RESUMO
C1q is the central pattern-recognition molecule in the classical pathway of the complement system and is known to have a key role in the crossroads between adaptive and innate immunity. Hereditary C1q deficiency is a rare genetic condition strongly associated with systemic lupus erythematosus and increased susceptibility to bacterial infections. However, the clinical symptoms may vary. For long, the molecular basis of C1q deficiency was ascribed to only six different mutations. In the present report, we describe five new patients with C1q deficiency, present the 12 causative mutations described till now and review the clinical spectrum of symptoms found in patients with C1q deficiency. With the results presented here, confirmed C1q deficiency is reported in 64 patients from at least 38 families.
Assuntos
Complemento C1q/deficiência , Complemento C1q/genética , Mutação , Substituição de Aminoácidos , Criança , Pré-Escolar , Feminino , Doenças Genéticas Inatas/diagnóstico , Genótipo , Humanos , Masculino , LinhagemRESUMO
The focus was to describe Swedish psychiatrists' experiences of collaboration with healthcare professionals when treating women with postpartum psychosis (PPP). A qualitative design was used, and semi-structured interviews were performed with nine psychiatrists working in psychiatric hospitals in Sweden. Data were analysed using manifest and latent content analysis. The results of these experiences were categorized in this study as: collaboration related to admission, collaboration during inpatient care and collaboration related to discharge. Collaboration with midwives and obstetricians was important in diagnosing the illness, as this often occurred on postnatal wards; and decisions about the form of care for the woman with PPP and for her baby demanded collaboration with various healthcare professionals. Collaboration with nurses was based on expectations and confidence in nurses' competence, and was exceedingly important during inpatient care. When the woman was to be discharged, collaboration with healthcare teams, e.g. outpatient clinic, child health clinic and community services, was required. The conclusions were that psychiatrists collaborate with different professionals in the various phases of the caring process. They rely extensively on nurses' competence when caring for women with PPP, and consider nurses to be their most important collaborators.
Assuntos
Comportamento Cooperativo , Papel do Profissional de Enfermagem , Período Pós-Parto , Enfermagem Psiquiátrica/métodos , Psiquiatria/métodos , Transtornos Psicóticos/terapia , Idoso , Competência Clínica , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Transtornos Psicóticos/enfermagem , SuéciaRESUMO
Long interspersed nuclear element-1 (LINE-1) or L1 elements are DNA elements present in the genome in high copy number and capable of active retrotransposition. Here we present a patient with severe chronic granulomatous disease (CGD) caused by insertion of an L1 sequence into intron 5 of the X-lined gene CYBB. Due to internal rearrangements, the insert introduced new splice sites into the intron. This resulted in a highly heterogeneous splicing pattern with introduction of two L1 fragments as new exons into the transcripts and concomitant skipping of exonic coding sequence. Because no wild-type cDNA was found, this mechanism is probably responsible for the patient's phenotype. The L1 fragment, which belongs to the Ta subset of transcriptionally active LINEs, illustrates a new mechanism by which these elements can modify the transcribed coding sequence of genes.
