Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 172
Filtrar
1.
J Clin Microbiol ; 62(8): e0026724, 2024 Aug 14.
Artigo em Inglês | MEDLINE | ID: mdl-39046255

RESUMO

Guidelines recommend monitoring of Epstein-Barr virus (EBV) and BK virus (BKV) in solid organ and hematopoietic stem cell transplant patients. The majority of quantitative DNA testing for EBV and BKV employs unstandardized individual laboratory-developed testing solutions (LDTs), with implications for accuracy, reproducibility, and comparability between laboratories. The performance of the cobas EBV and cobas BKV assays was assessed across five laboratories, using the World Health Organization International Standards (WHO IS) for EBV and BKV, and the National Institute of Standards and Technology Quantitative Standard for BKV, and results were compared with the LDTs in use at the time. Methods were also compared using locally sourced clinical specimens. Variation was high when laboratories reported EBV or BKV DNA values using LDTs, where quantitative values were observed to differ by up to 1.5 log10 unit/mL between sites. Conversely, results from the cobas EBV and cobas BKV assays were accurate and reproducible across sites and on different testing days. Adjustment of LDTs using the international standards led to closer alignment between the assays; however, day-to-day reproducibility of LDTs remained high. In addition, BKV continued to show bias, indicating challenges with the commutability of the BKV International Standard. The cobas EBV and cobas BKV assays are automated, aligned to the WHO IS, and have the potential to reduce the variability in viral load testing introduced by differences in LDTs. Standardization of reporting values may eventually allow different centers to compare data to allow clinical decision thresholds to be established supporting improvements in patient management.IMPORTANCEThe application of center-specific cut-offs for clinical decisions and the variability of LDTs often hinder interpretation; thus, the findings reported here support the need for standardization in the field of post-transplant monitoring of EBV and BKV to improve patient management. Alongside the choice of assay, it is also important to consider which standard to use when deciding upon a testing methodology. This is a call to action for standardization, as treatment for EBV and BKV is driven by viral load test results, and the more accurate and comparable the test results are across institutions, the more informed and better the treatment decisions can be.


Assuntos
Vírus BK , Infecções por Vírus Epstein-Barr , Herpesvirus Humano 4 , Carga Viral , Humanos , Vírus BK/isolamento & purificação , Vírus BK/genética , Herpesvirus Humano 4/genética , Herpesvirus Humano 4/isolamento & purificação , Carga Viral/normas , Carga Viral/métodos , Reprodutibilidade dos Testes , Infecções por Vírus Epstein-Barr/diagnóstico , Infecções por Vírus Epstein-Barr/virologia , Infecções por Polyomavirus/diagnóstico , Infecções por Polyomavirus/virologia , DNA Viral/genética , DNA Viral/análise , Técnicas de Diagnóstico Molecular/normas , Técnicas de Diagnóstico Molecular/métodos , Infecções Tumorais por Vírus/diagnóstico , Infecções Tumorais por Vírus/virologia
2.
Mikrobiyol Bul ; 58(3): 284-292, 2024 Jul.
Artigo em Turco | MEDLINE | ID: mdl-39046210

RESUMO

Viral load monitoring is important in identifying patients at risk of developing cytomegalovirus (CMV) related complications after transplantation and for this purpose, quantitative real-time polymerase chain reaction (Rt-qPCR) tests are most commonly used. The main problem in CMV DNA Rt-qPCR tests that make quantitative measurements is that there are significant differences in measurements performed with different kits in different laboratories. Comparability of viral load measurements between laboratories has increased with the introduction of quantitative PCR tests calibrated with the CMV International Quantitation Standard (IQS) developed by the World Health Organization (WHO). However, quantitative agreement between measurements made with different kits has still not been fully achieved. In this study, it was aimed to investigate the quantitative compatibility between measurements made with Cobas 6800 (Roche Diagnostics, Mannheim, Germany) and NeuMoDx (Qiagen, Ann Arbor, USA) CMV DNA Rt-qPCR tests, which are fully automated new generation systems calibrated with the WHO CMV IQS. The results of 214 plasma samples, which were studied simultaneously with Cobas 6800 CMV Rt-qPCR and NeuMoDx CMV Rt-qPCR tests were analyzed. In the tests, the extraction, amplification and detection stages were carried out fully automatically. CMV DNA was detected in 144 (67.28%) samples in both tests and was not detected in 53 (24.76%) samples. Incompatible results were obtained in a total of 17 (7.94%) samples. Good agreement was found between the qualitative results of both tests (kappa= 0.80, p< 0.001). When the quantitative results (n= 129) obtained in the dynamic measurement range of both tests were examined, the median viral load values measured by Cobas 6800 CMV Rt-qPCR and NeuMoDx CMV Rt-qPCR tests were 513 IU/mL (range= 35-37000) and 741 IU/mL (range= 68-48978), respectively. According to the correlation analysis, a very strong correlation was found between the results of both tests (r= 0.94, p< 0.001). According to Bland-Altman analysis; the average difference between the results of the NeuMoDx CMV Rt-qPCR test and the Cobas 6800 CMV Rt-qPCR test was found to be -0.14 log10 [standard deviation (SD)= 0.23] IU/mL and it was determined that the Cobas 6800 CMV Rt-qPCR test had lower measurements than the NeuMoDx CMV Rt-qPCR test. In 120 of 129 samples (93%) whose results were within the dynamic measurement range of both tests, the measurement difference was within ± 0.5 log10 IU/mL and in 9 (7%), it was detected as more than ± 0.5 log10 (median 0.54 log10 IU/ml; range= 0.51-0.81). No measurement difference of more than ± 1.0 log10 was detected in any sample. In this study, quantitative agreement was found in the measurements made in plasma samples with the fully automated Cobas 6800 CMV Rt-qPCR and NeuMoDx CMV Rt-qPCR tests calibrated with the CMV IQS. To the best of our knowledge, a study comparing viral load measurements made with Cobas 6800 and NeuMoDx fully automated systems in the detection of CMV DNA has not yet been conducted, and this is the first study on this subject.


