UBE2I regulates the nuclear translocation of hnRNPA2B1 by contributing to SUMO modification in osteoarthritis.

BACKGROUND: Osteoarthritis (OA) is a progressive condition affecting the joints that lacking effective therapy. However, the underlying molecular mechanism has not been fully clarified. METHODS: A model of OA was established in Sprague-Dawley (SD) rats through intra-articularly injected with monoiodoacetate (MIA). Western blot analysis was used to identify the levels of UBE2I and hnRNPA2B1 in articular cartilage. Overexpression and siRNA vectors for UBE2I were constructed and transfected into rat chondrocytes. CCK-8, TUNEL and transwell assay were utilized to assess the cell viability, apoptosis and migration ability. Western blot analysis was used to determine the levels of chondrogenic-specific genes including SOX9, COL2A1, Aggrecan, and PRG4. Then, molecular interactions were confirmed by immunoprecipitation. RESULTS: We observed significant upregulation of UBE2I and hnRNPA2B1 expression in articular cartilage samples of OA. The Pearson correlation analysis revealed positive correlation between UBE2I and hnRNPA2B1 levels. Functional experiments showed that increased UBE2I expression significantly suppressed cell growth, migration, and reduced the expression of chondrogenic-specific genes, while decreasing UBE2I levels had the opposite effects. Molecular interactions between UBE2I and hnRNPA2B1were determined via co-localization and immunoprecipitation. SUMO1 and SUMO3 proteins were enriched by immunoprecipitation using hnRNPA2B1 antibodies. Rescue experiments were performed using SUMOylation inhibitor (2-D08) and SUMOylation activator (N106). Overexpression of UBE2I increased the expression of hnRNPA2B1 in the cytoplasm and decreased the level in the nucleus, which was reversed by the treatment of 2-D08. Conversely, UBE2I knockdown and N106 treatment had the opposite effect. CONCLUSIONS: UBE2I modulated the nuclear translocation of hnRNPA2B1 by promoting SUMOylation in OA.

HNRNPA2B1 stabilizes NFATC3 levels to potentiate its combined actions with FOSL1 to mediate vasculogenic mimicry in GBM cells.

BACKGROUND: Vasculogenic mimicry (VM) is an enigmatic physiological feature that influences blood supply within glioblastoma (GBM) tumors for their sustained growth. Previous studies identify NFATC3, FOSL1 and HNRNPA2B1 as significant mediators of VEGFR2, a key player in vasculogenesis, and their molecular relationships may be crucial for VM in GBM. AIMS: The aim of this study was to understand how NFATC3, FOSL1 and HNRNPA2B1 collectively influence VM in GBM. METHODS: We have investigated the underlying gene regulatory mechanisms for VM in GBM cell lines U251 and U373 in vitro and in vivo. In vitro cell-based assays were performed to explore the role of NFATC3, FOSL1 and HNRNPA2B1 in GBM cell proliferation, VM and migration, in the context of RNA interference (RNAi)-mediated knockdown alongside corresponding controls. Western blotting and qRT-PCR assays were used to examine VEGFR2 expression levels. CO-IP was employed to detect protein-protein interactions, ChIP was used to detect DNA-protein complexes, and RIP was used to detect RNA-protein complexes. Histochemical staining was used to detect VM tube formation in vivo. RESULTS: Focusing on NFATC3, FOSL1 and HNRNPA2B1, we found each was significantly upregulated in GBM and positively correlated with VM-like cellular behaviors in U251 and U373 cell lines. Knockdown of NFATC3, FOSL1 or HNRNPA2B1 each resulted in decreased levels of VEGFR2, a key growth factor gene that drives VM, as well as the inhibition of proliferation, cell migration and extracorporeal VM activity. Chromatin immunoprecipitation (ChIP) studies and luciferase reporter gene assays revealed that NFATC3 binds to the promoter region of VEGFR2 to enhance VEGFR2 gene expression. Notably, FOSL1 interacts with NFATC3 as a co-factor to potentiate the DNA-binding capacity of NFATC3, resulting in enhanced VM-like cellular behaviors. Also, level of NFATC3 protein in cells was enhanced through HNRNPA2B1 binding of NFATC3 mRNA. Furthermore, RNAi-mediated silencing of NFATC3, FOSL1 and HNRNPA2B1 in GBM cells reduced their capacity for tumor formation and VM-like behaviors in vivo. CONCLUSION: Taken together, our findings identify NFATC3 as an important mediator of GBM tumor growth through its molecular and epistatic interactions with HNRNPA2B1 and FOSL1 to influence VEGFR2 expression and VM-like cellular behaviors.