Assuntos
Éxons/genética , Doença Granulomatosa Crônica/genética , Íntrons/genética , Elementos Nucleotídeos Longos e Dispersos/genética , Mutagênese Insercional/genética , Recombinação Genética , Adulto , Processamento Alternativo/genética , Sequência de Bases , Pré-Escolar , Evolução Fatal , Doença Granulomatosa Crônica/enzimologia , Doença Granulomatosa Crônica/etiologia , Humanos , Recém-Nascido , Masculino , Glicoproteínas de Membrana/genética , Dados de Sequência Molecular , NADPH Oxidase 2 , NADPH Oxidases/deficiência , NADPH Oxidases/genéticaRESUMO
The superoxide-forming nicotinamide adenine dinucleotide phosphate reduced (NADPH) oxidase of human phagocytes comprises membrane-bound and cytosolic proteins, which, upon cell activation, assemble on the plasma membrane to form the active enzyme. Patients with chronic granulomatous disease (CGD) are defective in one of the phagocyte oxidase (phox) components, p47-phox or p67-phox, which reside in the cytosol of resting phagocytes, or gp91-phox or p22-phox, which constitute the membrane-bound cytochrome b(558). In four X-linked CGD patients we have identified novel missense mutations in CYBB, the gene encoding gp91-phox. These mutations were associated with normal amounts of nonfunctional cytochrome b(558) in the patients' neutrophils. In phorbol-myristate-stimulated neutrophils and in a cell-free translocation assay with neutrophil membranes and cytosol, the association of p47-phox and p67-phox with the membrane fraction of the cells with Cys369-->Arg, Gly408-->Glu, and Glu568--> Lys substitutions was strongly disturbed. Only a Thr341-->Lys substitution, residing in a region of gp91-phox involved in flavin adenine dinucleotide (FAD) binding, supported a normal translocation. Thus, the introduction or reversal of charge at residues 369, 408, and 568 in gp91-phox destroys the correct binding of p47-phox and p67-phox to cytochrome b(558). Based on mutagenesis studies of structurally related flavin-dependent oxidoreductases, we propose that the Thr341-->Lys substitution results in impaired hydride transfer from NADPH to FAD. Because we found no electron transfer in solubilized neutrophil plasma membranes from any of the four patients, we conclude that all four amino acid replacements are critical for electron transfer. Apparently, an intimate relation exists between domains of gp91-phox involved in electron transfer and in p47/p67-phox binding. (Blood. 2000;95:666-673)
Assuntos
Doença Granulomatosa Crônica/enzimologia , Doença Granulomatosa Crônica/genética , Glicoproteínas de Membrana/genética , NADPH Oxidases/genética , Neutrófilos/fisiologia , Mutação Puntual , Sequência de Aminoácidos , Substituição de Aminoácidos , Sistema Livre de Células , Pré-Escolar , Citosol/enzimologia , Doença Granulomatosa Crônica/sangue , Humanos , Técnicas In Vitro , Lactente , Leucócitos Mononucleares/enzimologia , Glicoproteínas de Membrana/sangue , Glicoproteínas de Membrana/química , Modelos Moleculares , Dados de Sequência Molecular , NADPH Oxidase 2 , Neutrófilos/efeitos dos fármacos , Neutrófilos/enzimologia , Estrutura Secundária de Proteína , Valores de Referência , Explosão Respiratória , Alinhamento de Sequência , Homologia de Sequência de Aminoácidos , Superóxidos/sangue , Acetato de Tetradecanoilforbol/farmacologiaRESUMO
Treatment with gamma-interferon (IFN-gamma) is associated with reduced frequency and severity of infections in chronic granulomatous disease (CGD), but the mechanism is unknown. Since the inducible nitric oxide (NO) synthase can be amplified by IFN-gamma in murine macrophages, for example, we hypothesized that IFN-gamma might modulate NO release from polymorphonuclear neutrophils (PMNs) in patients with CGD. Eight patients with CGD and eight healthy controls were studied. Each patient was given either 50 or 100 microg of IFN-gamma per m2 on two consecutive days. The production of NO from N-formyl-methionyl-leucyl-phenylalanine (fMLP)-stimulated PMNs was assessed as the NG-monomethyl-L-arginine-inhibitable oxidation of oxyhemoglobin to methemoglobin in the presence of catalase and superoxide dismutase. Prior to IFN-gamma treatment, the PMNs from CGD patients produced 372 +/- 27 (mean +/- standard error of the mean) pmol of NO/10(6) PMNs at 45 min, while the control PMNs produced 343 +/- 44 pmol. On day 1 after IFN-gamma treatment, NO production increased to 132% +/- 25% of that for controls, and on day 3 it reached 360% +/- 37% (P < 0.001) of that for controls. On day 8, the values still remained higher, 280% +/- 78% more than the control values. Likewise, the bactericidal capacity of PMNs increased on day 3. The present data show that IFN-gamma treatment of CGD patients is associated with an increased production of NO from PMNs when activated by fMLP. Since these PMNs lack the capacity to produce superoxide anions, it is conceivable that this increase in NO release could be instrumental in augmenting host defense.