Assuntos
Infecções por Citomegalovirus , Citomegalovirus , DNA Viral , Reação em Cadeia da Polimerase em Tempo Real , Carga Viral , Humanos , Infecções por Citomegalovirus/diagnóstico , Infecções por Citomegalovirus/virologia , Citomegalovirus/genética , Citomegalovirus/isolamento & purificação , Carga Viral/métodos , Carga Viral/normas , Reação em Cadeia da Polimerase em Tempo Real/métodos , Reação em Cadeia da Polimerase em Tempo Real/normas , DNA Viral/análise , DNA Viral/sangue , Kit de Reagentes para Diagnóstico/normas
3.
Pediatrics ; 149(2)2022 02 01.
Artigo em Inglês | MEDLINE | ID: mdl-35102418

RESUMO

BACKGROUND AND OBJECTIVES: Viral respiratory infections are common in children, and practice guidelines do not recommend routine testing for typical viral illnesses. Despite results often not impacting care, nasopharyngeal swabs for viral testing are frequently performed and are an uncomfortable procedure. The aim of this initiative was to decrease unnecessary respiratory viral testing (RVT) in the emergency department (ED) and the pediatric medicine wards (PMWs) by 50% and 25%, respectively, over 36 months. METHODS: An expert panel reviewed published guidelines and appropriate evidence to formulate an RVT pathway using plan-do-study-act cycles. A multifaceted improvement strategy was developed that included implementing 2 newer, more effective tests when testing was deemed necessary; electronic order modifications with force functions; audit and feedback; and education. By using statistical process control charts, the outcomes analyzed were the percentage of RVT ordered in the ED and the rate of RVT ordered on the PMWs. Balancing measures included return visits leading to admission and inpatient viral nosocomial outbreaks. RESULTS: The RVT rate decreased from a mean of 3.0% to 0.5% of ED visits and from 44.3 to 30.1 per 1000 patient days on the PMWs and was sustained throughout the study. Even when accounting for the new rapid influenza test available in the ED, a 50% decrease in overall ED RVT was still achieved without any significant impact on return visits leading to admission or inpatient nosocomial infections. CONCLUSIONS: Through implementation of a standardized, electronically integrated RVT pathway, a decrease in unnecessary RVT was successfully achieved. Audit and feedback, reminders, and biannual education all supported long-term sustainability of this initiative.


Assuntos
Hospitais Pediátricos/normas , Influenza Humana/diagnóstico , Melhoria de Qualidade/normas , Infecções Respiratórias/diagnóstico , Carga Viral/normas , Adolescente , Antivirais/uso terapêutico , Criança , Pré-Escolar , Feminino , Hospitais Pediátricos/tendências , Humanos , Lactente , Recém-Nascido , Influenza Humana/tratamento farmacológico , Influenza Humana/epidemiologia , Masculino , Testes de Sensibilidade Microbiana/normas , Testes de Sensibilidade Microbiana/tendências , Ontário/epidemiologia , Oseltamivir/uso terapêutico , Melhoria de Qualidade/tendências , Infecções Respiratórias/tratamento farmacológico , Infecções Respiratórias/epidemiologia , Infecções Respiratórias/virologia , Carga Viral/tendências
4.
Nat Commun ; 12(1): 5753, 2021 10 01.
Artigo em Inglês | MEDLINE | ID: mdl-34599164

RESUMO

Patients with COVID-19 shed SARS-CoV-2 RNA in stool, sometimes well after their respiratory infection has cleared. This may be significant for patient health, epidemiology, and diagnosis. However, methods to preserve stool, and to extract and quantify viral RNA are not standardized. We test the performance of three preservative approaches at yielding detectable SARS-CoV-2 RNA: the OMNIgene-GUT kit, Zymo DNA/RNA shield kit, and the most commonly applied, storage without preservative. We test these in combination with three extraction kits: QIAamp Viral RNA Mini Kit, Zymo Quick-RNA Viral Kit, and MagMAX Viral/Pathogen Kit. We also test the utility of ddPCR and RT-qPCR for the reliable quantification of SARS-CoV-2 RNA from stool. We identify that the Zymo DNA/RNA preservative and the QiaAMP extraction kit yield more detectable RNA than the others, using both ddPCR and RT-qPCR. Taken together, we recommend a comprehensive methodology for preservation, extraction and detection of RNA from SARS-CoV-2 and other coronaviruses in stool.