LINC00982-encoded protein PRDM16-DT regulates CHEK2 splicing to suppress colorectal cancer metastasis and chemoresistance.

Metastasis is one of the key factors of treatment failure in late-stage colorectal cancer (CRC). Metastatic CRC frequently develops resistance to chemotherapeutic agents. This study aimed to identify the novel regulators from "hidden" proteins encoded by long noncoding RNAs (lncRNAs) involved in tumor metastasis and chemoresistance. Methods: CRISPR/Cas9 library functional screening was employed to identify the critical suppressor of cancer metastasis in highly invasive CRC models. Western blotting, immunofluorescence staining, invasion, migration, wound healing, WST-1, colony formation, gain- and loss-of-function experiments, in vivo experimental metastasis models, multiplex immunohistochemical staining, immunohistochemistry, qRT-PCR, and RT-PCR were used to assess the functional and clinical significance of FOXP3, PRDM16-DT, HNRNPA2B1, and L-CHEK2. RNA-sequencing, co-immunoprecipitation, qRT-PCR, RT-PCR, RNA affinity purification, RNA immunoprecipitation, MeRIP-quantitative PCR, fluorescence in situ hybridization, chromatin immunoprecipitation and luciferase reporter assay were performed to gain mechanistic insights into the role of PRDM16-DT in cancer metastasis and chemoresistance. An oxaliplatin-resistant CRC cell line was established by in vivo selection. WST-1, colony formation, invasion, migration, Biacore technology, gain- and loss-of-function experiments and an in vivo experimental metastasis model were used to determine the function and mechanism of cimicifugoside H-1 in CRC. Results: The novel protein PRDM16-DT, encoded by LINC00982, was identified as a cancer metastasis and chemoresistance suppressor. The down-regulated level of PRDM16-DT was positively associated with malignant phenotypes and poor prognosis of CRC patients. Transcriptionally regulated by FOXP3, PRDM16-DT directly interacted with HNRNPA2B1 and competitively decreased HNRNPA2B1 binding to exon 9 of CHEK2, resulting in the formation of long CHEK2 (L-CHEK2), subsequently promoting E-cadherin secretion. PRDM16-DT-induced E-cadherin secretion inhibited fibroblast activation, which in turn suppressed CRC metastasis by decreasing MMP9 secretion. Cimicifugoside H-1, a natural compound, can bind to LEU89, HIS91, and LEU92 of FOXP3 and significantly upregulated PRDM16-DT expression to repress CRC metastasis and reverse oxaliplatin resistance. Conclusions: lncRNA LINC00982 can express a new protein PRDM16-DT to function as a novel regulator in cancer metastasis and drug resistance of CRC. Cimicifugoside H-1 can act on the upstream of the PRDM16-DT signaling pathway to alleviate cancer chemoresistance.

CD271 mRNA/hnRNPA2B1 complex promotes proliferation and stemness in oral and head and neck squamous cell carcinoma.

RNAs, such as noncoding RNA, microRNA, and recently mRNA, have been recognized as signal transduction molecules. CD271, also known as nerve growth factor receptor, has a critical role in cancer, although the precise mechanism is still unclear. Here, we show that CD271 mRNA, but not CD271 protein, facilitates spheroid cell proliferation. We established CD271-/- cells lacking both mRNA and protein of CD271, as well as CD271 protein knockout cells lacking only CD271 protein, from hypopharyngeal and oral squamous cell carcinoma lines. Sphere formation was reduced in CD271-/- cells but not in CD271 protein knockout cells. Mutated CD271 mRNA, which is not translated to a protein, promoted sphere formation. CD271 mRNA bound to hnRNPA2B1 protein at the 3'-UTR region, and the inhibition of this interaction reduced sphere formation. In surgical specimens, the CD271 mRNA/protein expression ratio was higher in the cancerous area than in the noncancerous area. These data suggest CD271 mRNA has dual functions, encompassing protein-coding and noncoding roles, with its noncoding RNA function being predominant in oral and head and neck squamous cell carcinoma.