Assuntos
Doença Granulomatosa Crônica/tratamento farmacológico , Interferon gama/uso terapêutico , Neutrófilos/metabolismo , Óxido Nítrico/biossíntese , Adolescente , Adulto , Criança , Feminino , Doença Granulomatosa Crônica/sangue , Doença Granulomatosa Crônica/imunologia , Humanos , Interferon gama/administração & dosagem , MasculinoRESUMO
Human neutrophils have a short half-life and are believed to die by apoptosis or programmed cell death both in vivo and in vitro. We found that caspases are activated in a time-dependent manner in neutrophils undergoing spontaneous apoptosis, concomitant with other characteristic features of apoptotic cell death such as morphologic changes, phosphatidylserine (PS) exposure, and DNA fragmentation. The treatment of neutrophils with agonistic anti-Fas monoclonal antibodies (MoAbs) significantly accelerated this process. However, in cells treated with the potent neutrophil activator phorbol 12-myristate 13-acetate (PMA), caspase activity was only evident after pharmacologic inhibition of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Similarily, inhibition of the NADPH oxidase in constitutive and Fas/APO-1-triggered apoptosis resulted in increased rather than suppressed levels of caspase activity, suggesting that reactive oxygen species may prevent caspases from functioning optimally in these cells. Moreover, oxidants generated via the NADPH oxidase were essential for PS exposure during PMA-induced cell death, but not for neutrophils undergoing spontaneous apoptosis. We conclude that caspases are an important component of constitutive and Fas/APO-1-triggered neutrophil apoptosis. However, these redox sensitive enzymes are suppressed in activated neutrophils, and an alternate oxidant-dependent pathway is used to mediate PS exposure and neutrophil clearance under these conditions.
Assuntos
Apoptose , Caspases/fisiologia , Neutrófilos/fisiologia , Espécies Reativas de Oxigênio/fisiologia , Tamanho Celular/efeitos dos fármacos , Fragmentação do DNA/efeitos dos fármacos , Ativação Enzimática , Doença Granulomatosa Crônica/enzimologia , Doença Granulomatosa Crônica/patologia , Humanos , NADPH Oxidases/fisiologia , Neutrófilos/efeitos dos fármacos , Neutrófilos/enzimologia , Fosfatidilserinas/farmacologia , Acetato de Tetradecanoilforbol/farmacologia , Fatores de Tempo , Receptor fas/fisiologiaRESUMO
Interferon-gamma (IFN-gamma) is recommended as prophylaxis against infections in patients with chronic granulomatous disease (CGD). However, since the optimal dose, the dosing interval, and the mechanisms of action are not well-defined, we studied the effects on CGD neutrophil (PMN) functions ex vivo of interferon-gamma (IFN-gamma). Evaluations were made on oxidative capacity, measured by superoxide anion production and chemiluminescence after stimulation with f-met-leu-phe (f-MLP) or phorbol-myristate-acetate, the killing of Aspergillus fumigatus hyphae (assessed as conversion of the tetrazolium salt MTT to formazan), and on the expression of Fc gammaRI receptor (CD64). After randomization, 9 CGD patients (4 with gp91phox, 3 with p47phox, 1 with p67phox deficiency and 1 with unspecified CGD) were given IFN-gamma, either 50 or 100 microg/m2 subcutaneously on 2 consecutive days after double blinded randomization. Furthermore, one female hyperlyonized X-linked carrier with a CGD phenotype was also studied separately after IFN-gamma treatment. Evaluations were made the day before and on days 1, 3, 8, and 18 after IFN-gamma administration. The killing of A fumigatus hyphae, being close to zero before IFN-gamma, was enhanced on day 3, being 36% higher than pretreatment values in the high-dose CGD group and 17% in the low-dose group. The expression of Fc gammaRI on PMN increased 3.7-fold in the high-dose and 2.3-fold in the low-dose CGD group, being maximal on day 1. Oxidative functions were raised in only selected patients represented by different subtypes of CGD. The hyperlyonized carrier of X-linked CGD responded to IFN-gamma with more enhanced oxidative responses and Aspergillus killing of her PMNs than the other patients. This study suggests that a higher dose of IFN-gamma than currently recommended confers transient enhancements of certain PMN functions in CGD patients.