Assuntos
Teste de Ácido Nucleico para COVID-19/normas , Fezes/virologia , SARS-CoV-2/isolamento & purificação , COVID-19/diagnóstico , Proteínas do Nucleocapsídeo de Coronavírus/genética , Humanos , Fosfoproteínas/genética , Preservação Biológica/normas , RNA Viral/análise , RNA Viral/genética , Kit de Reagentes para Diagnóstico , Padrões de Referência , SARS-CoV-2/genética , Manejo de Espécimes/normas , Carga Viral/normas
5.
Diagn Microbiol Infect Dis ; 101(3): 115467, 2021 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-34391073

RESUMO

The increased coverage of antiretroviral therapy has resulted in a decrease in the positive predictive value (PPV) and diagnostic sensitivity of early infant diagnosis assays. To evaluate the diagnostic performance of the Aptima HIV-1 Quant DX assay (Aptima) in detecting HIV infection at birth. The study was a cross-sectional laboratory based evaluation using whole blood DBS specimens. Samples were collected from HIV-exposed neonates at birth at two paediatric facilities in Gauteng between 1st March 2018 - 31st January 2020. Performance of the Aptima compared to the Cobas® AmpliPrep/Cobas® TaqMan HIV-1 Qualitative Test v2.0 was calculated using a two-by-two table and reported as proportions with 95% confidence intervals. A total of 363 infants met the inclusion criteria of which 4 (1.1%) had an Aptima result discordant with CAP/CTM HIV status: two (50%) negative and two (50%) positive. The Aptima assay had a sensitivity of 93.75% (95% CI: 79.19%-99.23%), specificity of 99.4% (95% CI: 97.83%-99.93%), PPV of 93.75% (95% CI: 78.98%-98.36%), negative predictive value of 99.4% (95% CI: 97.73%-99.84%), and overall accuracy of 98.9% (95% CI: 97.2%-99.7%). The Aptima yielded an error code on 37 (10.19%) results, of which 35 (94.59%) were resolved on repeat testing. Of the 32 HIV-detected specimens, 20 had a plasma VL result available (18 on Abbott and 2 on Cobas). The absolute median difference was 0.66 log10 (IQR: 0.36-1.71). The Aptima demonstrated good EID performance and can be considered as a qualitative EID assay.


Assuntos
Infecções por HIV/diagnóstico , HIV-1/genética , Técnicas de Diagnóstico Molecular/normas , Triagem Neonatal/métodos , Kit de Reagentes para Diagnóstico/normas , Carga Viral/normas , Estudos Transversais , Infecções por HIV/sangue , Humanos , Recém-Nascido , Transmissão Vertical de Doenças Infecciosas/prevenção & controle , Técnicas de Diagnóstico Molecular/métodos , RNA Viral/sangue , Sensibilidade e Especificidade , África do Sul , Carga Viral/métodos
6.
Viruses ; 13(7)2021 07 11.
Artigo em Inglês | MEDLINE | ID: mdl-34372546

RESUMO

The viral loads of acute bee paralysis virus (ABPV), black queen cell virus (BQCV), chronic bee paralysis virus (CBPV), deformed wing virus (DWV), Lake Sinai virus 3 (LSV3), and sacbrood bee virus (SBV) were determined in samples with the use of quantitative TaqMan real-time reverse transcription and polymerase chain reaction (RT-qPCR). A total of 108 samples of healthy adult honeybees from four differently located apiaries and samples of honeybees showing different clinical signs of viral infections from 89 apiaries were collected throughout Slovenia. The aim of this study was to discover correlations between viral loads and clinical signs in adult honeybees and confirm previously set threshold viral load levels between healthy and clinically affected honeybees. Within this study, two new RT-qPCR assays for quantification of LSV3 and SBV were developed. Statistically significant differences in viral loads of positive samples were identified between healthy and clinically affected honeybees for ABPV, CBPV, DWV, and SBV, while for BQCV and LSV3, no statistical differences were observed between both groups. Despite high detected LSV3 prevalence and viral loads around 6.00 log10 viral copies/bee, this lineage probably has a limited impact on the health status of honeybee colonies. The determined viral loads between 3.94 log10 and 13.17 log10 in positive samples for six viruses, collected over 10 consecutive months, including winter, present additional information of high viral load variations in healthy honeybee colonies.


