Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 57
Filter
Add more filters








Publication year range
1.
Plant Cell Rep ; 43(6): 138, 2024 May 11.
Article in English | MEDLINE | ID: mdl-38733408

ABSTRACT

KEY MESSAGE: The soybean gene GmSABP2-1 encodes methyl salicylate esterase and its overexpression led to significant reduction in development of pathogenic soybean cyst nematode. Soybean cyst nematode (SCN, Heterodera glycines) is one of the most devastating pests of soybean (Glycine max L. Merr.). In searching for SCN-defense genes, a soybean gene of the methylesterase (MES) family was found to be upregulated in an SCN-resistant soybean line and downregulated in an SCN-susceptible line upon SCN infection. This gene was designated as GmSABP2-1. Here, we report on biochemical and overexpression studies of GmSABP2-1 to examine its possible function in SCN resistance. The protein encoded by GmSABP2-1 is closely related to known methyl salicylate esterases. To determine the biochemical function of GmSABP2-1, a full-length cDNA of GmSABP2-1 was cloned into a protein expression vector and expressed in Escherichia coli. The resulting recombinant GmSABP2-1 was demonstrated to catalyze the demethylation of methyl salicylate. The biochemical properties of GmSABP2-1 were determined. Its apparent Km value was 46.2 ± 2.2 µM for methyl salicylate, comparable to those of the known methyl salicylate esterases. To explore the biological significance of GmSABP2-1 in soybean defense against SCN, we first overexpressed GmSABP2-1 in transgenic hairy roots of an SCN-susceptible soybean line. When infected with SCN, GmSABP2-1-overexpressing hairy roots showed 84.5% reduction in the development of SCN beyond J2 stage. To provide further genetic evidence for the role of GmSABP2-1 in SCN resistance, stable transgenic soybean plants overexpressing GmSABP2-1 were produced. Analysis of the GmSABP2-1-overexpressing lines showed a significant reduction in SCN development compared to non-transgenic plants. In conclusion, we demonstrated that GmSABP2-1 encodes methyl salicylate esterase and functions as a resistance-related gene against SCN.


Subject(s)
Glycine max , Plant Diseases , Salicylates , Tylenchoidea , Animals , Carboxylic Ester Hydrolases/metabolism , Carboxylic Ester Hydrolases/genetics , Disease Resistance/genetics , Gene Expression Regulation, Plant , Glycine max/genetics , Glycine max/parasitology , Plant Diseases/parasitology , Plant Diseases/genetics , Plant Proteins/genetics , Plant Proteins/metabolism , Plants, Genetically Modified , Salicylates/metabolism , Tylenchoidea/physiology , Tylenchoidea/pathogenicity
2.
ACS Sustain Chem Eng ; 12(5): 1897-1910, 2024 Feb 05.
Article in English | MEDLINE | ID: mdl-38333206

ABSTRACT

Economically viable production of biobased products and fuels requires high-yielding, high-quality, sustainable process-advantaged crops, developed using bioengineering or advanced breeding approaches. Understanding which crop phenotypic traits have the largest impact on biofuel economics and sustainability outcomes is important for the targeted feedstock crop development. Here, we evaluated biomass yield and cell-wall composition traits across a large natural variant population of switchgrass (Panicum virgatum L.) grown across three common garden sites. Samples from 331 switchgrass genotypes were collected and analyzed for carbohydrate and lignin components. Considering plant survival and biomass after multiple years of growth, we found that 84 of the genotypes analyzed may be suited for commercial production in the southeastern U.S. These genotypes show a range of growth and compositional traits across the population that are apparently independent of each other. We used these data to conduct techno-economic analyses and life cycle assessments evaluating the performance of each switchgrass genotype under a standard cellulosic ethanol process model with pretreatment, added enzymes, and fermentation. We find that switchgrass yield per area is the largest economic driver of the minimum fuel selling price (MSFP), ethanol yield per hectare, global warming potential (GWP), and cumulative energy demand (CED). At any yield, the carbohydrate content is significant but of secondary importance. Water use follows similar trends but has more variability due to an increased dependence on the biorefinery model. Analyses presented here highlight the primary importance of plant yield and the secondary importance of carbohydrate content when selecting a feedstock that is both economical and sustainable.