Assuntos
Doença Granulomatosa Crônica/terapia , Interferon gama/uso terapêutico , NADPH Oxidases , Neutrófilos/fisiologia , Adolescente , Adulto , Aspergillus , Criança , Relação Dose-Resposta a Droga , Método Duplo-Cego , Feminino , Doença Granulomatosa Crônica/sangue , Doença Granulomatosa Crônica/genética , Humanos , Técnicas In Vitro , Interferon gama/farmacologia , Cinética , Medições Luminescentes , Masculino , Glicoproteínas de Membrana/deficiência , N-Formilmetionina Leucil-Fenilalanina/farmacologia , NADH Desidrogenase/deficiência , NADPH Desidrogenase/deficiência , NADPH Oxidase 2 , Neutrófilos/efeitos dos fármacos , Fagocitose/efeitos dos fármacos , Fosfoproteínas/deficiência , Proteínas Recombinantes , Superóxidos/sangue , Acetato de Tetradecanoilforbol/farmacologia , Fatores de TempoRESUMO
One isoform of apolipoprotein E (apoE), a protein primarily involved in transport of lipids, is associated with an increased risk for Alzheimer's disease. Moreover, fragments of apoE are deposited in the amyloid that invariantly are found in brain tissue of disease victims. An intriguing possibility is therefore that increased levels of apoE are involved in the pathogenesis of the disease. Levels of full-length apoE in cerebrospinal fluid from 13 Alzheimer patients and 12 healthy controls were determined using Western blotting technique. Levels of the protein were essentially identical to previously reported findings and no difference between patients and healthy controls was found. Hence, it is concluded that increases in cerebrospinal fluid (CSF) levels of apoE are not involved in the pathogenesis of Alzheimer's disease and that measurement of CSF apoE levels does not seem to be useful as a diagnostic procedure.
Assuntos
Doença de Alzheimer/líquido cefalorraquidiano , Apolipoproteínas E/líquido cefalorraquidiano , Idoso , Amiloide/metabolismo , Apolipoproteínas E/análise , Western Blotting , Cromatografia em Gel , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Peso MolecularRESUMO
Chronic granulomatous disease (CGD) is characterized by the failure of phagocytic leukocytes to generate superoxide, needed for the intracellular killing of microorganisms. This is caused by mutations in any one of the four subunits of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. In a rare, autosomal recessive form of CGD, a 67-kD cytosolic component of this enzyme (p67-phox) is missing. We here report on a patient with a mutation in the p67-phox gene that leads to expression of a nonfunctional p67-phox protein. The purified granulocytes of this patient failed to produce superoxide and contained about half of the normal amount of p67-phox. Analysis of the cDNA and genomic DNA of this patient showed that the patient is a compound heterozygote for a triplet nucleotide deletion in the p67-phox gene, predicting an in-frame deletion of lysine 58 in the p67-phox protein and a larger deletion of 11-13 kb in the other allele. Interestingly, the 58Lys deletion in p67-phox disrupts the interaction with p21-rac1, a ras-related protein involved in the activation of the NADPH oxidase. In contrast to normal neutrophils, in which p47-phox and p67-phox translocate to the plasma membrane upon cell activation, the cells of the patient did not show this translocation, indicating that an interaction between p67-phox and p21-rac1 is essential for translocation of these cytosolic proteins and activation of the NADPH oxidase. Moreover, this CGD patient represents the first case of disease caused by a disturbed binding of a ras-related protein to its target protein.