Assuntos
Abelhas/virologia , Reação em Cadeia da Polimerase Via Transcriptase Reversa/métodos , Carga Viral/estatística & dados numéricos , Vírus/classificação , Vírus/genética , Animais , Dicistroviridae/genética , Prevalência , Vírus de RNA/genética , RNA Viral , Reação em Cadeia da Polimerase Via Transcriptase Reversa/normas , Estações do Ano , Carga Viral/métodos , Carga Viral/normas , Vírus/isolamento & purificação , Vírus/patogenicidade
7.
J Infect Dis ; 224(8): 1325-1332, 2021 Oct 28.
Artigo em Inglês | MEDLINE | ID: mdl-34329473

RESUMO

BACKGROUND: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) reverse-transcription polymerase chain reaction (RT-PCR) provides a highly variable cycle threshold (Ct) value that cannot distinguish viral infectivity. Subgenomic ribonucleic acid (sgRNA) has been used to monitor active replication. Given the importance of long RT-PCR positivity and the need for work reincorporation and discontinuing isolation, we studied the functionality of normalized viral loads (NVLs) for patient monitoring and sgRNA for viral infectivity detection. METHODS: The NVLs measured through the Nucleocapsid and RNA-dependent-RNA-polymerase genes and sgRNA RT-PCRs were performed in 2 consecutive swabs from 84 healthcare workers. RESULTS: The NVLs provided similar and accurate quantities of both genes of SARS-CoV-2 at 2 different timepoints of infection, overcoming Ct-value and swab collection variability. Among SARS-CoV-2-positive samples, 51.19% were sgRNA-positive in the 1st RT-PCR and 5.95% in the 2nd RT-PCR. All sgRNA-positive samples had >4 log10 RNA copies/1000 cells, whereas samples with ≤1 log10 NVLs were sgRNA-negative. Although NVLs were positive until 29 days after symptom onset, 84.1% of sgRNA-positive samples were from the first 7 days, which correlated with viral culture viability. Multivariate analyses showed that sgRNA, NVLs, and days of symptoms were significantly associated (P < .001). CONCLUSIONS: The NVLs and sgRNA are 2 rapid accessible techniques that could be easily implemented in routine hospital practice providing a useful proxy for viral infectivity and coronavirus disease 2019 patient follow-up.


Assuntos
COVID-19/diagnóstico , SARS-CoV-2/isolamento & purificação , Carga Viral/normas , Adulto , Assistência ao Convalescente/normas , COVID-19/terapia , COVID-19/transmissão , COVID-19/virologia , Teste de Ácido Nucleico para COVID-19/estatística & dados numéricos , Tomada de Decisão Clínica/métodos , Monitoramento Epidemiológico , Feminino , Pessoal de Saúde/estatística & dados numéricos , Humanos , Masculino , Pessoa de Meia-Idade , Nasofaringe/patologia , Nasofaringe/virologia , RNA Viral/isolamento & purificação , SARS-CoV-2/genética , SARS-CoV-2/patogenicidade
8.
Virol J ; 18(1): 38, 2021 02 18.
Artigo em Inglês | MEDLINE | ID: mdl-33602271

RESUMO

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.


Assuntos
Transfusão de Sangue , DNA Viral/sangue , Herpesvirus Humano 6/genética , Herpesvirus Humano 7/genética , Herpesvirus Humano 8/genética , Reação em Cadeia da Polimerase Multiplex/métodos , DNA Viral/genética , Feminino , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificação , Herpesvirus Humano 8/isolamento & purificação , Humanos , Masculino , Reação em Cadeia da Polimerase Multiplex/normas , Estudos Prospectivos , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Carga Viral/métodos , Carga Viral/normas
10.
J Med Virol ; 93(6): 3707-3713, 2021 06.
Artigo em Inglês | MEDLINE | ID: mdl-33174623

RESUMO

As we strive towards the WHO goal of elimination of viral hepatitis as a public health threat by 2030, implementation of reliable, accurate diagnostic assays is crucial to identify those at risk of disease progression and those at risk of transmission. Ironically those at greatest risk of chronic hepatitis B are often in resource-poor regions with limited access to testing, collection, storage, and/or transportation of peripheral blood. The Xpert® HBV Viral Load assay provides an easy to use, convenient means of measuring load on GeneXpert platforms. In this study, the Xpert assay is evaluated against four commercially available high-throughput assays for Hepatitis B virus (HBV) loads. In addition application of dried blood spots (DBS) for estimation of viral load is assessed on real-world samples collected from a remote Pacific Island, Kiribati. A total of 107 serum/plasma samples were tested in the Xpert HBV load assay and compared with the Abbott m2000, Alinity m, and Roche Cobas CAP/CTM and 6800. Fifty-three DBS were tested in the Xpert assay and compared with matching serum samples. Overall 82% serum/plasma samples demonstrated good correlation between the Xpert and Roche and Abbott assays, to within 0.5 log10 IU/ml. The greatest discrepancies were seen at the limits of quantification of all assays. About 85.4% DBS gave estimable viral loads to within 1 log10 IU/ml of the serum load. The Xpert HBV viral load assay is recommended for all settings but particularly useful for resource-poor settings. Utility of DBS with the Xpert assay provides a simple means for testing in remote settings.