3.
Plant Cell Rep ; 43(3): 69, 2024 Feb 12.
Article in English | MEDLINE | ID: mdl-38345745

ABSTRACT

KEY MESSAGE: Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.


Subject(s)
Oryza , Oryza/genetics , Droughts , Plants, Genetically Modified/genetics , Promoter Regions, Genetic/genetics , Gene Expression Regulation, Plant
4.
Front Plant Sci ; 14: 1186292, 2023.
Article in English | MEDLINE | ID: mdl-37324708

ABSTRACT

Soybean (Glycine max) is an important crop in agricultural production where water shortage limits yields in soybean. Root system plays important roles in water-limited environments, but the underlying mechanisms are largely unknown. In our previous study, we produced a RNA-seq dataset generated from roots of soybean at three different growth stages (20-, 30-, and 44-day-old plants). In the present study, we performed a transcriptome analysis of the RNA-seq data to select candidate genes with probable association with root growth and development. Candidate genes were functionally examined in soybean by overexpression of individual genes using intact soybean composite plants with transgenic hairy roots. Root growth and biomass in the transgenic composite plants were significantly increased by overexpression of the GmNAC19 and GmGRAB1 transcriptional factors, showing up to 1.8-fold increase in root length and/or 1.7-fold increase in root fresh/dry weight. Furthermore, greenhouse-grown transgenic composite plants had significantly higher seed yield by about 2-fold than control plants. Expression profiling in different developmental stages and tissues showed that GmNAC19 and GmGRAB1 were most highly expressed in roots, displaying a distinct root-preferential expression. Moreover, we found that under water-deficit conditions, overexpression of GmNAC19 enhanced water stress tolerance in transgenic composite plants. Taken together, these results provide further insights into the agricultural potential of these genes for development of soybean cultivars with improved root growth and enhanced tolerance to water-deficit conditions.

5.
Front Plant Sci ; 14: 1129454, 2023.
Article in English | MEDLINE | ID: mdl-36875574

ABSTRACT

Trypsin inhibitors (TIs) are widely distributed in plants and are known to play a protective role against herbivores. TIs reduce the biological activity of trypsin, an enzyme involved in the breakdown of many different proteins, by inhibiting the activation and catalytic reactions of proteins. Soybean (Glycine max) contains two major TI classes: Kunitz trypsin inhibitor (KTI) and Bowman-Birk inhibitor (BBI). Both genes encoding TI inactivate trypsin and chymotrypsin enzymes, which are the main digestive enzymes in the gut fluids of Lepidopteran larvae feeding on soybean. In this study, the possible role of soybean TIs in plant defense against insects and nematodes was investigated. A total of six TIs were tested, including three known soybean trypsin inhibitors (KTI1, KTI2 and KTI3) and three genes encoding novel inhibitors identified in soybean (KTI5, KTI7, and BBI5). Their functional role was further examined by overexpression of the individual TI genes in soybean and Arabidopsis. The endogenous expression patterns of these TI genes varied among soybean tissues, including leaf, stem, seed, and root. In vitro enzyme inhibitory assays showed significant increase in trypsin and chymotrypsin inhibitory activities in both transgenic soybean and Arabidopsis. Detached leaf-punch feeding bioassays detected significant reduction in corn earworm (Helicoverpa zea) larval weight when larvae fed on transgenic soybean and Arabidopsis lines, with the greatest reduction observed in KTI7 and BBI5 overexpressing lines. Whole soybean plant greenhouse feeding bioassays with H. zea on KTI7 and BBI5 overexpressing lines resulted in significantly reduced leaf defoliation compared to non-transgenic plants. However, bioassays of KTI7 and BBI5 overexpressing lines with soybean cyst nematode (SCN, Heterodera glycines) showed no differences in SCN female index between transgenic and non-transgenic control plants. There were no significant differences in growth and productivity between transgenic and non-transgenic plants grown in the absence of herbivores to full maturity under greenhouse conditions. The present study provides further insight into the potential applications of TI genes for insect resistance improvement in plants.