Assuntos
Proteínas de Ligação ao GTP/metabolismo , Doença Granulomatosa Crônica/etiologia , Doença Granulomatosa Crônica/genética , Mutação , Fosfoproteínas/genética , Transporte Biológico , Compartimento Celular , Criança , Chile/etnologia , Feminino , Doença Granulomatosa Crônica/classificação , Humanos , NADPH Oxidases , Fosfoproteínas/metabolismo , Proteínas Recombinantes de Fusão/metabolismo , Análise de Sequência de DNA , Proteínas rac de Ligação ao GTPAssuntos
Grupo dos Citocromos b/deficiência , Doença Granulomatosa Crônica/genética , Glicoproteínas de Membrana/genética , Proteínas de Membrana Transportadoras , NADH NADPH Oxirredutases/deficiência , NADPH Desidrogenase/genética , Fosfoproteínas/genética , Cromossomo X/genética , Sequência de Bases , Membrana Celular/enzimologia , Cromossomos Humanos Par 1/genética , Cromossomos Humanos Par 16/genética , Cromossomos Humanos Par 7/genética , Sequência Consenso , Grupo dos Citocromos b/química , Grupo dos Citocromos b/genética , Grânulos Citoplasmáticos/enzimologia , Feminino , Genes Recessivos , Heterogeneidade Genética , Terapia Genética , Doença Granulomatosa Crônica/classificação , Doença Granulomatosa Crônica/enzimologia , Doença Granulomatosa Crônica/terapia , Humanos , Interferon gama/uso terapêutico , Leucócitos/enzimologia , Leucócitos/ultraestrutura , Masculino , Modelos Moleculares , Dados de Sequência Molecular , Mutação , NADH NADPH Oxirredutases/química , NADH NADPH Oxirredutases/genética , NADPH Oxidase 2 , NADPH Oxidases , Conformação Proteica , Proteínas Recombinantes , Deleção de SequênciaRESUMO
To estimate the prevalence of chronic granulomatous disease (CGD) in Sweden, an inquiry asking for known and possible CGD cases was mailed to paediatric, internal medicine and infectious disease departments all over Sweden. The detected patients were characterized as to genetics and the clinical presentation. Twenty-one patients (belonging to 16 different families) were found, corresponding to a prevalence of approximately 1/450,000 individuals. The patients with X-linked disease, lacking a functional gp91phox protein (n = 12), comprised 57% and 43% of the patients had an autosomal recessive (AR) disease lacking p47phox (n = 7) or p67phox (n = 1), respectively. All unrelated patients with X-linked disease displayed different gene abnormalities such as point mutations predicting nonsense (n = 3), missense (n = 1) or splice site mutations (n = 2), but also a total deletion and a unique 40 base pair duplicature insertion. The patients with p47phox-deficiency showed a GT deletion at a GTGT tandem repeat, and the p67phox-deficient patient displayed a heterozygous in-frame deletion of AAG combined with a large deletion in the other allele. Three patients died during the study period, two from pseudomonas cepacia infections. Patients with X-linked disease had more frequent infections (mean of 1.7 per year), than the patients with AR inheritance (0.5 infections per year). The most common infections were dermal abscesses (n = 111), followed by lymphadenitis (n = 82) and pneumonias (n = 73). Inflammatory bowel disease-like symptoms, mimicking Crohn's disease of the colon, was seen in three CGD patients.
Assuntos
Doença Granulomatosa Crônica/genética , Adolescente , Adulto , Criança , Pré-Escolar , Aberrações Cromossômicas/genética , Transtornos Cromossômicos , Estudos Transversais , Feminino , Genes Recessivos/genética , Triagem de Portadores Genéticos , Ligação Genética/genética , Doença Granulomatosa Crônica/diagnóstico , Doença Granulomatosa Crônica/epidemiologia , Humanos , Incidência , Masculino , Infecções Oportunistas/diagnóstico , Infecções Oportunistas/epidemiologia , Infecções Oportunistas/genética , Mutação Puntual/genética , Fatores de Risco , Aberrações dos Cromossomos Sexuais/genética , Suécia/epidemiologia , Cromossomo XRESUMO
Activated polymorphonuclear neutrophil granulocytes (PMN) from patients with chronic granulomatous disease (CGD) show reduced electron-proton shifts and an inability to acidify the cell. We studied whether this impaired pH-regulating capacity affected PMN membrane potential changes and the kinetics of homotypic aggregation by changing the extracellular pH over a wide range. At pH 7.4 normal PMN showed a rapid, transient membrane depolarization to leukotriene B4 (LTB4) and a slower response to N-formyl-methionyl-leucyl-phenylalanine. In contrast, PMN from 13 patients with CGD exhibited no or minute depolarization to these stimuli and 77% of tested patients with CGD displayed absence or marked reductions of the disaggregation to LTB4. On acidification of pH 5.0 to 6.4, PMN membrane depolarization appeared in six of nine tested patients. Likewise, disaggregation became evident in all of three patients. On alkalinization of normal PMN to pH 8.0 to 9.0, membrane depolarization and disaggregation to LTB4 disappeared, and cells reacted as CGD PMN. This change was not due to inefficient signal transduction, because normal PMN enhanced the superoxide ion production to N-formyl-methionyl-leucyl-phenylalanine on this alkalinization. Cytosolic pH changes in resting and LTB4-activated CGD cells at pH 6.0, 7.4, and 8.5 were similar those in control cells but for absence of an initial acidification. Thus neutrophil membrane potential changes and aggregation kinetics to LTB4 are abnormal in patients with CGD and return toward normal on extracellular acidification.