Assuntos
Teste em Amostras de Sangue Seco/normas , Vírus da Hepatite B/genética , Hepatite B/sangue , Técnicas de Diagnóstico Molecular/normas , Carga Viral/métodos , Carga Viral/normas , Teste em Amostras de Sangue Seco/métodos , Hepatite B/virologia , Humanos , Limite de Detecção , Técnicas de Diagnóstico Molecular/métodos , Mutação , Estudos Prospectivos , Kit de Reagentes para Diagnóstico/normas , Estudos Retrospectivos , Sensibilidade e Especificidade , Manejo de Espécimes , Carga Viral/instrumentação
11.
Rev Med Virol ; 31(2): e2165, 2021 03.
Artigo em Inglês | MEDLINE | ID: mdl-32978882

RESUMO

HIV-1 viral load (VL) testing is a crucial element in providing an antiretroviral treatment monitoring program. The success of these programs depends on the availability and quality of the VL testing services. There are several pre-analytic factors which can affect the quality of VL testing. Many of the challenges faced by resource-limited countries result in a compromise of specimen integrity, thus limiting widespread access to VL monitoring. The various logistic and financial challenges that exist are not insurmountable and several innovative solutions currently exist to overcome these barriers to providing widespread VL testing. This review summarizes the VL testing challenges in resource-limited settings and provides an overview of potential solutions including testing dried blood spots, dried plasma spots, plasma separation cards and the use of point of care tests.


Assuntos
Infecções por HIV/diagnóstico , HIV-1/genética , Manejo de Espécimes/normas , Carga Viral/métodos , Carga Viral/normas , Infecções por HIV/virologia , Humanos , Garantia da Qualidade dos Cuidados de Saúde
12.
Clin Chim Acta ; 511: 177-180, 2020 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-33068630

RESUMO

To clarify the effect of different respiratory sample types on SARS-CoV-2 detection, we collected throat swabs, nasal swabs and hock-a-loogie saliva or sputum, and compared their detection rates and viral loads. The detection rates of sputum (95.65%, 22/23) and hock-a-loogie saliva (88.09%, 37/42) were significantly higher than those in throat swabs (41.54%, 27/65) and nasal swabs (72.31%, 47/65) (P < 0.001). The Ct Values of sputum, hock-a-loogie saliva and nasal swabs were significantly higher than that in throat swabs, whereas no significant difference was observed between sputum and saliva samples. Hock-a-loogie saliva are reliable sample types that can be used to detect SARS-CoV-2, and worthy of clinical promotion.


Assuntos
COVID-19/diagnóstico , COVID-19/genética , Reação em Cadeia da Polimerase/normas , SARS-CoV-2/genética , Saliva/virologia , Manejo de Espécimes/normas , Adulto , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Nasofaringe/virologia , Reação em Cadeia da Polimerase/métodos , Estudos Prospectivos , SARS-CoV-2/isolamento & purificação , Manejo de Espécimes/métodos , Escarro/virologia , Carga Viral/métodos , Carga Viral/normas
13.
J Appl Microbiol ; 129(3): 768-774, 2020 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-32202037

RESUMO

AIMS: To evaluate the potential use of synthetic oligonucleotides as a standard curve for proviral load (PVL) of human T-cell leukaemia virus type 1 (HTLV-1) quantification in peripheral blood mononuclear cells (PBMC) of HTLV-1-infected individuals by quantitative real-time polymerase chain reaction (qPCR) analysis. METHODS AND RESULTS: Synthetic oligonucleotides based on HTLV-1 genome were customized to use as a standard curve. Twelve anti-HTLV-1-positive samples with known HTLV-1 PVL, previously quantified by qPCR assay using TARL-2 cells as a conventional standard curve, were submitted to the new protocol. The proviral quantification levels had a high concordance with qPCR results using a conventional standard curve. The results demonstrate that the conventional standard curve can be replaced by a synthetic standard curve due to its ability to quantification based on the linearity and qPCR efficiency and similar results with a validated qPCR assay using a conventional standard curve. CONCLUSIONS: Synthetic oligonucleotides standard curves could be a very useful tool on HTLV-1 diagnosis and absolute HTLV-1 PVL quantification. SIGNIFICANCE AND IMPACT OF THE STUDY: HTLV-1 PVL determination using synthetic oligonucleotides standard curve by qPCR could be a helpful alternative for the laboratories that monitor infected patients as an important prognostic factor in HTLV-1-associated diseases progression. Also, it can decrease costs and overcome the biological limitations of the plasmid curve.


