The reduction of microglial efferocytosis is concomitant with depressive-like behavior in CUMS-treated mice.

BACKGROUND: Microglial efferocytosis plays a crucial role in facilitating and sustaining homeostasis in the central nervous system, and it is involved in neuropsychiatric disorders. How microglial efferocytosis is affected under the condition of major depressive disorder (MDD) remains elusive. In this study, we hypothesized that microglial efferocytosis in the hippocampus is impaired in the chronic unpredicted mild stress (CUMS) model of MDD, which is involved in the development of MDD. METHOD: Depressive-like behavior in adult male mice was induced by CUMS and confirmed by behavioral tests. Microglial efferocytosis was evaluated using immunofluorescence staining of hippocampal slices and primary microglia co-cultured with apoptotic cells. The protein and mRNA levels of phagocytosis-related molecules and inflammation-related cytokines were detected using western blotting and RT-qPCR, respectively. Annexin V was injected to mimic impairment of microglial efferocytosis. TREM2-siRNA was further used on primary microglia to examine efferocytosis-related signaling pathways. RESULTS: Microglia were activated and the expression of proinflammatory cytokines was increased in CUMS mice, while microglial efferocytosis and efferocytosis-related molecules were decreased. Inhibition of the TREM2/Rac1 pathway impaired microglial efferocytosis. Annexin V injection inhibited microglial efferocytosis, increased inflammation in the hippocampus and depressive-like behavior. LIMITATIONS: The potential antidepressant effect of the upregulation of the TREM2/Rac1 pathway was not evaluated. CONCLUSIONS: Impairment of microglial efferocytosis is involved in the development of depressive-like behavior, with downregulation of the TREM2/Rac1 pathway and increased inflammation. These results may increase our understanding of the pathophysiological mechanisms associated with MDD and provide novel targets for therapeutic interventions.

First Report of the guava root-knot nematode (Meloidogyne enterolobii) on Selenicereus costaricensis in Guangxi, China.

Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67″ N; 108°40'43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 µm, stylet lengths = 15.1 ± 0.9 µm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 µm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 µm, stylet lengths = 14.7 ± 0.5 µm, DGO = 3.5 ± 0.4 µm, tail lengths averaged = 43.6 ± 9.7 µm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.

Biocontrol potential of lipopeptides produced by Paenibacillus polymyxa AF01 against Neoscytalidium dimidiatum in pitaya.

Pitaya canker, caused by Neoscytalidium dimidiatum, is one of the most important fungal diseases that cause significant losses in production. To replace chemical pesticides, the use of biocontrol strains to manage plant diseases has been the focus of research. In this study, the bacterial strain AF01, identified as Paenibacillus polymyxa, exhibited significant antifungal effects against N. dimidiatum and four other pitaya fungal pathogens. The strain P. polymyxa AF01 produces 13 fusaricidins, which directly inhibit mycelial growth, spore germination and germ tube elongation by causing the membrane integrity and cell ultrastructure to incur irreversible damage. Pot experiment and yield test confirmed that AF01 provided preservative effects by reducing the disease index. In comparison to the untreated control groups, RNA-seq data showed that P. polymyxa AF01 selectively blocked some transcription and translation processes and inhibited RNA and DNA structural dynamics, energy production and conversion, and signal transduction, particularly cell wall biosynthesis, changes in membrane permeability, and impairment of protein biosynthesis. Thus, P. polymyxa AF01 could be potentially useful as a suitable biocontrol agent for pitaya canker.

The sequence of pulmonary vessels ligation during lobectomy for non-small cell lung cancer: A systematic review and meta-analysis.