Splicing factor hnRNPA1 regulates alternative splicing of LOXL2 to enhance the production of LOXL2Δ13.

Lysyl oxidase-like 2 (LOXL2) is a member of the lysyl oxidase family and has the ability to catalyze the cross-linking of extracellular matrix collagen and elastin. High expression of LOXL2 is related to tumor cell proliferation, invasion, and metastasis. LOXL2 contains 14 exons. Previous studies have found that LOXL2 has abnormal alternative splicing and exon skipping in a variety of tissues and cells, resulting in a new alternatively spliced isoform denoted LOXL2Δ13. LOXL2Δ13 lacks LOXL2WT exon 13, but its encoded protein has greater ability to induce tumor cell proliferation, invasion, and metastasis. However, the molecular events that produce LOXL2Δ13 are still unclear. In this study, we found that overexpression of the splicing factor hnRNPA1 in cells can regulate the alternative splicing of LOXL2 and increase the expression of LOXL2Δ13. The exonic splicing silencer exists at the 3' splice site and 5' splice site of LOXL2 exon 13. HnRNPA1 can bind to the exonic splicing silencer and inhibit the inclusion of exon 13. The RRM domain of hnRNPA1 and phosphorylation of hnRNPA1 at S91 and S95 are important for the regulation of LOXL2 alternative splicing. These results show that hnRNPA1 is a splicing factor that enhances the production of LOXL2Δ13.

DRAIC mediates hnRNPA2B1 stability and m6A-modified IGF1R instability to inhibit tumor progression.

Type 1 insulin-like growth factor receptor (IGF1R) plays an important role in cancer, however, posttranscriptional regulation such as N6-methyladenosine (m6A) of IGF1R remains unclear. Here, we reveal a role for a lncRNA Downregulated RNA in Cancer (DRAIC) suppress tumor growth and metastasis in clear cell Renal Carcinoma (ccRCC). Mechanistically, DRAIC physically interacts with heterogeneous nuclear ribonucleoprotein A2B1 (hnRNPA2B1) and enhances its protein stability by blocking E3 ligase F-box protein 11 (FBXO11)-mediated ubiquitination and proteasome-dependent degradation. Subsequently, hnRNPA2B1 destabilizes m6A modified-IGF1R, leading to inhibition of ccRCC progression. Moreover, four m6A modification sites are identified to be responsible for the mRNA degradation of IGF1R. Collectively, our findings reveal that DRAIC/hnRNPA2B1 axis regulates IGF1R mRNA stability in an m6A-dependent manner and highlights an important mechanism of IGF1R fate. These findings shed light on DRAIC/hnRNPA2B1/FBXO11/IGF1R axis as potential therapeutic targets in ccRCC and build a link of molecular fate between m6A-modified RNA and ubiquitin-modified protein.

Neratinib impairs function of m6A recognition on AML1-ETO pre-mRNA and induces differentiation of t (8;21) AML cells by targeting HNRNPA3.

Acute myeloid leukemia (AML) is frequently linked to genetic abnormalities, with the t (8; 21) translocation, resulting in the production of a fusion oncoprotein AML1-ETO (AE), being a prevalent occurrence. This protein plays a pivotal role in t (8; 21) AML's onset, advancement, and recurrence, making it a therapeutic target. However, the development of drug molecules targeting AML1-ETO are markedly insufficient, especially used in clinical treatment. In this study, it was uncovered that Neratinib could significantly downregulate AML1-ETO protein level, subsequently promoting differentiation of t (8; 21) AML cells. Based on "differentiated active" probes, Neratinib was identified as a functional inhibitor against HNRNPA3 through covalent binding. The further studies demonstrated that HNRNPA3 function as a putative m6A reader responsible for recognizing and regulating the alternative splicing of AML-ETO pre-mRNA. These findings not only contribute to a novel insight to the mechanism governing post-transcriptional modification of AML1-ETO transcript, but also suggest that Neratinib would be promising therapeutic potential for t (8; 21) AML treatment.

The DNA-repair protein APE1 participates with hnRNPA2B1 to motif-enriched and prognostic miRNA secretion.