Assuntos
Doença Granulomatosa Crônica/fisiopatologia , Neutrófilos/fisiologia , Adolescente , Adulto , Ânions/metabolismo , Agregação Celular/efeitos dos fármacos , Criança , Feminino , Humanos , Concentração de Íons de Hidrogênio , Cinética , Leucotrieno B4/farmacologia , Medições Luminescentes , Masculino , Potenciais da Membrana/efeitos dos fármacos , Neutrófilos/efeitos dos fármacos , Nitroazul de Tetrazólio , Valores de Referência , Superóxidos/metabolismoRESUMO
Fourteen patients suffering from dementia of the Alzheimer type were treated with tacrine (tetrahydroaminoacridine, THA) for 1 year in an open trial. Clinical results were evaluated every third month with neuropsychological tests and rating scales. During the dose-finding, two patients were temporarily withdrawn from medication and one patient was excluded because of elevated levels of liver enzymes. With individualized doses the treatment caused few side effects. Plasma levels of THA varied substantially among patients and correlated with elevation of liver enzymes but not with clinical response. Two patients showed a gradual increase in plasma levels of THA despite unchanged doses. Although results of the neuropsychological tests and clinical ratings were mostly negative, the study indicates that THA can be administered safely for prolonged periods of time. Clinical observations and dose-titration strategy in relation to side effects are discussed.
Assuntos
Doença de Alzheimer/tratamento farmacológico , Testes Neuropsicológicos , Nootrópicos/administração & dosagem , Tacrina/administração & dosagem , Idoso , Doença de Alzheimer/sangue , Doença de Alzheimer/psicologia , Relação Dose-Resposta a Droga , Esquema de Medicação , Feminino , Humanos , Testes de Função Hepática , Masculino , Entrevista Psiquiátrica Padronizada , Taxa de Depuração Metabólica/fisiologia , Pessoa de Meia-Idade , Nootrópicos/efeitos adversos , Nootrópicos/farmacocinética , Tacrina/efeitos adversos , Tacrina/farmacocinéticaRESUMO
The presence of macrophages and the induction of c-jun protein and proliferation of non-neuronal cells were studied following implantation of silicone tubes with different diameters (i.e. 0.8 or 1.6 mm) around the rat sciatic nerve. Three days after implantation, numerous EDI and ED2 positive macrophages could be observed around the nerve beneath the 1.6 mm tubes. Some EDI and ED2 positive macrophages were also present in the endoneurium. In contrast, there were numerous EDI and ED2 positive macrophages in the endoneurium beneath the tube and distally in nerves surrounded by the 0.8 mm tube. In these experiments, there was also a massive induction of c-jun protein and DNA synthesis in non-neuronal cells, as visualised by c-jun and BrdU antibodies respectively (e.g. a response similar to that observed after a crush lesion). Such activated cells, albeit few, were also present in the endoneurium beneath the tube of nerves with a 1.6 mm tube, but not distal to the tube in the endoneurium. At 7 days, the responses were somewhat amplified but essentially the same as at 3 days. The results showed that the large diameter implants, which do not cause axonal damage, as does the small diameter tube, but result in conditioning of the nerve [4], induced invasion of macrophages around the nerve and activation of some cells in the endoneurium beneath the tube. We suggest that cell activation is caused by factors released from macrophages and that endoneurial cell activation is important for the conditioning of the nerve by the silicone tube implant.
