation, and better controlled glucose homeostasis. Mechanistically, Endo1 interacts with the lipid translocase CD36, thus regulating its surface abundance and lipid uptake in adipocytes. In humans, the level of Endo1 transcripts is increased in the adipose tissue of patients with obesity, but low levels rather correlate with a profile of metabolically healthy obesity. We suggest here that Endo1, most likely by controlling CD36 cell surface abundance and lipid uptake in adipocytes, dissociates obesity from diabetes and that its absence participates in metabolically healthy obesity.

Loss of NAT10 alleviates maternal high-fat diet-induced hepatic steatosis in male offspring of mice.

OBJECTIVE: Metabolic dysfunction-associated steatotic liver disease (MASLD) is becoming an escalating health problem in pediatric populations. This study aimed to investigate the role of N-acetyltransferase 10 (NAT10) in maternal high-fat diet (HFD)-induced MASLD in offspring at early life. METHODS: We generated male hepatocyte-specific NAT10 knockout (Nat10HKO) mice and mated them with female Nat10fl/fl mice under chow or HFD feeding. Body weight, liver histopathology, and expression of lipid metabolism-associated genes (Srebp1c, Fasn, Pparα, Cd36, Fatp2, Mttp, and Apob) were assessed in male offspring at weaning. Lipid uptake assays were performed both in vivo and in vitro. The mRNA stability assessment and RNA immunoprecipitation were performed to determine NAT10-regulated target genes. RESULTS: NAT10 deletion in hepatocytes of male offspring alleviated perinatal lipid accumulation induced by maternal HFD, decreasing expression levels of Srebp1c, Fasn, Cd36, Fatp2, Mttp, and Apob while enhancing Pparα expression. Furthermore, Nat10HKO male mice exhibited reduced lipid uptake. In vitro, NAT10 promoted lipid uptake by enhancing the mRNA stability of CD36 and FATP2. RNA immunoprecipitation assays exhibited direct interactions between NAT10 and CD36/FATP2 mRNA. CONCLUSIONS: NAT10 deletion in offspring hepatocytes ameliorates maternal HFD-induced hepatic steatosis through decreasing mRNA stability of CD36 and FATP2, highlighting NAT10 as a potential therapeutic target for pediatric MASLD.

Inhibition of fatty acid uptake by TGR5 prevents diabetic cardiomyopathy.

Diabetic cardiomyopathy is characterized by myocardial lipid accumulation and cardiac dysfunction. Bile acid metabolism is known to play a crucial role in cardiovascular and metabolic diseases. Takeda G-protein-coupled receptor 5 (TGR5), a major bile acid receptor, has been implicated in metabolic regulation and myocardial protection. However, the precise involvement of the bile acid-TGR5 pathway in maintaining cardiometabolic homeostasis remains unclear. Here we show decreased plasma bile acid levels in both male and female participants with diabetic myocardial injury. Additionally, we observe increased myocardial lipid accumulation and cardiac dysfunction in cardiomyocyte-specific TGR5-deleted mice (both male and female) subjected to a high-fat diet and streptozotocin treatment or bred on the diabetic db/db genetic background. Further investigation reveals that TGR5 deletion enhances cardiac fatty acid uptake, resulting in lipid accumulation. Mechanistically, TGR5 deletion promotes localization of CD36 on the plasma membrane through the upregulation of CD36 palmitoylation mediated by the palmitoyl acyltransferase DHHC4. Our findings indicate that the TGR5-DHHC4 pathway regulates cardiac fatty acid uptake, which highlights the therapeutic potential of targeting TGR5 in the management of diabetic cardiomyopathy.

Association of Candidate Single-Nucleotide Polymorphism Genotypes With Plasma and Skin Carotenoid Concentrations in Adults Provided a Lycopene-Rich Juice.