The base excision repair (BER) Apurinic/apyrimidinic endonuclease 1 (APE1) enzyme is endowed with several non-repair activities including miRNAs processing. APE1 is overexpressed in many cancers but its causal role in the tumorigenic processes is largely unknown. We recently described that APE1 can be actively secreted by mammalian cells through exosomes. However, APE1 role in EVs or exosomes is still unknown, especially regarding a putative regulatory function on vesicular small non-coding RNAs. Through dedicated transcriptomic analysis on cellular and vesicular small RNAs of different APE1-depleted cancer cell lines, we found that miRNAs loading into EVs is a regulated process, dependent on APE1, distinctly conveying RNA subsets into vesicles. We identified APE1-dependent secreted miRNAs characterized by enriched sequence motifs and possible binding sites for APE1. In 33 out of 34 APE1-dependent-miRNA precursors, we surprisingly found EXO-motifs and proved that APE1 cooperates with hnRNPA2B1 for the EV-sorting of a subset of miRNAs, including miR-1246, through direct binding to GGAG stretches. Using TCGA-datasets, we showed that these miRNAs identify a signature with high prognostic significance in cancer. In summary, we provided evidence that the ubiquitous DNA-repair enzyme APE1 is part of the EV protein cargo with a novel post-transcriptional role for this ubiquitous DNA-repair enzyme that could explain its role in cancer progression. These findings could open new translational perspectives in cancer biology.

HnRNPA2B1 ISGylation Regulates m6A-Tagged mRNA Selective Export via ALYREF/NXF1 Complex to Foster Breast Cancer Development.

Regulating nuclear export precisely is essential for maintaining mRNA homeostasis and impacts tumor progression. However, the mechanisms governing nuclear mRNA export remain poorly elucidated. Herein, it is revealed that the enhanced hypoxic long no-ncoding RNA (lncRNA prostate cancer associated transcript 6 (PCAT6) in breast cancer (BC) promotes the nuclear export of m6A-modified mRNAs, bolstering breast cancer stem cells (BCSCs) stemness and doxorubicin resistance. Clinically, hypoxic PCAT6 correlates with malignant BC features and poor prognosis. Mechanically, PCAT6 functions as a scaffold between interferon-stimulated gene 15 (ISG15) and heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNPA2B1), leading to ISGylation of hnRNPA2B1, thus protecting hnRNPA2B1 from ubiquitination-mediated proteasomal degradation. Interestingly, as an m6A reader, hnRNPA2B1 selectively mediates m6A-tagged mRNAs nuclear export via the Aly/REF export factor (ALYREF)/ nuclear RNA export factor 1 (NXF1) complex, which promotes stemness-related genes expression. HnRNPA2B1 knockdown or mRNA export inhibition can result in the retention of nuclear m6A-tagged mRNA associated with stemness maintenance, which suppresses BCSCs self-renewal and effectively improves the efficacy of doxorubicin therapy. These findings demonstrate the pivotal role of m6A-modified mRNA nuclear export in BC progression, highlighting that the inhibition of m6A-tagged mRNA and its nuclear export is a potential therapeutic strategy for the amelioration of cancer chemotherapy.

Particulate matters 2.5 induce tumor progression in lung cancer by increasing the activity of hnRNPA2B1 resulting in retarding mRNA decay of oxidative phosphorylation.

Particulate matter 2.5 (PM2.5) has been implicated in lung injury and various cancers, yet its precise mechanistic role remains elusive. To elucidate the key signaling pathways underpinning PM2.5-induced lung cancer progression, we embarked on a study examining the impact of PM2.5 both in vitro and in vivo. Lung cancer cell lines, A549 and H157, were employed for the in vitro investigations. Overexpression or knockdown techniques targeting the hnRNPA2B1 protein were implemented. Lung cancer cells were treated with a medium containing PM2.5 and subsequently prepared for in vitro evaluations. Cell growth, invasion, and migration were gauged using transwell and CCK-8 assays. Apoptosis was ascertained through flow cytometry and western blotting of pertinent proteins. Seahorse analyses probed the influence of PM2.5 on lung cancer energy metabolism. The RNA stability assay was employed to discern the impact of PM2.5 on the stability of oxidative phosphorylation-related genes in lung cancer. Our findings revealed that PM2.5 augmented cell proliferation, migration, and invasion rates. Similarly, a diminished apoptosis rate was observed in PM2.5-treated cells. Elevated expression of hnRNPA2B1 was detected in lung cancer cells exposed to PM2.5. Moreover, in cells treated with PM2.5, hnRNPA2B1 knockdown markedly curtailed cell proliferation by inducing G1-S cell cycle arrest and bolstered lung cancer cell apoptosis in vitro; it also curbed xenograft tumor growth. Mechanistically, our data suggest that PM2.5 undermines the stability of mRNA transcripts associated with oxidative phosphorylation (OXPHOS) and augments the formation of processing bodies (P-bodies), leading to an upsurge in OXPHOS levels. In conclusion, PM2.5 appears to drive lung cancer progression and migration by modulating the energy metabolism of lung cancer in a hnRNPA2B1-dependent manner.