Assuntos
Infecções por HTLV-I/diagnóstico , Vírus Linfotrópico T Tipo 1 Humano/isolamento & purificação , Provírus/isolamento & purificação , Reação em Cadeia da Polimerase em Tempo Real/métodos , Carga Viral/métodos , Adulto , DNA Viral/genética , Progressão da Doença , Genoma Viral/genética , Infecções por HTLV-I/sangue , Infecções por HTLV-I/virologia , Vírus Linfotrópico T Tipo 1 Humano/genética , Humanos , Leucócitos Mononucleares/virologia , Pessoa de Meia-Idade , Oligonucleotídeos/síntese química , Oligonucleotídeos/genética , Prognóstico , Provírus/genética , Reação em Cadeia da Polimerase em Tempo Real/normas , Carga Viral/normas
14.
Int J Food Microbiol ; 322: 108587, 2020 Jun 02.
Artigo em Inglês | MEDLINE | ID: mdl-32203767

RESUMO

Hepatitis E virus (HEV) is a zoonotic pathogen spreading worldwide. Pig was known as its first and main animal reservoir. In China, pork consumption is very large and the risk of potential HEV contamination should not be underestimated. The present study aims to develop a quantitative real-time reverse transcription combining recombinase polymerase amplification assay (RT-qRPA) for the rapid detection of HEV RNA presence in raw pork liver on the Jinzhou markets in China. Methods: the specific primers and probes for RT-qRPA assay were designed targeting the ORF2/3 conserved region in genotype 4 swine HEV isolate (accession no. DQ279091.2) according to the TwistDx manual instructions. The specificity, sensitivity and reproducibility evaluations of the RT-qRPA method were subsequently conducted in assessing agreement with the standard RT-qPCR method. Results: the qRPA method step exhibited the obvious time-saving advantage which worked under the isothermal condition at 39 °C within about 30 min to complete the run while the compared standard qPCR method in the same cycle took almost 60 min to do. Both methods could exclusively detect the HEV genome equivalents from the quantified HEV-VLPs spiked samples. And both methods shared the same limit of detection (LOD) that was estimated at 1.25 × 103 genome equivalents copies/g spiked sample by the probit analysis. The recovery rate of HEV-VLPs reached a range of 9.56-14.65% by the RT-qRPA method which was higher than that of 1.34-2.34% by the standard RT-qPCR method. The detected HEV RNA positive rate in the field was 1.8% (1 out of 55) by both methods under Cohen's kappa statistic accessing with perfect agreement (κ = 1.00, p < 0.0005). The viral load in positive sample detected by the RT-qRPA method was estimated at 2.2125 × 105 genome copies/g pork liver sample. Conclusions, the present reported RT-qRPA method mainly targeting genotype 4 HEV is a rapid and reliable method. Its time-saving quality offers a promising for the development of a portable tool used in the routine monitoring of HEV contamination in the field.


Assuntos
Microbiologia de Alimentos/métodos , Vírus da Hepatite E/isolamento & purificação , Fígado/virologia , Carne de Porco/virologia , Carga Viral/métodos , Animais , China , Microbiologia de Alimentos/normas , Genótipo , Vírus da Hepatite E/genética , Limite de Detecção , Reação em Cadeia da Polimerase em Tempo Real/métodos , Reação em Cadeia da Polimerase em Tempo Real/normas , Reprodutibilidade dos Testes , Suínos , Fatores de Tempo , Carga Viral/normas
15.
Clin Microbiol Infect ; 26(12): 1688.e1-1688.e7, 2020 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-32184172

RESUMO

HIV-1 diversity poses major challenges to viral load assays because genetic polymorphisms can impede nucleic acid detection. In addition to the on-going viral diversification within the HIV-1 group M pandemic, HIV-1 genetic diversity is further increased by non-group M infections, such as HIV-1 groups O (HIV-1-O), N and P. We here conducted a systematic evaluation of commercially available PCR assays to detect HIV-1-O isolates. We collected 25 primary HIV-1-O isolates covering all genetic clusters within HIV-1-O. Subsequently, this panel of isolates was tested on eight commercially available quantitative and five qualitative HIV-1 PCR-based assays in serial dilutions. Sequence analyses were performed for severe cases of underquantification or lack of detection. We observed differences between the assays in quantification that depended on the HIV-1-O isolate's subgroup. All three tested HIV-1-O subgroup IV isolates were underquantified by the Roche CAP/CTM >800-fold compared to the Abbott RealTime assay. In contrast, the latter assay underquantified several subgroup I isolates >200-fold. Notably, the Xpert HIV-1 Viral Load test from Cepheid failed to detect two of the HIV-1-O isolates, whereas the Roche Cobas 8800 assay readily detected all isolates. Comparative sequence analyses identified polymorphisms in the HIV-1-O long-terminal repeat and integrase genes that likely underlie inadequate nucleic acid amplification. Potential viral load underquantification should be considered in therapeutic monitoring of HIV-1-O-infected patients. Pre-clinical assessments of HIV-1 diagnostic assays could be harmonized by establishing improved and internationally standardized panels of HIV-1 isolates that cover the dynamic diversity of circulating HIV-1 strains.