6.
Front Plant Sci ; 13: 988048, 2022.
Article in English | MEDLINE | ID: mdl-36160998

ABSTRACT

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the -46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

7.
Front Plant Sci ; 13: 873480, 2022.
Article in English | MEDLINE | ID: mdl-35548302

ABSTRACT

Phytosensors are genetically engineered plant-based sensors that feature synthetic promoters fused to reporter genes to sense and report the presence of specific biotic and abiotic stressors on plants. However, when induced reporter gene output is below detectable limits, owing to relatively weak promoters, the phytosensor may not function as intended. Here, we show modifications to the system to amplify reporter gene signal by using a synthetic transcription factor gene driven by a plant pathogen-inducible synthetic promoter. The output signal was unambiguous green fluorescence when plants were infected by pathogenic bacteria. We produced and characterized a phytosensor with improved sensing to specific bacterial pathogens with targeted detection using spectral wavelengths specific to a fluorescence reporter at 3 m standoff detection. Previous attempts to create phytosensors revealed limitations in using innate plant promoters with low-inducible activity since they are not sufficient to produce a strong detectable fluorescence signal for standoff detection. To address this, we designed a pathogen-specific phytosensor using a synthetic promoter-transcription factor system: the S-Box cis-regulatory element which has low-inducible activity as a synthetic 4xS-Box promoter, and the Q-system transcription factor as an amplifier of reporter gene expression. This promoter-transcription factor system resulted in 6-fold amplification of the fluorescence after infection with a potato pathogen, which was detectable as early as 24 h post-bacterial infection. This novel bacterial pathogen-specific phytosensor potato plant demonstrates that the Q-system may be leveraged as a powerful orthogonal tool to amplify a relatively weak synthetic inducible promoter, enabling standoff detection of a previously undetectable fluorescence signal. Pathogen-specific phytosensors would be an important asset for real-time early detection of plant pathogens prior to the display of disease symptoms on crop plants.

8.
Front Plant Sci ; 13: 893610, 2022.
Article in English | MEDLINE | ID: mdl-35586220

ABSTRACT

Switchgrass (Panicum virgatum L.) has immense potential as a bioenergy crop with the aim of producing biofuel as an end goal. Nitrogen (N)-related sustainability traits, such as nitrogen use efficiency (NUE) and nitrogen remobilization efficiency (NRE), are important factors affecting switchgrass quality and productivity. Hence, it is imperative to develop nitrogen use-efficient switchgrass accessions by exploring the genetic basis of NUE in switchgrass. For that, we used 331 diverse field-grown switchgrass accessions planted under low and moderate N fertility treatments. We performed a genome wide association study (GWAS) in a holistic manner where we not only considered NUE as a single trait but also used its related phenotypic traits, such as total dry biomass at low N and moderate N, and nitrogen use index, such as NRE. We have evaluated the phenotypic characterization of the NUE and the related traits, highlighted their relationship using correlation analysis, and identified the top ten nitrogen use-efficient switchgrass accessions. Our GWAS analysis identified 19 unique single nucleotide polymorphisms (SNPs) and 32 candidate genes. Two promising GWAS candidate genes, caffeoyl-CoA O-methyltransferase (CCoAOMT) and alfin-like 6 (AL6), were further supported by linkage disequilibrium (LD) analysis. Finally, we discussed the potential role of nitrogen in modulating the expression of these two genes. Our findings have opened avenues for the development of improved nitrogen use-efficient switchgrass lines.