Mutations in human prion-like domains: pathogenic but not always amyloidogenic.

Heterogeneous nuclear ribonucleoproteins (hnRNPs) are multifunctional proteins with integral roles in RNA metabolism and the regulation of alternative splicing. These proteins typically contain prion-like domains of low complexity (PrLDs or LCDs) that govern their assembly into either functional or pathological amyloid fibrils. To date, over 60 mutations targeting the LCDs of hnRNPs have been identified and associated with a spectrum of neurodegenerative diseases including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and Alzheimer's disease (AD). The cryo-EM structures of pathological and functional fibrils formed by different hnRNPs have been recently elucidated, including those of hnRNPA1, hnRNPA2, hnRNPDL-2, TDP-43, and FUS. In this review, we discuss the structural features of these amyloid assemblies, placing particular emphasis on scrutinizing the impact of prevalent disease-associated mutations mapping within their LCDs. By performing systematic energy calculations, we reveal a prevailing trend of destabilizing effects induced by these mutations in the amyloid structure, challenging the traditionally assumed correlation between pathogenicity and amyloidogenic propensity. Understanding the molecular basis of this discrepancy might provide insights for developing targeted therapeutic strategies to combat hnRNP-associated diseases.

N6-methyladenosine reader hnRNPA2B1 recognizes and stabilizes NEAT1 to confer chemoresistance in gastric cancer.

BACKGROUND: Chemoresistance is a major cause of treatment failure in gastric cancer (GC). Heterogeneous nuclear ribonucleoprotein A2B1 (hnRNPA2B1) is an N6-methyladenosine (m6A)-binding protein involved in a variety of cancers. However, whether m6A modification and hnRNPA2B1 play a role in GC chemoresistance is largely unknown. In this study, we aimed to investigate the role of hnRNPA2B1 and the downstream mechanism in GC chemoresistance. METHODS: The expression of hnRNPA2B1 among public datasets were analyzed and validated by quantitative PCR (qPCR), Western blotting, immunofluorescence, and immunohistochemical staining. The biological functions of hnRNPA2B1 in GC chemoresistance were investigated both in vitro and in vivo. RNA sequencing, methylated RNA immunoprecipitation, RNA immunoprecipitation, and RNA stability assay were performed to assess the association between hnRNPA2B1 and the binding RNA. The role of hnRNPA2B1 in maintenance of GC stemness was evaluated by bioinformatic analysis, qPCR, Western blotting, immunofluorescence, and sphere formation assays. The expression patterns of hnRNPA2B1 and downstream regulators in GC specimens from patients who received adjuvant chemotherapy were analyzed by RNAscope and multiplex immunohistochemistry. RESULTS: Elevated expression of hnRNPA2B1 was found in GC cells and tissues, especially in multidrug-resistant (MDR) GC cell lines. The expression of hnRNPA2B1 was associated with poor outcomes of GC patients, especially in those who received 5-fluorouracil treatment. Silencing hnRNPA2B1 effectively sensitized GC cells to chemotherapy by inhibiting cell proliferation and inducing apoptosis both in vitro and in vivo. Mechanically, hnRNPA2B1 interacted with and stabilized long noncoding RNA NEAT1 in an m6A-dependent manner. Furthermore, hnRNPA2B1 and NEAT1 worked together to enhance the stemness properties of GC cells via Wnt/ß-catenin signaling pathway. In clinical specimens from GC patients subjected to chemotherapy, the expression levels of hnRNPA2B1, NEAT1, CD133, and CD44 were markedly elevated in non-responders compared with responders. CONCLUSION: Our findings indicated that hnRNPA2B1 interacts with and stabilizes lncRNA NEAT1, which contribute to the maintenance of stemness property via Wnt/ß-catenin pathway and exacerbate chemoresistance in GC.