Assuntos
Infecções por HIV , HIV-1 , Técnicas de Amplificação de Ácido Nucleico , Carga Viral , Infecções por HIV/diagnóstico , Infecções por HIV/virologia , HIV-1/classificação , HIV-1/genética , Humanos , Técnicas de Amplificação de Ácido Nucleico/métodos , Técnicas de Amplificação de Ácido Nucleico/normas , RNA Viral/análise , RNA Viral/genética , Reprodutibilidade dos Testes , Carga Viral/métodos , Carga Viral/normas
16.
J Clin Virol ; 125: 104289, 2020 04.
Artigo em Inglês | MEDLINE | ID: mdl-32097889

RESUMO

BACKGROUND: Early infant diagnosis (EID) of HIV-1 exposed infants enables timely initiation of antiretroviral therapy (ART), thereby allowing early diagnosis and treatment to slow disease progression and reduce mortality. Turn-around time to results, partially caused by low to medium throughput technology, remains a hindrance to early treatment. A major solution to this challenge is to incorporate high throughput and accurate technologies in the testing process. The Hologic Aptima Quant Dx Assay (Aptima) is a CE marked Real-Time TMA assay running on the high throughput Panther system. OBJECTIVES: The objective of this study was to evaluate the performance of Aptima for EID using dried blood spots. STUDY DESIGN: This was a cross-sectional prospective study of 2,048 infants seeking HIV services from health facilities in Western Kenya, Africa. Capillary Dried Blood Spot samples DBS were collected from infants with the consent of their mothers. The qualitative performance of Aptima was compared with the Roche COBAS Ampliprep/ COBAS Taqman HIV-1 Qualitative Test v2.0 (CAP/CTM), using these DBS. Demographic information of the participants was also collected. RESULTS: A total of 1,975 successful comparisons between the two platforms were included in the analysis. The overall agreement between the assays was 99.65 %. The sensitivity and specificity of Aptima was 95.24 % (95 % CI 88.40-98.19 %) and 99.84 % (95 % CI 99.49-99.92 %) respectively. CONCLUSIONS: Aptima assay has performance characteristics that are comparable to those of the Roche CAP/CTM for qualitative testing on DBS taken from infants. The two assays can therefore be used interchangeably for Early Infant Diagnosis of HIV.


Assuntos
Infecções por HIV/diagnóstico , HIV-1/isolamento & purificação , Técnicas de Diagnóstico Molecular/instrumentação , Técnicas de Diagnóstico Molecular/normas , Kit de Reagentes para Diagnóstico/normas , Carga Viral/instrumentação , Estudos Transversais , Teste em Amostras de Sangue Seco/métodos , Diagnóstico Precoce , Feminino , Infecções por HIV/sangue , HIV-1/genética , Humanos , Lactente , Recém-Nascido , Quênia , Masculino , Técnicas de Diagnóstico Molecular/métodos , Estudos Prospectivos , RNA Viral/sangue , Sensibilidade e Especificidade , Carga Viral/métodos , Carga Viral/normas
17.
Diagn Microbiol Infect Dis ; 96(2): 114946, 2020 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-31771903

RESUMO

Quantification of HBV DNA is used for initiating and monitoring antiviral treatment. We have evaluated the Xpert HBV Viral Load (VL) assay on the GeneXpert instrument. We estimated its limit of detection to be 7.5 IU/mL. Reproducibility was 1.1-12.7% as assessed by the coefficients of variation for 3 different samples. The assay was linear from 2 to 8 log10 IU/mL for HBV genotypes A to F. Its clinical performance was evaluated by testing prospectively 100 HBV DNA-positive samples with the Xpert HBV VL and Aptima Quant HBV assays. The results from the 2 assays were correlated, with a modest bias (-0.10 log10 IU/mL) between them by Bland-Altman analysis. Patient monitoring with 80 samples performed with both assays gave similar patient profiles with trends in the same direction. The Xpert HBV Viral load assay is reliable enough for quantifying HBV DNA in clinical practice.


Assuntos
DNA Viral , Vírus da Hepatite B/genética , Hepatite B/diagnóstico , Hepatite B/virologia , Técnicas de Diagnóstico Molecular , Carga Viral/métodos , Genótipo , Humanos , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Carga Viral/normas , Fluxo de Trabalho
18.
Turk J Gastroenterol ; 30(11): 957-963, 2019 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-31767550

RESUMO

BACKGROUND/AIMS: To evaluate the HCV RNA genotyping and HDV RNA tests that are performed in molecular microbiology laboratories in Turkey as part of a national external quality assessment programme, MOTAKK (Moleküler Tanida Kalite Kontrol) (English translation: Quality control in molecular diagnostics). MATERIALS AND METHODS: Plasmas having different HCV RNA genotypes were used to prepare HCV genotype control sera. The HDV RNA main stock was prepared from patients with chronic delta hepatitis who had a significant amount of viral load detected, as per the WHO reference materials on viral load studies that were compiled for the purpose of developing HDV RNA control sera. Samples with different viral loads were prepared from this main stock by dilution. The prepared controls were delivered to the registered laboratories. The laboratories carried out the relevant tests and entered their results via the MOTAKK web page. External quality assessment (EQA) reports of the participants were uploaded to the website as well. RESULTS: In total, there were 23 participating laboratories, out of which 20 exclusively performed HCV genotyping, and 15 and 16 only performed HDV RNA in 2015 and 2016, respectively. The success rate of the results of the HCV genotype was 56-96% in 2015 and 30-95% in 2016. The tube with a 30% success rate had a recombinant type of HCV, therefore, it could not be detected in most of the laboratories. The HDV RNA results were evaluated qualitatively. Accordingly, HDV RNA detection rates of participant laboratories were 71-100% in 2015 and 50-100% in 2016. CONCLUSION: This study was the first national external quality control program in Turkey regarding HCV RNA genotyping and HDV RNA in the field of molecular microbiology, and it was implemented successfully.