BACKGROUND: Carotenoids are fat-soluble phytochemicals with biological roles, including ultraviolet protective functions in skin. Spectroscopic skin carotenoid measurements can also serve as a noninvasive biomarker for carotenoid consumption. Single-nucleotide polymorphisms (SNPs) in metabolic genes are associated with human plasma carotenoid concentrations; however, their relationships with skin carotenoid concentrations are unknown. OBJECTIVES: The objective of this study was to determine the relationship between 13 candidate SNPs with skin and plasma carotenoid concentrations before and after a carotenoid-rich tomato juice intervention. METHODS: In this randomized, controlled trial, participants (n = 80) were provided with lycopene-rich vegetable juice providing low (13.1 mg), medium (23.9 mg), and high (31.0 mg) daily total carotenoid doses for 8 wk. Plasma carotenoid concentrations were measured by high-pressure liquid chromatography, and skin carotenoid score was assessed by reflection spectroscopy (Veggie Meter) at baseline and the end-of-study time point. Thirteen candidate SNPs in 5 genes (BCO1, CD36, SCARB1, SETD7, and ABCA1) were genotyped from blood using PCR-based assays. Mixed models tested the effects of the intervention, study time point, interaction between intervention and study time point, and SNP genotype on skin and plasma carotenoids throughout the study. Baseline carotenoid intake, body mass index, gender, and age are covariates in all models. RESULTS: The genotype of CD36 rs1527479 (P = 0.0490) was significantly associated with skin carotenoid concentrations when baseline and the final week of the intervention were evaluated. Genotypes for BCO1 rs7500996 (P = 0.0067) and CD36 rs1527479 (P = 0.0018) were significant predictors of skin carotenoid concentrations in a combined SNP model. CONCLUSIONS: These novel associations between SNPs and skin carotenoid concentrations expand on the understanding of how genetic variation affects interindividual variation in skin carotenoid phenotypes in humans. This trial was registered at clinicaltrials.gov as NCT03202043.

Protein kinase-D1 and downstream signaling mechanisms involved in GLUT4 translocation in cardiac muscle.

The Ser/Thr kinase protein kinase-D1 (PKD1) is involved in induction of various cell physiological processes in the heart such as myocellular hypertrophy and inflammation, which may turn maladaptive during long-term stimulation. Of special interest is a key role of PKD1 in the regulation of cardiac substrate metabolism. Glucose and fatty acids are the most important substrates for cardiac energy provision, and the ratio at which they are utilized determines the health status of the heart. Cardiac glucose uptake is mainly regulated by translocation of the glucose transporter GLUT4 from intracellular stores (endosomes) to the sarcolemma, and fatty acid uptake via a parallel translocation of fatty acid transporter CD36 from endosomes to the sarcolemma. PKD1 is involved in the regulation of GLUT4 translocation, but not CD36 translocation, giving it the ability to modulate glucose uptake without affecting fatty acid uptake, thereby altering the cardiac substrate balance. PKD1 would therefore serve as an attractive target to combat cardiac metabolic diseases with a tilted substrate balance, such as diabetic cardiomyopathy. However, PKD1 activation also elicits cardiac hypertrophy and inflammation. Therefore, identification of the events upstream and downstream of PKD1 may provide superior therapeutic targets to alter the cardiac substrate balance. Recent studies have identified the lipid kinase phosphatidylinositol 4-kinase IIIß (PI4KIIIß) as signaling hub downstream of PKD1 to selectively stimulate GLUT4-mediated myocardial glucose uptake without inducing hypertrophy. Taken together, the PKD1 signaling pathway serves a pivotal role in cardiac glucose metabolism and is a promising target to selectively modulate glucose uptake in cardiac disease.

The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Conjugated linoleic acid (CLA) reduces intestinal fatty acid uptake and chylomicron formation in HFD-fed mice associated with the inhibition of DHHC7-mediated CD36 palmitoylation and the downstream ERK pathway.

The anti-obesity effect of conjugated linoleic acid (CLA) has been well elucidated, but whether CLA affects fat deposition by regulating intestinal dietary fat absorption remains largely unknown. Thus, this study aimed to investigate the effects of CLA on intestinal fatty acid uptake and chylomicron formation and explore the possible underlying mechanisms. We found that CLA supplementation reduced the intestinal fat absorption in HFD (high fat diet)-fed mice accompanied by the decreased serum TG level, increased fecal lipids and decreased intestinal expression of ApoB48 and MTTP. Correspondingly, c9, t11-CLA, but not t10, c12-CLA induced the reduction of fatty acid uptake and TG content in PA (palmitic acid)-treated MODE-K cells. In the mechanism of fatty acid uptake, c9, t11-CLA inhibited the binding of CD36 with palmitoyltransferase DHHC7, thus leading to the decreases of CD36 palmitoylation level and localization on the cell membrane of the PA-treated MODE-K cells. In the mechanism of chylomicron formation, c9, t11-CLA inhibited the formation of the CD36/FYN/LYN complex and the activation of the ERK pathway in the PA-treated MODE-K cells. In in vivo verification, CLA supplementation reduced the DHHC7-mediated total and cell membrane CD36 palmitoylation and suppressed the formation of the CD36/FYN/LYN complex and the activation of the ERK pathway in the jejunum of HFD-fed mice. Altogether, these data showed that CLA reduced intestinal fatty acid uptake and chylomicron formation in HFD-fed mice associated with the inhibition of DHHC7-mediated CD36 palmitoylation and the downstream ERK pathway.