Embryonic stem cell related gene regulates alternative splicing of transcription factor 3 to maintain human embryonic stem cells' self-renewal and pluripotency.

Exploring the mechanism of self-renewal and pluripotency maintenance of human embryonic stem cells (hESCs) is of great significance in basic research and clinical applications, but it has not been fully elucidated. Long non-coding RNAs (lncRNAs) have been shown to play a key role in the self-renewal and pluripotency maintenance of hESCs. We previously reported that the lncRNA ESRG, which is highly expressed in undifferentiated hESCs, can maintain the self-renewal and pluripotency of hPSCs. RNA pull-down mass spectrometry showed that ESRG could bind to other proteins, among which heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) attracted our attention. In this study, we showed that HNRNPA1 can maintain self-renewal and pluripotency of hESCs. ESRG bound to and stabilized HNRNPA1 protein through the ubiquitin-proteasome pathway. In addition, knockdown of ESRG or HNRNPA1 resulted in alternative splicing of TCF3, which originally and primarily encoded E12, to mainly encode E47 and inhibit CDH1 expression. HNRNPA1 could rescue the biological function changes of hESCs caused by ESRG knockdown or overexpression. Our results suggest that ESRG regulates the alternative splicing of TCF3 to affect CDH1 expression and maintain hESCs self-renewal and pluripotency by binding and stabilizing HNRNPA1 protein. This study lays a good foundation for exploring the new molecular regulatory mechanism by which ESRG maintains hESCs self-renewal and pluripotency.

A mutation in the low-complexity domain of splicing factor hnRNPA1 linked to amyotrophic lateral sclerosis disrupts distinct neuronal RNA splicing networks.

Amyotrophic lateral sclerosis (ALS) is a debilitating neurodegenerative disease characterized by loss of motor neurons. Human genetic studies have linked mutations in RNA-binding proteins as causative for this disease. The hnRNPA1 protein, a known pre-mRNA splicing factor, is mutated in some ALS patients. Here, two human cell models were generated to investigate how a mutation in the C-terminal low-complexity domain (LCD) of hnRNPA1 can cause splicing changes of thousands of transcripts that collectively are linked to the DNA damage response, cilium organization, and translation. We show that the hnRNPA1 D262V mutant protein binds to new binding sites on differentially spliced transcripts from genes that are linked to ALS. We demonstrate that this ALS-linked hnRNPA1 mutation alters normal RNA-dependent protein-protein interactions. Furthermore, cells expressing this hnRNPA1 mutant exhibit a cell aggregation phenotype, markedly reduced growth rates, changes in stress granule kinetics, and aberrant growth of neuronal processes. This study provides insight into how a single amino acid mutation in a splicing factor can alter RNA splicing networks of genes linked to ALS.

HNRNPA2B1 promotes oral squamous cell carcinogenesis via m6A-dependent stabilization of FOXQ1 mRNA stability.

Oral squamous cell carcinoma (OSCC), as a common type of oral malignancy, has an unclear pathogenesis. N6 methyladenosine (m6A) is a reversible and dynamic process that participates in the modulation of cancer pathogenesis and development. As an m6A recognition protein (reader), heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) show abnormally high expression in cancers. Forkhead box Q1 (FOXQ1), an oncogenic transcription factor, controls multiple biological processes (e.g., embryonic development, cell differentiation, and apoptosis, impacting the initiation and progression of cancers by mediating signaling pathways together with epithelial-mesenchymal transition). Through the Cancer Genome Atlas database screening along with clinical and laboratory experiments, in head and neck squamous cell carcinoma, we found a correlation between HNRNPA2B1 and FOXQ1 gene expression, with shared m6A motifs between HNRNPA2B1 and FOXQ1 mRNA sequences. Silencing or overexpression of HNRNPA2B1 in OSCC cells affected the malignant phenotypes of OSCC cells in vitro, and depletion of HNRNPA2B1 retarded tumor growth in vivo. HNRNPA2B1 could bind to m6A-modified FOXQ1 mRNA to enhance its mRNA stability, resulting in up-regulation of FOXQ1 protein expression. To conclude, HNRNPA2B1 was upregulated in OSCC and enhanced OSCC cell malignant phenotypes by stabilizing m6A-modified FOXQ1 mRNA, eventually aggravating the malignancy and tumorigenicity of OSCC. This study accelerates the recognition of the potency of m6A modification in OSCC and paves the path for OSCC's targeted diagnosis and therapy.