9.
Plant Cell Rep ; 41(2): 293-305, 2022 Feb.
Article in English | MEDLINE | ID: mdl-34674016

ABSTRACT

Proteinase inhibitors (PIs) from legumes have the potential for use as protectants in response to pests and pathogens. Legumes have evolved PIs that inhibit digestive proteinases upon herbivory resulting in delayed development, deformities, and reduced fertility of herbivorous insects. Legume PIs (serine proteinase inhibitors and cysteine proteinase inhibitors) have been overexpressed in plants to confer plant protection against herbivores. Recently, the co-expression of multiple PIs in transgenic plants enhanced host defense over single PI expression, i.e., in an additive fashion. Therefore, a synthetic PI could conceivably be designed using different inhibitory domains that may provide multifunctional protection. Little attention has yet given to expanding PI gene repertoires to improve PI efficacy for targeting multiple proteinases. Also, PIs have been shown to play an important role in response to abiotic stresses. Previously published papers have presented several aspects of strategic deployment of PIs in transgenic plants, which is the focus of this review by providing a comprehensive update of the recent progress of using PIs in transgenic plants. We also emphasize broadening the potential usefulness of PIs and their future direction in research, which will likely result in a more potent defense against herbivores.


Subject(s)
Fabaceae/physiology , Herbivory , Plants, Genetically Modified , Protease Inhibitors/metabolism , Animals , Gene Editing/methods , Gene Expression Regulation, Plant , Insecta , Plant Breeding , Plant Proteins/genetics , Plant Proteins/metabolism , Synthetic Biology/methods
10.
Plants (Basel) ; 10(12)2021 Dec 11.
Article in English | MEDLINE | ID: mdl-34961199

ABSTRACT

Unmanned aerial vehicles (UAVs) provide an intermediate scale of spatial and spectral data collection that yields increased accuracy and consistency in data collection for morphological and physiological traits than satellites and expanded flexibility and high-throughput compared to ground-based data collection. In this study, we used UAV-based remote sensing for automated phenotyping of field-grown switchgrass (Panicum virgatum), a leading bioenergy feedstock. Using vegetation indices calculated from a UAV-based multispectral camera, statistical models were developed for rust disease caused by Puccinia novopanici, leaf chlorophyll, nitrogen, and lignin contents. For the first time, UAV remote sensing technology was used to explore the potentials for multiple traits associated with sustainable production of switchgrass, and one statistical model was developed for each individual trait based on the statistical correlation between vegetation indices and the corresponding trait. Also, for the first time, lignin content was estimated in switchgrass shoots via UAV-based multispectral image analysis and statistical analysis. The UAV-based models were verified by ground-truthing via correlation analysis between the traits measured manually on the ground-based with UAV-based data. The normalized difference red edge (NDRE) vegetation index outperformed the normalized difference vegetation index (NDVI) for rust disease and nitrogen content, while NDVI performed better than NDRE for chlorophyll and lignin content. Overall, linear models were sufficient for rust disease and chlorophyll analysis, but for nitrogen and lignin contents, nonlinear models achieved better results. As the first comprehensive study to model switchgrass sustainability traits from UAV-based remote sensing, these results suggest that this methodology can be utilized for switchgrass high-throughput phenotyping in the field.

11.
Front Plant Sci ; 11: 574073, 2020.
Article in English | MEDLINE | ID: mdl-33193511

ABSTRACT

Unmanned aerial vehicle (UAV) technology is an emerging powerful approach for high-throughput plant phenotyping field-grown crops. Switchgrass (Panicum virgatum L.) is a lignocellulosic bioenergy crop for which studies on yield, sustainability, and biofuel traits are performed. In this study, we exploited UAV-based imagery (LiDAR and multispectral approaches) to measure plant height, perimeter, and biomass yield in field-grown switchgrass in order to make predictions on bioenergy traits. Manual ground truth measurements validated the automated UAV results. We found UAV-based plant height and perimeter measurements were highly correlated and consistent with the manual measurements (r = 0.93, p < 0.001). Furthermore, we found that phenotyping parameters can significantly improve the natural saturation of the spectral index of the optical image for detecting high-density plantings. Combining plant canopy height (CH) and canopy perimeter (CP) parameters with spectral index (SI), we developed a robust and standardized biomass yield model [biomass = (m × SI) × CP × CH] where the m is an SI-sensitive coefficient linearly varying with the plant phenological changing stage. The biomass yield estimates obtained from this model were strongly correlated with manual measurements (r = 0.90, p < 0.001). Taking together, our results provide insights into the capacity of UAV-based remote sensing for switchgrass high-throughput phenotyping in the field, which will be useful for breeding and cultivar development.

