Postoperative haemoglobin and anaemia-associated ischaemic events after major noncardiac surgery: A sex-stratified cohort study.

STUDY OBJECTIVE: To determine the sex-specific associations between postoperative haemoglobin and mortality or complications reflecting ischaemia or inadequate oxygen supply after major noncardiac surgery. DESIGN: A retrospective cohort study with prospective validation. SETTING: A large university hospital health system in China. PATIENTS: Men and women undergoing elective major noncardiac surgery. INTERVENTIONS AND MEASUREMENTS: The primary exposure was nadir haemoglobin within 48 h after surgery. The outcome of interest was a composite of postoperative mortality or ischaemic events including myocardial injury, acute kidney injury and stroke within hospitalisation. MAIN RESULTS: The study included 26,049 patients (15,757 men and 10,292 women). Low postoperative haemoglobin was a strong predictor of the composite outcome in both sexes, with the risk progressively increasing as the nadir haemoglobin concentration dropped below 130 g l-1 in men and 120 g l-1 in women (adjusted odds ratio [OR] 1.43, 95% CI 1.37-1.50 in men, and OR 1.45, 95% CI 1.35-1.55 in women, per 10 g l-1 decrease in postoperative nadir haemoglobin). Above these sex-specific thresholds, the change of nadir haemoglobin was no longer associated with odds of the composite outcome in either men or women. There was no significant interaction between patient sex and the association between postoperative haemoglobin and the composite outcome (Pinteraction = 0.673). Validation in an external prospective cohort (n = 2120) with systematic postoperative troponin and creatinine measurement confirmed our findings. CONCLUSIONS: Postoperative haemoglobin levels following major noncardiac surgery were nonlinearly associated with ischaemic complications or mortality, without any clinically important interaction with patient sex.

Association between cumulative duration of deep anesthesia and postoperative acute kidney injury after noncardiac surgeries: a retrospective observational study.

BACKGROUND: Bispectral index (BIS) is a processed electroencephalography monitoring tool and is widely used in anesthetic depth monitoring. Deep anesthesia exposure may be associated with multiple adverse outcomes. However, the relationship between anesthetic depth and postoperative acute kidney injury (AKI) remains unclear. We sought to determine the effect of BIS-based deep anesthesia duration on postoperative AKI following noncardiac surgery. METHODS: This retrospective study used data from the Vital Signs DataBase, including patients undergoing noncardiac surgeries with BIS monitoring. The BIS values were collected every second during anesthesia. Restricted cubic splines and logistic regression were used to assess the association between the cumulative duration of deep anesthesia and postoperative AKI. RESULTS: 4774 patients were eligible, and 129 (2.7%) experienced postoperative AKI. Restricted cubic splines showed that a cumulative duration of BIS < 45 was nonlinearly associated with postoperative AKI (P-overall = 0.033 and P-non-linear = 0.023). Using the group with the duration of BIS < 45 less than 15 min as the reference, ORs of postoperative AKI were 2.59 (95% confidence interval [CI]:0.60 to 11.09, p = 0.200) in the 15-100 min group, and 4.04 (95%CI:0.92 to 17.76, p = 0.064) in the ≥ 100 min group after adjusting for preoperative and intraoperative covariates in multivariable logistic regression. CONCLUSIONS: The cumulative duration of BIS < 45 was independently and nonlinearly associated with the risk of postoperative AKI in patients undergoing noncardiac surgery.

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA. Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA. Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup). Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Cytotoxicity of 5-Aza-2'-deoxycytidine against gastric cancer involves DNA damage in an ATM-P53 dependent signaling pathway and demethylation of P16(INK4A).

The DNA methylation inhibitor 5-Aza-2'-deoxycytidine (5-Aza-CdR) has increasingly attracted worldwide attention for its antineoplastic potential. The cytotoxitic mechanisms, however, especially, the relative contribution of silenced genes reactivation by demethylation and enzyme-DNA adduct formation to the efficacy of 5-Aza-CdR is still a crucial unresolved question. In this investigation, we demonstrated that 5-Aza-CdR treatment resulted in growth suppression in a concentration and time-dependent manner and G2 phrase arrest - hallmarks of a DNA damage response in gastric cancer AGS cells. Formation of DNA double-strand breaks, as monitored by comet assay was examined in an ATM (ataxia-telangiectasia mutated)-dependent manner based on the fact that PI3K inhibitor Wortmannin abolished the action of cytotoxicity of 5-Aza-CdR. Upon treatment with 5-Aza-CdR, ATM activation was clearly associated with P53 phosphorylation at Ser(15), which was directly responsible for 5-Aza-CdR modified P21(Waf1/Cip1) expression. Further exploration revealed that demethylation of P16(INK4A) correlated with the strikingly down-regulated expressions of DNA methyltransferase 3A as well as 3B was, at least in part, attributed to the cytotoxicity of 5-Aza-CdR in AGS cells. Conclusively, these results greatly enhance our understanding of the mechanisms of cytotoxicity of 5-Aza-CdR and strongly provide the preclinical rationale for an assessment of 5-Aza-CdR to ameliorate patient outcome with gastric cancer.