OBJECTIVES: The effects of ligating the pulmonary vein first or pulmonary artery first during lobectomy on the long-term survival of patients with non-small cell lung cancer (NSCLC) remain controversial. We conducted the first systematic review and meta-analysis to determine the association between different sequences of vessel ligation during lobectomy and the prognosis of patients with NSCLC. METHODS: Literature retrieval was performed by systematically searching Embase, PubMed and Web of Science to identify relevant articles published from the inception of each database to November 2020. The overall survival (OS) and disease-free survival (DFS) of patients treated with vein-first ligation versus those treated with artery-first ligation during lobectomy were analyzed. A standard fixed-effect model test (Mantel-Haenszel method) was used to calculate pooled hazard ratios (HRs) and 95% confidence intervals (CIs). Heterogeneity was assessed using the Q-test and I2-test. Sensitivity analysis was performed to further examine the stability of pooled HRs. RESULTS: Five studies with a total of 1109 patients receiving lobectomy, including one randomized controlled trial and four retrospective studies, were included in this meta-analysis. The results showed that patients with vein-first ligation had a significantly better OS (HR 1.25, 95% CI 1.03-1.50; P = 0.02) and DFS (HR 1.54, 95% CI 1.16-2.04; P = 0.003) than those with artery-first ligation during lobectomy. Significant heterogeneity and publication bias were not observed during analysis. CONCLUSION: Our meta-analysis indicates that vein-first ligation may improve the prognosis of NSCLC patients receiving lobectomy. Therefore, vein-first ligation is recommended during lobectomy for patients with non-small cell lung cancer whenever possible.

Secondary Metabolites of the Endophytic Fungus Lachnum abnorme from Ardisia cornudentata.

Fractionation of an EtOAc-soluble fraction of the solid fermentate of an endophytic fungus, Lachnum abnorme Mont. BCRC 09F0006, derived from the endemic plant, Ardisia cornudentata Mez. (Myrsinaceae), resulted in the isolation of three new chromones, lachnochromonins D-F (1-3), one novel compound, lachabnormic acid (4), along with nine known compounds (5-13). Their structures were elucidated by spectroscopic analyses. Alternariol-3,9-dimethyl ether (6) was given the correct data as well as 2D spectral analyses for the first time. This is the first report of the isolation of one unprecedented compound 4 from Lachnum genus, while all known compounds were also found for the first time from Lachnum. The effects of some isolates (3, 4, 7-9, 10, and 13) on the inhibition of nitric oxide (NO) production in lipopolysaccharide (LPS)-activated RAW 264.7 murine macrophages were also evaluated. Several compounds exhibited weak inhibitory activity on lipopolysaccharide (LPS)-stimulated NO production in RAW 264.7 macrophages.

The mating-type locus b of the sugarcane smut Sporisorium scitamineum is essential for mating, filamentous growth and pathogenicity.

Sporisorium scitamineum is the causal agent of sugarcane smut, which is one of the most serious constraints to global sugarcane production. S. scitamineum and Ustilago maydis are two closely related smut fungi, that are predicted to harbor similar sexual mating processes/system. To elucidate the molecular basis of sexual mating in S. scitamineum, we identified and deleted the ortholog of mating-specific U. maydis locus b, in S. scitamineum. The resultant b-deletion mutant was defective in mating and pathogenicity in S. scitamineum. Furthermore, a functional b locus heterodimer could trigger filamentous growth without mating in S. scitamineum, and functionally replace the b locus in U. maydis in terms of triggering aerial filament production and forming solopathogenic strains, which do not require sexual mating prior to pathogenicity on the host plants.

Biological evaluation of secondary metabolites from the root of Machilus obovatifolia.

Bioassay-guided fractionation of the root of Machilus obovatifolia led to the isolation of four new lignans, epihenricine B (1), threo-(7'R,8'R) and threo-(7'S,8'S)-methylmachilusol D (2 and 3), and isofragransol A (4), along with 23 known compounds. The compounds were obtained as isomeric mixtures (i.e., 2/3 and 4/20, resp.). The structures were elucidated by spectral analyses. Among the isolates, 1, licarin A (12), guaiacin (14), (±)-syringaresinol (21), and (-)-epicatechin (23) showed ABTS (=2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) cation radical-scavenging activity, with SC50 values of 11.7±0.5, 12.3±1.1, 11.0±0.1, 10.6±0.3, and 9.5±0.2 µM in 20 min, respectively. In addition, kachirachirol B (17) showed cytotoxicity against the NCI-H460 cell line with an IC50 value of 3.1 µg/ml.