12.
Front Plant Sci ; 11: 843, 2020.
Article in English | MEDLINE | ID: mdl-32636863

ABSTRACT

Switchgrass (Panicum virgatum L.) is a lignocellulosic perennial grass with great potential in bioenergy field. Lignocellulosic bioenergy crops are mostly resistant to cell wall deconstruction, and therefore yield suboptimal levels of biofuel. The one-carbon pathway (also known as C1 metabolism) is critical for polymer methylation, including that of lignin and hemicelluloses in cell walls. Folylpolyglutamate synthetase (FPGS) catalyzes a biochemical reaction that leads to the formation of folylpolyglutamate, an important cofactor for many enzymes in the C1 pathway. In this study, the putatively novel switchgrass PvFPGS1 gene was identified and its functional role in cell wall composition and biofuel production was examined by RNAi knockdown analysis. The PvFPGS1-downregulated plants were analyzed in the field over three growing seasons. Transgenic plants with the highest reduction in PvFPGS1 expression grew slower and produced lower end-of-season biomass. Transgenic plants with low-to-moderate reduction in PvFPGS1 transcript levels produced equivalent biomass as controls. There were no significant differences observed for lignin content and syringyl/guaiacyl lignin monomer ratio in the low-to-moderately reduced PvFPGS1 transgenic lines compared with the controls. Similarly, sugar release efficiency was also not significantly different in these transgenic lines compared with the control lines. However, transgenic plants produced up to 18% more ethanol while maintaining congruent growth and biomass as non-transgenic controls. Severity of rust disease among transgenic and control lines were not different during the time course of the field experiments. Altogether, the unchanged lignin content and composition in the low-to-moderate PvFPGS1-downregulated lines may suggest that partial downregulation of PvFPGS1 expression did not impact lignin biosynthesis in switchgrass. In conclusion, the manipulation of PvFPGS1 expression in bioenergy crops may be useful to increase biofuel potential with no growth penalty or increased susceptibility to rust in feedstock.

13.
New Phytol ; 227(1): 168-184, 2020 07.
Article in English | MEDLINE | ID: mdl-32112408

ABSTRACT

DNA methylation is a widespread epigenetic mark that contributes to transcriptome reprogramming during plant-pathogen interactions. However, the distinct role of DNA methylation in establishing resistant and susceptible responses remains largely unexplored. Here, we developed and used a pair of near-isogenic lines (NILs) to characterize DNA methylome landscapes of soybean roots during the susceptible and resistant interactions with soybean cyst nematode (SCN; Heterodera glycines). We also compared the methylomes of the NILs and their parents to identify introduced and stably inherited methylation variants. The genomes of the NILs were substantially differentially methylated under uninfected conditions. This difference was associated with differential gene expression that may prime the NIL responses to SCN infection. In response to SCN infection, the susceptible line exhibited reduced global methylation levels in both protein-coding genes and transposable elements, whereas the resistant line showed the opposite response, increased global methylation levels. Heritable and novel nonparental differentially methylated regions overlapping with genes associated with soybean response to SCN infection were identified and validated using transgenic hairy root system. Our analyses indicate that DNA methylation patterns associated with the susceptible and resistant interactions are highly specific and that novel and stably inherited methylation variants are of biological significance.


Subject(s)
Cysts , Glycine max , Animals , DNA Methylation/genetics , Gene Expression Regulation, Plant , Plant Diseases/genetics , Glycine max/genetics
14.
Plant Cell Rep ; 39(2): 245-257, 2020 Feb.
Article in English | MEDLINE | ID: mdl-31728703