Nuclear pore pathology underlying multisystem proteinopathy type 3-related inclusion body myopathy.

OBJECTIVE: Multisystem proteinopathy type 3 (MSP3) is an inherited, pleiotropic degenerative disorder caused by a mutation in heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1), which can affect the muscle, bone, and/or nervous system. This study aimed to determine detailed histopathological features and transcriptomic profile of HNRNPA1-mutated skeletal muscles to reveal the core pathomechanism of hereditary inclusion body myopathy (hIBM), a predominant phenotype of MSP3. METHODS: Histopathological analyses and RNA sequencing of HNRNPA1-mutated skeletal muscles harboring a c.940G > A (p.D314N) mutation (NM_031157) were performed, and the results were compared with those of HNRNPA1-unlinked hIBM and control muscle tissues. RESULTS: RNA sequencing revealed aberrant alternative splicing events that predominantly occurred in myofibril components and mitochondrial respiratory complex. Enrichment analyses identified the nuclear pore complex (NPC) and nucleocytoplasmic transport as suppressed pathways. These two pathways were linked by the hub genes NUP50, NUP98, NUP153, NUP205, and RanBP2. In immunohistochemistry, these nucleoporin proteins (NUPs) were mislocalized to the cytoplasm and aggregated mostly with TAR DNA-binding protein 43 kDa and, to a lesser extent, with hnRNPA1. Based on ultrastructural observation, irregularly shaped myonuclei with deep invaginations were frequently observed in atrophic fibers, consistent with the disorganization of NPCs. Additionally, regarding the expression profiles of overall NUPs, reduced expression of NUP98, NUP153, and RanBP2 was shared with HNRNPA1-unlinked hIBMs. INTERPRETATION: The shared subset of altered NUPs in amyotrophic lateral sclerosis (ALS), as demonstrated in prior research, HNRNPA1-mutated, and HNRNPA1-unlinked hIBM muscle tissues may provide evidence regarding the underlying common nuclear pore pathology of hIBM, ALS, and MSP.

The mechanism of UP1 binding and unfolding of human telomeric DNA G-quadruplex.

The human telomere contains multiple copies of the DNA sequence d(TTAGGG) which can fold into higher order intramolecular G-quadruplexes and regulate the maintenance of telomere length and chromosomal integrity. The nucleic acid binding protein heteronuclear ribonucleoprotein A1 (hnRNP A1) and its N-terminus proteolytic product UP1 have been shown to efficiently bind and unfold telomeric DNA G-quadruplex. However, the understanding of the molecular mechanism of the UP1 binding and unfolding telomeric G-quadruplexes is still limited. Here, we performed biochemical and biophysical characterizations of UP1 binding and unfolding of human telomeric DNA G-quadruplex d[AGGG(TTAGGG)3], and in combination of systematic site-direct mutagenesis of two tandem RNA recognition motifs (RRMs) in UP1, revealed that RRM1 is responsible for initial binding and unfolding, whereas RRM2 assists RRM1 to complete the unfolding of G-quadruplex. Isothermal titration calorimetry (ITC) and circular dichroism (CD) studies of the interactions between UP1 and DNA G-quadruplex variants indicate that the "TAG" binding motif in Loop2 of telomeric G-quadruplex is critical for UP1 recognition and G-quadruplex unfolding initiation. Together we depict a model for molecular mechanism of hnRNP A1 (UP1) binding and unfolding of the human telomeric DNA G-quadruplex.

Expression and effect of heterogeneous nuclear ribonucleoprotein A2/B1 in tongue squamous cell carcinoma. / æ ¸å† ä¸å‡ä¸€æ ¸ç³–æ ¸è›‹ç™½A2/B1在舌鳞状细胞癌中的表达及作用.