Sesamin ameliorates nonalcoholic hepatic steatosis by inhibiting CD36-mediated hepatocyte lipid accumulation in vitro and in vivo.

Hepatic steatosis is a critical factor in the development of nonalcoholic steatohepatitis (NASH). Sesamin (Ses), a functional lignan isolated from Sesamum indicum, possesses hypolipidemic, liver-protective, anti-hypertensive, and anti-tumor properties. Ses has been found to improve hepatic steatosis, but the exact mechanisms through which Ses achieves this are not well understood. In this study, we observed the anti-hepatic steatosis effects of Ses in palmitate/oleate (PA/OA)-incubated primary mouse hepatocytes, AML12 hepatocytes, and HepG2 cells, as well as in high-fat, high-cholesterol diet-induced NASH mice. RNA sequencing analysis revealed that cluster of differentiation 36 (CD36), a free fatty acid (FA) transport protein, was involved in the Ses-mediated inhibition of hepatic fat accumulation. Moreover, the overexpression of CD36 significantly increased hepatic steatosis in both Ses-treated PA/OA-incubated HepG2 cells and NASH mice. Furthermore, Ses treatment suppressed insulin-induced de novo lipogenesis in HepG2 cells, which was reversed by CD36 overexpression. Mechanistically, we found that Ses ameliorated NASH by inhibiting CD36-mediated FA uptake and upregulation of lipogenic genes, including FA synthase, stearoyl-CoA desaturase 1, and sterol regulatory element-binding protein 1. The findings of our study provide novel insights into the potential therapeutic applications of Ses in the treatment of NASH.

O-GlcNAcylation promotes the progression of nonalcoholic fatty liver disease by upregulating the expression and function of CD36.

BACKGROUND AND AIMS: Nonalcoholic fatty liver disease (NAFLD) and its progressive variant, nonalcoholic steatohepatitis (NASH), constitute a burgeoning worldwide epidemic with no FDA-approved pharmacotherapies. The multifunctional immunometabolic receptor, fatty acid translocase CD36 (CD36), plays an important role in the progression of hepatic steatosis. O-GlcNAcylation is a crucial posttranslational modification that mediates the distribution and function of CD36, but its involvement in NAFLD remains poorly understood. METHODS: O-GlcNAcylation and CD36 expression were evaluated in human liver tissues obtained from NASH patients and normal control. Mice with hepatocyte-specific CD36 knockout were administered adeno-associated viral vectors expressing wild-type CD36 (WT-CD36) or CD36 O-GlcNAcylation site mutants (S468A&T470A-CD36) and were provided with a high-fat/high-cholesterol (HFHC) diet for 3 months. RT-qPCR analysis, immunoblotting, dual-luciferase reporter assays, chromatin immunoprecipitation, and coimmunoprecipitation were performed to explore the mechanisms by which O-GlcNAcylation regulates CD36 expression. Membrane protein extraction, immunofluorescence analysis, site-directed mutagenesis, and fatty acid uptake assays were conducted to elucidate the impact of O-GlcNAcylation on CD36 function. RESULTS: O-GlcNAcylation and CD36 expression were significantly increased in patients with NASH, mouse models of NASH, and palmitic acid-stimulated hepatocytes. Mechanistically, the increase in O-GlcNAcylation facilitated the transcription of CD36 via the NF-κB signalling pathway and stabilized the CD36 protein by inhibiting its ubiquitination, thereby promoting CD36 expression. On the other hand, O-GlcNAcylation facilitated the membrane localization of CD36, fatty acid uptake, and lipid accumulation. However, site-directed mutagenesis of residues S468 and T470 of CD36 reversed these effects. Furthermore, compared with their WT-CD36 counterparts, HFHC-fed S468A&T470A-CD36 mice exhibited decreases in systemic insulin resistance, steatosis severity, inflammation and fibrosis. Pharmacological inhibition of O-GlcNAcylation and CD36 also mitigated the progression of NASH. CONCLUSIONS: O-GlcNAcylation promotes the progression of NAFLD by upregulating CD36 expression and function. Inhibition of CD36 O-GlcNAcylation protects against NASH, highlighting a potentially effective therapeutic approach for individuals with NASH.