ABSTRACT

KEY MESSAGE: A novel and robust lipofection-mediated transfection approach for the use of DNA-free Cas9/gRNA RNP for gene editing has demonstrated efficacy in plant cells. Precise genome editing has been revolutionized by CRISPR/Cas9 systems. DNA-based delivery of CRISPR/Cas9 is widely used in various plant species. However, protein-based delivery of the in vitro translated Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complex into plant cells is still in its infancy even though protein delivery has several advantages. These advantages include DNA-free delivery, gene-edited host plants that are not transgenic, ease of use, low cost, relative ease to be adapted to high-throughput systems, and low off-target cleavage rates. Here, we show a novel lipofection-mediated transfection approach for protein delivery of the preassembled Cas9/gRNA RNP into plant cells for genome editing. Two lipofection reagents, Lipofectamine 3000 and RNAiMAX, were adapted for successful delivery into plant cells of Cas9/gRNA RNP. A green fluorescent protein (GFP) reporter was fused in-frame with the C-terminus of the Cas9 protein and the fusion protein was successfully delivered into non-transgenic tobacco cv. 'Bright Yellow-2' (BY2) protoplasts. The optimal efficiencies for Lipofectamine 3000- and RNAiMAX-mediated protein delivery were 66% and 48%, respectively. Furthermore, we developed a biolistic method for protein delivery based on the known proteolistics technique. A transgenic tobacco BY2 line expressing an orange fluorescence protein reporter pporRFP was targeted for knockout. We found that the targeted mutagenesis frequency for our Lipofectamine 3000-mediated protein delivery was 6%. Our results showed that the newly developed lipofection-mediated transfection approach is robust for the use of the DNA-free Cas9/gRNA technology for genome editing in plant cells.


Subject(s)
CRISPR-Cas Systems , Gene Editing/methods , Plant Cells/metabolism , RNA, Guide, Kinetoplastida/metabolism , Ribonucleoproteins/genetics , Ribonucleoproteins/metabolism , Agrobacterium , Biolistics/methods , Cell Line , DNA , Gene Expression Regulation, Plant , Genome, Plant , Mutagenesis , Plants, Genetically Modified , Protoplasts , Nicotiana/genetics
15.
PeerJ ; 7: e7887, 2019.
Article in English | MEDLINE | ID: mdl-31637134

ABSTRACT

Genetic engineering has been used to decrease the lignin content and to change the lignin composition of switchgrass (Panicum virgatum L.) to decrease cell wall recalcitrance to enable more efficient cellulosic biofuel production. Previous greenhouse and field studies showed that downregulation of the gene encoding switchgrass caffeic acid O-methyltransferase (COMT) and overexpression of the switchgrass PvMYB4 (MYB4) gene effectively improved ethanol yield. To understand potential environmental impacts of cultivating these transgenic bioenergy crops in the field, we quantified the effects of field cultivation of transgenic switchgrass on soil organic carbon (SOC) dynamics. Total and active SOC as well as soil respiration were measured in soils grown with two COMT-downregulated transgenic lines (COMT2 and COMT3), three MYB4-overexpressed transgenic lines (L1, L6, and L8), and their corresponding non-transgenic controls. No differences in total SOC, dissolved organic carbon (DOC), and permanganate oxidizable carbon (POXC) were detected between transgenic and non-transgenic treatments for both COMT (10.4-11.1 g kg-1 for SOC, 60.0-64.8 mg kg-1 for DOC, and 299-384 mg kg-1 for POXC) and MYB4 lines (6.89-8.21 g kg-1 for SOC, 56.0-61.1 mg kg-1 for DOC, and 177-199 mg kg-1 for POXC). Soil CO2-carbon (CO2-C) production from the COMT2 transgenic line was not significantly different from its non-transgenic control. In contrast, the COMT3 transgenic line had greater soil CO2-C production than its non-transgenic control (210 vs. 165 µg g-1) after 72 days of laboratory incubation. Combining the improvement in ethanol yield and biomass production reported in previous studies with negligible change in SOC and soil respiration, COMT2 could be a better biofuel feedstock than COMT3 for environmental conservation and cost-effective biofuel production. On the other hand, MYB4 transgenic line L8 produced more biomass and total ethanol per hectare while it released more CO2-C than the control (253 vs. 207 µg g-1). Long-term in situ monitoring of transgenic switchgrass systems using a suite of soil and environmental variables is needed to determine the sustainability of growing genetically modified bioenergy crops.