OBJECTIVES: Tongue squamous cell carcinoma (TSCC) is a common cancer in the oral and maxillofacial region, which seriously endangers people's life and health.Heterogeneous nuclear ribonucleoprotein A2/B1(hnRNP A2/B1) is an RNA-binding protein that regulates the expression of a variety of genes and participates in the occurrence and development of a variety of cancers. This study aims to investigate the role of hnRNP A2/B1 in TSCC progression. METHODS: The differential expression of hnRNP A2/B1 in oral squamous cell carcinoma (OSCC) and normal oral mucosa cells and tissues was analyzed based on the gene expression profiles of GSE146483 and GSE85195 in the Gene Expression Omnibus (GEO) database. The correlation between hnRNP A2/B1 expression and disease-free survival of TSCC patients was analyzed based on TSCC related chip of GSE4676. TSCC cancer and paracancerous tissue samples of 30 patients were collected in Hunan Cancer Hospital from July to December 2021. Real-time RT-PCR and Western blotting were used to verify the mRNA and protein expression of hnRNP A2/B1 in TSCC patients'samples, respectively. Human TSCC Tca-8113 cells were transfected with hnRNP A2/B1 empty vector (a sh-NC group), knockdown plasmid (a sh-hnRNP A2/B1 group), empty vector overexpression plasmid (an OE-NC group) and overexpression plasmid (an OE-hnRNP A2/B1 group), respectively. The knockdown or overexpression efficiency of hnRNP A2/B1 was detected by Western blotting. The proliferation activity of Tca-8113 cells was detected by cell counting kit-8 (CCK-8), and the apoptosis rate of Tca-8113 cells was detected by flow cytometry. RESULTS: Based on the analysis of OSCC-related chips of GSE146483 and GSE85195 in the GEO database, it was found that hnRNP A2/B1 was differentially expressed in the OSCC and normal oral mucosa cells and tissues (all P<0.01). Meanwhile, the analysis of TSCC related chip GSE4676 confirmed that the expression of hnRNP A2/B1 was negatively correlated with the disease-free survival of TSCC patients (P=0.006). The results of real-time RT-PCR and Western blotting showed that the relative expression levels of hnRNP A2/B1 mRNA and protein in TSCC tissues were significantly up-regulated compared with those in adjacent tissues (all P<0.01). The results of Western blotting showed that the expression level of hnRNP A2/B1 in Tca-8113 cells was significantly inhibited or promoted after knockdown or overexpression of hnRNP A2/B1 (all P<0.01). The results of CCK-8 and flow cytometry showed that inhibition of hnRNP A2/B1 expression in Tca-8113 cells reduced cell proliferation activity (P<0.05) and increased cell apoptic rate (P<0.01). Overexpression of hnRNP A2/B1 in Tca-8113 cells significantly increased cell proliferation (P<0.05) and decreased cell apoptosis (P<0.01). CONCLUSIONS: HnRNP A2/B1 is a key factor regulating the proliferation and apoptosis of TSCC cells. Inhibition of hnRNP A2/B1 expression can reduce the proliferation activity of TSCC cells and promote the apoptosis of TSCC cells.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

A2/B1 Promotes NRF2 mRNA Stability and Inhibits Ferroptosis and Cell Proliferation in Breast Cancer Cells.

Breast cancer is a highly harmful malignant tumor, which poses a great threat to women's body and mind, and the mortality rate ranks second among all women's diseases. The incidence rate accounts for 7-10% of various malignant tumors in the whole body, second only to uterine cancer in women, and has become the main cause of threatening women's health. Advanced breast cancer is often considered an incurable disease. The family of heterogeneous nuclear ribonucleoprotein complexes is composed of about 20 hnRNP proteins with molecular weights ranging from 32 to 120 kDa, and they are named according to their molecular weights. Among them, hnRNPA2 and hnRNPB1 are the two most important members of the hnRNP family, both derived from the same gene on chromosome 7p15. Therefore, research to understand the molecular mechanism and process of breast cancer progression has an important role in promoting the current medical research on breast cancer treatment methods. Therefore, studying the mechanism of tumorigenesis is the key to tumor prevention and treatment. Therefore, this paper proposes that A2/B1 promotes the stability of NRF2 mRNA and inhibits ferroptosis and cell proliferation in breast cancer cells. The article mainly introduces the disease diagnosis method based on artificial neural network and its neural network algorithm. In the experimental part, the activity of hnRNP A2/B1 on cancer cells is deeply studied. The results show that the absorbance of the MTT method increases continuously with the extension of the culture time, and the maximum reaches 1.2. This fully shows that its absorption capacity is very strong, especially after 24 hours, the absorption rate rises from 0.6 to 0.9, which shows that 24 hours is the best absorption time. And it can also be found that hnRNPA2/B1 has a significant inhibitory effect on breast cancer cells; it can reduce the effect on breast cancer cell cycle and apoptosis.