RESUMO
(S)- and (R)-[11C]nicotine were synthesized by methylation of (S)- and (R)-nornicotine using [11C]methyl iodide. Following their intravenous injection in tracer doses to smoking and nonsmoking healthy males the radioactivity in arterial blood showed a sharp peak at about 1 min followed by a plateau level for the remaining 50 min of recording. Uptake in the brain, as measured by positron emission tomography (PET), was rapid with a peak at 5 min followed by a steady decline towards the end of the measurement. The regional distribution of radioactivity followed essentially the distribution of gray matter with high uptake in the cortex, the thalamus and the basal ganglia and low uptake in the pons, cerebellum and white matter. Levels of the labelled natural enantiomer, (S)-[11C]nicotine, were higher than those of the synthetic enantiomer, (R)-[11C]nicotine, particularly in the smokers. The time-activity curves of (S)-[11C]nicotine uptake were not changed by co-administration of 1.0 mg of unlabelled nicotine with the labelled nicotine. Similarly administration of unlabelled nicotine at the peak of radioactivity, 6 min following (S)-[11C]nicotine, had no effect on the time-activity curves. Thus essential criteria for visualizing receptor binding with the PET technique could not be fulfilled. Calculation of kinetic constants using a two-compartment model gave values indicating that the brain uptake of [11C]nicotine is mainly determined by the cerebral blood flow, extraction of the tracer over the blood-brain barrier and unspecific binding. Thus 11C-labelled nicotine does not seem to be a suitable tracer for PET studies of nicotinic cholinergic receptors in the human brain.
Assuntos
Encéfalo/metabolismo , Nicotina/farmacocinética , Receptores Nicotínicos/metabolismo , Adulto , Encéfalo/diagnóstico por imagem , Isótopos de Carbono , Humanos , Masculino , Modelos Biológicos , Nicotina/sangue , Fumar/metabolismo , Estereoisomerismo , Tomografia Computadorizada de EmissãoRESUMO
The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.
Assuntos
Tonsila Faríngea/microbiologia , Haemophilus influenzae/crescimento & desenvolvimento , Tonsila Faríngea/ultraestrutura , Adolescente , Sequência de Bases , Criança , Pré-Escolar , Sondas de DNA , DNA Bacteriano/genética , Haemophilus influenzae/genética , Haemophilus influenzae/isolamento & purificação , Humanos , Hibridização in Situ Fluorescente , Microscopia Eletrônica , Dados de Sequência Molecular , RNA Bacteriano/genética , RNA Ribossômico 16S/genéticaRESUMO
In a previous pharmacokinetic study in Alzheimer patients great inter-individual variation and low oral bioavailability of the cholinesterase inhibitor tacrine (tetrahydroaminoacridine, THA) were found. In the present investigation oral and rectal administration of tacrine were compared with the aim to find a route for improved bioavailability through diminished first-pass metabolism in the liver. Eight patients suffering from Alzheimer's dementia were given tacrine by oral (25 and 50 mg b.i.d.) and rectal (12.5 and 25 mg b.i.d.) routes for 1 week with 4-6 weeks washout in between. Drug hydroxylation capacity in the patients was determined using the debrisoquine test. Levels of tacrine in plasma and cerebrospinal fluid (CSF) were determined and the cognitive performance was examined by the Mini-Mental State Examination (MMSE) and the Alzheimer Deficit Assessment Scale (ADAS). Tacrine was well tolerated in all but one patient, a slow hydroxylator, who developed an aplastic anemia. MMSE and ADAS scores did not significantly change, except for word recall which was improved on tacrine when given by the rectal route. Pharmacokinetic analysis of the two administration routes revealed that the drug dose may be reduced by almost 50% when given rectally compared to orally. Concentrations of tacrine in the CSF were significantly lower and correlated linearly with the concentrations in plasma.
Assuntos
Doença de Alzheimer/tratamento farmacológico , Tacrina/uso terapêutico , Administração Oral , Administração Retal , Idoso , Disponibilidade Biológica , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Tacrina/administração & dosagem , Tacrina/farmacocinéticaRESUMO
Chronic granulomatous disease (CGD) is characterized by the inability of the patients' phagocytic leukocytes to generate superoxide. Therefore, these cells fail to kill certain bacteria and fungi. As a result, patients with CGD suffer from recurrent, life-threatening infections with these micro-organisms. Superoxide is produced by NADPH oxidase, a multicomponent enzyme exclusively present in phagocytic leukocytes. The most common form of CGD is X-linked, originating from a deficiency of the high-molecular-weight subunit of cytochrome b558 (gp91-phox). Here we describe a patient suffering from X-linked CGD due to a 40-base-pair duplication in exon 7 of the CYBB gene coding for gp91-phox, predicting a frameshift, substitution of 22 amino acids and a premature stop codon at amino-acid position 253. The mother as well as the grandmother of this patient were proven to be heterozygous for this mutation; the father and sister were normal. However, the great-grandmother proved to have normal oxidative functions, suggesting that the mutation occurred three generations ago. This is the first description of a nucleotide duplication leading to CGD.