17.
Biotechnol Biofuels ; 12: 15, 2019.
Article in English | MEDLINE | ID: mdl-30675183

ABSTRACT

Background: The recalcitrance of cellulosic biomass is widely recognized as a key barrier to cost-effective biological processing to fuels and chemicals, but the relative impacts of physical, chemical and genetic interventions to improve biomass processing singly and in combination have yet to be evaluated systematically. Solubilization of plant cell walls can be enhanced by non-biological augmentation including physical cotreatment and thermochemical pretreatment, the choice of biocatalyst, the choice of plant feedstock, genetic engineering of plants, and choosing feedstocks that are less recalcitrant natural variants. A two-tiered combinatoric investigation of lignocellulosic biomass deconstruction was undertaken with three biocatalysts (Clostridium thermocellum, Caldicellulosiruptor bescii, Novozymes Cellic® Ctec2 and Htec2), three transgenic switchgrass plant lines (COMT, MYB4, GAUT4) and their respective nontransgenic controls, two Populus natural variants, and augmentation of biological attack using either mechanical cotreatment or cosolvent-enhanced lignocellulosic fractionation (CELF) pretreatment. Results: In the absence of augmentation and under the conditions tested, increased total carbohydrate solubilization (TCS) was observed for 8 of the 9 combinations of switchgrass modifications and biocatalysts tested, and statistically significant for five of the combinations. Our results indicate that recalcitrance is not a trait determined by the feedstock only, but instead is coequally determined by the choice of biocatalyst. TCS with C. thermocellum was significantly higher than with the other two biocatalysts. Both CELF pretreatment and cotreatment via continuous ball milling enabled TCS in excess of 90%. Conclusion: Based on our results as well as literature studies, it appears that some form of non-biological augmentation will likely be necessary for the foreseeable future to achieve high TCS for most cellulosic feedstocks. However, our results show that this need not necessarily involve thermochemical processing, and need not necessarily occur prior to biological conversion. Under the conditions tested, the relative magnitude of TCS increase was augmentation > biocatalyst choice > plant choice > plant modification > plant natural variants. In the presence of augmentation, plant modification, plant natural variation, and plant choice exhibited a small, statistically non-significant impact on TCS.

18.
Front Plant Sci ; 10: 1720, 2019.
Article in English | MEDLINE | ID: mdl-32117329

ABSTRACT

CRISPR/Cas9 has been widely applied to various plant species accelerating the pace of plant genome editing and precision breeding in crops. Unintended effects beyond off-target nucleotide mutations are still somewhat unexplored. We investigated the degree and patterns of epigenetic changes after gene editing. We examined changes in DNA methylation in genome-edited promoters of naturally hypermethylated genes (AT1G72350 and AT1G09970) and hypomethylated genes (AT3G17320 and AT5G28770) from Arabidopsis. Transgenic plants were developed via Agrobacterium-mediated floral dip transformation. Homozygous edited lines were selected from segregated T2 plants by an in vitro digestion assay using ribonucleoprotein complex. Bisulfite sequencing comparisons were made between paired groups of edited and non-edited plants to identify changes in DNA methylation of the targeted loci. We found that directed mutagenesis via CRISPR/Cas9 resulted in no unintended morphological or epigenetic alterations. Phenotypes of wild-type, transgenic empty vector, and transgenic edited plants were similar. Epigenetic profiles revealed that methylation patterns of promoter regions flanking target sequences were identical among wild-type, transgenic empty vector, and transgenic edited plants. There was no effect of mutation type on epigenetic status. We also evaluated off-target mutagenesis effects in the edited plants. Potential off-target sites containing up to 4-bp mismatch of each target were sequenced. No off-target mutations were detected in candidate sites. Our results showed that CRISPR/Cas9 did not leave an epigenetic footprint on either the immediate gene-edited DNA and flanking DNA or introduce off-target mutations.