Assuntos
Técnicas de Genotipagem/normas , Garantia da Qualidade dos Cuidados de Saúde/normas , Controle de Qualidade , RNA Viral/sangue , Carga Viral/normas , Hepacivirus/genética , Hepatite C Crônica/sangue , Hepatite C Crônica/virologia , Hepatite D Crônica/sangue , Hepatite D Crônica/virologia , Vírus Delta da Hepatite/genética , Humanos , Avaliação de Programas e Projetos de Saúde , Turquia , Carga Viral/métodos
19.
J Clin Microbiol ; 58(1)2019 12 23.
Artigo em Inglês | MEDLINE | ID: mdl-31619529

RESUMO

Despite the adaptation of international standards, quantitative viral load testing of transplant-associated viruses continues to be limited by interlaboratory disagreement. Studies have suggested that this disagreement and the poor commutability of standards may, in some cases, be linked to amplicon size and the fragmentation of circulating viral DNA. We evaluated target fragmentation as a cause of noncommutability and pretest fragmentation of quantitative standards as a potential means of increasing commutability and interassay agreement. Forty-two cytomegalovirus (CMV)-positive and 41 Epstein-Barr virus (EBV)-positive plasma samples, together with two different quantitative standards for each virus, were tested as unknowns using 10 different quantitative PCR assays at 5 different laboratories. Standards were tested both intact and after intentional fragmentation by ultrasonication. Quantitative agreement between methods was assessed, together with commutability, using multiple statistical approaches. Most assays yielded results within 0.5 log10 IU/ml of the mean for CMV, while for EBV a greater variability of up to 1.5 log10 IU/ml of the mean was shown. Commutability showed marked improvement following fragmentation of both CMV standards but not after fragmentation of the EBV standards. These findings confirm the impact of amplicon size and target fragmentation on commutability for CMV and suggest that for some (but not all) viruses, interlaboratory harmonization can be improved through the use of fragmented quantitative standards.


Assuntos
Infecções por Citomegalovirus/diagnóstico , Infecções por Citomegalovirus/virologia , Citomegalovirus/genética , Infecções por Vírus Epstein-Barr/diagnóstico , Infecções por Vírus Epstein-Barr/virologia , Herpesvirus Humano 4/genética , Carga Viral/métodos , DNA Viral , Humanos , Reação em Cadeia da Polimerase em Tempo Real/métodos , Reação em Cadeia da Polimerase em Tempo Real/normas , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Carga Viral/normas
20.
PLoS One ; 14(10): e0223573, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31622394

RESUMO

Regular plasma HIV-RNA testing for persons living with HIV on antiretroviral therapy (ART) is now the global standard, but as many as 60% of persons in Africa today on ART do not have access to standard laboratory HIV-RNA assays. As a result, patients in Zambia often receive treatment without any means of determining true virologic failure, which poses a risk of premature switch of ART regimens and widespread HIV drug resistance. Dry blood spots (DBS) on the other hand require unskilled personnel and less complex storage supply chain so are ideal to capture viral-load results from HIV patients outside clinic settings. We assess collection of DBS in the community using non-medically trained personnel (NMP) and documented challenges. We trained 23 NMP to collect DBS from lost to follow-up (LTFU) patients in 4 rural and urban Zambian districts. We developed a phlebotomy box to transport DBS without contamination at ambient temperature and concomitant training and standard operating procedures. We evaluated this through field observations, bi-weekly meetings, reports, and staff meetings. The laboratory assessed DBS quality for testing validity. We attempted to collect DBS from 357 participants in the community. Though individual reasons for refusal from the remaining 37% were not collected, NMPs reported privacy concerns, awkward box-size which drew attention in the community and fears of undisclosed uses of samples related to witchcraft and circulating narratives about past research. Successful DBS collection was not associated with patient gender, age, time on ART, enrolment CD4, facility. DBS viral-load collection by NMP is feasible in Zambia. Our training approach and assessments of NMP not part of the health system can be extended to patients by giving them more responsibility to manage their own differentiated care groups. Concerted efforts that compare collection of DBS by NMP to those collected by skilled-medical personnel are needed.


Assuntos
Serviços de Saúde Comunitária , Teste em Amostras de Sangue Seco , Pessoal de Saúde , Recursos em Saúde , Manejo de Espécimes , Carga Viral/métodos , Adulto , Serviços de Saúde Comunitária/métodos , Teste em Amostras de Sangue Seco/métodos , Teste em Amostras de Sangue Seco/normas , Feminino , Infecções por HIV/diagnóstico , Infecções por HIV/virologia , HIV-1 , Humanos , Masculino , Índice de Gravidade de Doença , Manejo de Espécimes/métodos , Manejo de Espécimes/normas , Carga Viral/normas
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...