Assuntos
Grupo dos Citocromos b/genética , Doença Granulomatosa Crônica/genética , Leucócitos Mononucleares/metabolismo , NADPH Oxidases , Mutação Puntual , Cromossomo X , Sequência de Aminoácidos , Sequência de Bases , Northern Blotting , Éxons , Feminino , Doença Granulomatosa Crônica/sangue , Humanos , Lactente , Íntrons , Substâncias Macromoleculares , Masculino , Dados de Sequência Molecular , Família Multigênica , Linhagem , Reação em Cadeia da Polimerase/métodos , RNA/sangue , RNA/isolamento & purificação , Mapeamento por RestriçãoRESUMO
A clinical comparison of tacrine (THA) and placebo was performed in 15 Alzheimer patients using a double blind crossover technique over 4 plus 4 weeks with one drug-free week in between. Treatment results, as evaluated by clinical rating scales and neuropsychological tests, were mostly negative. Side effects were few, except for elevation liver enzymes which occurred in one third of the patients. CSF levels of the monoamine metabolites HVA and 5-HIAA increased on tacrine as evidence for activation of dopamine and serotonin pathways through cholinergic receptors. Pharmacokinetic investigations showed that the oral bioavailability of tacrine was low and greatly varying between subjects. Patients with high bioavailability of the drug tended to improve more, and also to have more liver enzyme elevations, than those with low bioavailability. A gel preparation for rectal administration was manufactured for comparison of plasma levels attained during one week's treatment with levels attained with oral capsules. Preliminary results indicate that the dose of tacrine can be reduced to 50 per cent when administered rectally, probably as by this route the rapid first-pass metabolism of the drug in the liver is diminished. A clinical trial of tacrine via the rectal route would be justified as this could decrease the number of patients with liver side effects and increase the number of patients improving on the treatment.
Assuntos
Doença de Alzheimer/tratamento farmacológico , Tacrina/uso terapêutico , Administração Retal , Doença de Alzheimer/diagnóstico , Doença de Alzheimer/metabolismo , Monoaminas Biogênicas/líquido cefalorraquidiano , Estudos Transversais , Método Duplo-Cego , Feminino , Ácido Homovanílico/líquido cefalorraquidiano , Ácido Homovanílico/metabolismo , Humanos , Ácido Hidroxi-Indolacético/líquido cefalorraquidiano , Ácido Hidroxi-Indolacético/metabolismo , Fígado/efeitos dos fármacos , Fígado/enzimologia , Masculino , Testes Neuropsicológicos , Placebos , Tacrina/administração & dosagem , Tacrina/farmacologiaRESUMO
Chronic granulomatous disease (CGD) is characterized by the absence of a respiratory burst in activated phagocytes. Defects in at least four different genes lead to CGD. Patients with the X-linked form of CGD have mutations in the gene for the beta-subunit of cytochrome b558 (gp91-phox). We studied the molecular defect in four patients with X-linked CGD. In a fifth family, we studied the mother of a patient with X-linked CGD who had died before our investigations. Gp91-phox messenger RNA (mRNA) was reverse transcribed into cDNA and the coding region was amplified by polymerase chain reaction into three fragments. Sequence analysis showed the absence of the exon 7, 5, 3, and 2 sequences in patients 1, 2, 3, and 4, respectively. In carrier 5, we found both normal cDNA and cDNA that lacked 57 3'-nucleotides of exon 6. We analyzed the splice sites of the flanking introns of the missing exons. In patients 1, 2, and 3, we found single nucleotide substitutions within the first five positions of the down-stream 5' donor splice sites. In patient 4, a similar substitution was found at position -1 of the 3' acceptor splice site of intron 1. In carrier 5, no mutation was found in the exon 6-intron 6 boundary sequence. Instead, a single substitution was observed in exon 6 (C----A at nucleotide 633) that created a new donor splice site. Apparently, mRNA splicing occurs preferentially at this newly created splice site. We conclude that the absence of the exon sequences in the gp91-phox mRNA of these patients is due to splicing errors. Of 30 European X-linked CGD patients studied by us so far, five appear to be caused by mutations that affect correct mRNA splicing. Thus, such mutations appear to be a common cause of X-linked CGD.