19.
Front Plant Sci ; 9: 1114, 2018.
Article in English | MEDLINE | ID: mdl-30127793

ABSTRACT

Switchgrass (Panicum virgatum L.) is a leading lignocellulosic bioenergy feedstock. Cellulose is a major component of the plant cell walls and the primary substrate for saccharification. Accessibility of cellulose to enzymatic breakdown into fermentable sugars is limited by the presence of lignin in the plant cell wall. In this study, putatively novel switchgrass secondary cell wall cellulose synthase PvCesA4 and primary cell wall PvCesA6 genes were identified and their functional role in cellulose synthesis and cell wall composition was examined by overexpression and knockdown of the individual genes in switchgrass. The endogenous expression of PvCesA4 and PvCesA6 genes varied among including roots, leaves, stem, and reproductive tissues. Increasing or decreasing PvCesA4 and PvCesA6 expression to extreme levels in the transgenic lines resulted in decreased biomass production. PvCesA6-overexpressing lines had reduced lignin content and syringyl/guaiacyl lignin monomer ratio accompanied by increased sugar release efficiency, suggesting an impact of PvCesA6 expression levels on lignin biosynthesis. Cellulose content and cellulose crystallinity were decreased, while xylan content was increased in PvCesA4 and PvCesA6 overexpression or knockdown lines. The increase in xylan content suggests that the amount of non-cellulosic cell wall polysaccharide was modified in these plants. Taken together, the results show that the manipulation of the cellulose synthase genes alters the cell wall composition and availability of cellulose as a bioprocessing substrate.

20.
Biotechnol Biofuels ; 11: 122, 2018.
Article in English | MEDLINE | ID: mdl-29713381

ABSTRACT

BACKGROUND: Genetic engineering of switchgrass (Panicum virgatum L.) for reduced cell wall recalcitrance and improved biofuel production has been a long pursued goal. Up to now, constitutive promoters have been used to direct the expression of cell wall biosynthesis genes toward attaining that goal. While generally sufficient to gauge a transgene's effects in the heterologous host, constitutive overexpression often leads to undesirable plant phenotypic effects. Green tissue-specific promoters from switchgrass are potentially valuable to directly alter cell wall traits exclusively in harvestable aboveground biomass while not changing root phenotypes. RESULTS: We identified and functionally characterized three switchgrass green tissue-specific promoters and assessed marker gene expression patterns and intensity in stably transformed rice (Oryza sativa L.), and then used them to direct the expression of the switchgrass MYB4 (PvMYB4) transcription factor gene in transgenic switchgrass to endow reduced recalcitrance in aboveground biomass. These promoters correspond to photosynthesis-related light-harvesting complex II chlorophyll-a/b binding gene (PvLhcb), phosphoenolpyruvate carboxylase (PvPEPC), and the photosystem II 10 kDa R subunit (PvPsbR). Real-time RT-PCR analysis detected their strong expression in the aboveground tissues including leaf blades, leaf sheaths, internodes, inflorescences, and nodes of switchgrass, which was tightly up-regulated by light. Stable transgenic rice expressing the GUS reporter under the control of each promoter (756-2005 bp in length) further confirmed their strong expression patterns in leaves and stems. With the exception of the serial promoter deletions of PvLhcb, all GUS marker patterns under the control of each 5'-end serial promoter deletion were not different from that conveyed by their respective promoters. All of the shortest promoter fragments (199-275 bp in length) conveyed strong green tissue-specific GUS expression in transgenic rice. PvMYB4 is a master repressor of lignin biosynthesis. The green tissue-specific expression of PvMYB4 via each promoter in transgenic switchgrass led to significant gains in saccharification efficiency, decreased lignin, and decreased S/G lignin ratios. In contrast to constitutive overexpression of PvMYB4, which negatively impacts switchgrass root growth, plant growth was not compromised in green tissue-expressed PvMYB4 switchgrass plants in the current study. CONCLUSIONS: Each of the newly described green tissue-specific promoters from switchgrass has utility to change cell wall biosynthesis exclusively in aboveground harvestable biomass without altering root systems. The truncated green tissue promoters are very short and should be useful for targeted expression in a number of monocots to improve shoot traits while restricting gene expression from roots. Green tissue-specific expression of PvMYB4 is an effective strategy for improvement of transgenic feedstocks.

SELECTION OF CITATIONS
SEARCH DETAIL