5-Aza-2'-deoxycytidine induces cytotoxicity in BGC-823 cells via DNA methyltransferase 1 and 3a independent of p53 status.

The DNA methylation inhibitor 5-aza-2'-deoxycytidine (5-Aza-CdR) has therapeutic value for the treatment of cancer. However, the mechanism by which 5-Aza-CdR induces antineoplastic activity is not clear. The efficacy of 5-Aza-CdR on the contribution of gene reactivation by demethylation and enzyme-DNA adduct formation is an important unresolved question. The aim of this study was to explore the mechanism of the effect of 5-Aza-CdR on human gastric cancer growth. Human BGC-823 cells were treated with different concentrations of 5-Aza-CdR for different durations. Cell viability, DNA damage and gene expression were determined. The results showed that 5-Aza-CdR at low concentrations induced inhibition of gastric cancer BGC-823 cell proliferation as well as increased apoptosis caused by DNA damage. For the first time, we demonstrated that 5-Aza-CdR-induced cytotoxicity against BGC-823 cells was predominantly regulated via upregulation of DNA methyltransferase 1, 3a and partially via reactivation of RUNX3, which was independent of p53 status and its ability to activate p21Waf1/Cip1 expression. To our knowledge, this is the first demonstration of p53-independent 5-Aza-CdR action on DNA methyltransferases and demethylation. These results strongly provide the preclinical rationale for the clinical evaluation of 5-Aza-CdR to improve patient outcome in gastric cancer.

Synergistic gastric cancer inhibition by chemogenetherapy with recombinant human adenovirus p53 and epirubicin: an in vitro and in vivo study.

This study was designed to investigate the in vitro and in vivo antitumor effect on SGC-7901 gastric cancer cells by chemogenetherapy. SGC-7901 cells were treated by chemogenetherapy with Gendicine, a recombinant human Ad-p53 injection (rAd-p53), and epirubicin hydrochloride (EPI), a cytotoxic chemotherapy agent. Compared with blank control, rAd-p53, EPI, and combined therapy achieved SGC-7901 growth inhibition by 32.26, 35.48, 43.44%, respectively on day 1 and 70.62, 78.82, 87.15%, respectively on day 2 (rAd-p53, EPI VS control, p<0.01; rAd-p53+EPI VS either alone, p<0.05). Flow cytometry study confirmed that rAd-p53 and/or EPI mainly inhibit the cell cycle at S phase. SGC-7901 cells were subcutaneously injected into the nude mice to form xenograft models, which were treated with rAd-p53 and EPI. Compared with the blank control, treatment with rAd-p53 at the dose of 10 µl of 10(12) vp/ml and EPI at the dose of 1.25 mg/kg, 7 times in 3 weeks, resulted in 80 and 60% of tumor growth inhibition, respectively. No animal death was observed, although 2 nude mice in rAd-p53 group developed liver toxicity and 1 nude mouse in EPI group developed cardiac toxicity. rAd-p53 and EPI have synergistic tumor inhibition effect on gastric cancer cells.

[Association of MLH1 gene 415G/C polymorphism with colorectal cancer in Chinese].

OBJECTIVE: To study the possible etiological role of MLH1 gene 415G/C polymorphism in sporadic Chinese colorectal cancer (CRC) patients. METHODS: Ninety-seven sporadic CRC patients and 138 normal controls were collected from Hubei Provincial Cancer Hospital and the People's Hospital of Wuhan University. In addition, five CRC families including 6 patients and their 19 first-degree relatives were also recruited. Genomic DNA was extracted from peripheral blood samples. Gene mutation was analyzed by PCR-RFLP. MLH1 mRNA expression in colorectal mucosa was analyzed by RT-PCR. RESULTS: The frequency of MLH1 gene CC genotype was significantly higher in sporadic CRC patients than that in controls (P=0.035, OR=5.29, 95% CI: 1.07-26.04). In the CRC families, the C allele frequency of CRC patients and their relatives was increased, compared with sporadic CRC patients and normal controls, respectively (P=0.003 and P=0.006). MLH1 mRNA expression of colorectal mucosa was similar in different genotypes. CONCLUSION: MLH1 gene 415G/C polymorphism might be a risk factor to sporadic CRC in Chinese. The mutation does not affect the MLH1 mRNA expression. For first-degree relatives from CRC families, carriers of MLH1 415C allele have a high risk to CRC.