RESUMO
Malathion (MAL) is one of the highly toxic organophosphorus (OP) compounds that induces hepatotoxicity. Echinops. ritro leaves extract (ERLE) is traditionally used in the treatment of bacterial/fungal infections. This study's goal was to investigate the potential of extracts from ERLE against hepatotoxicity induced by MAL in male albino rats. Four equal groups of forty mature male albino rats were created: The rats in the first group used as a control. The second group of rats received ERLE orally. The third group received MAL. ERLE and MAL were administered to the fourth group of rats. Six-week treatment groups were conducted. Using lipid peroxidation indicators [malondialdehyde (MDA), alanine aminotransferase (ALT), aspartate aminotransferase (AST)], oxidative stress markers [catalase (CAT), superoxide dismutase (SOD) and glutathione peroxidase (GPx)], apoptotic markers [Bcl-2 & caspase-3] and tumor necrosis factor alpha (TNF-α). Rats treated with MAL underwent a significant increase on MDA, ALT, AST, caspase-3 and TNF-α marker with a significant decrease in antioxidant markers [CAT, SOD, GPx] and Bcl-2. Histologically, MAL-treated group's liver sections displayed damaged hepatocytes with collapsed portions, pyknotic nuclei, vacuolated cytoplasm, and congested central veins. Ultra structurally, rat livers treated with MAL showed dilated cisternae of endoplasmic reticulum, swollen mitochondria with disrupted cristae, nuclei with disrupted chromatin content, multiple lysosomes, multiple vacuolations and a disrupted blood sinusoid. With rats treated with ERLE, these alterations were essentially non-existent. It is possible to conclude that ERLE protects against MAL hepatotoxicity, and that this protection is related, at least in part, to its antioxidant activities.
RESUMO
Introduction: Administration of high doses of acetaminophen (APAP) results in liver injury. Oxidative stress and iron overload play roles in the pathogenesis of APAP-induced hepatotoxicity. The present study assessed the potential hepatoprotective effects of phytic acid (PA), a natural antioxidant and iron chelator, on APAP-induced hepatotoxicity and the possible underlying mechanism through its effects on CYP2E1 gene expression, iron homeostasis, oxidative stress, and SIRT-1 expression levels. Methods: Twenty-four adult male albino mice were used in this study. Mice were divided into four groups (six mice in each group): control, APAP-treated, PA-treated and APAP + PA-treated groups. Liver function tests, serum and liver tissue iron load were evaluated in all the study groups. Hepatic tissue homogenates were used to detect oxidative stress markers, including malondialdehyde (MDA) and reduced glutathione (GSH). Histological hepatic evaluation and immunohistochemistry of SIRT-1 were performed. Quantitative real-time PCR was used for the assessment of CYP2E1 and SIRT-1 gene expressions. APAP-induced biochemical and structural hepatic changes were reported. Results: PA administration showed beneficial effects on APAP-induced hepatotoxicity through improvements in liver functions, decreased CYP2E1 gene expression, decreased serum and liver iron load, decreased MDA, increased GSH, increased SIRT-1 expression level and improvement in hepatic architecture. Conclusion: Conclusively, PA can be considered a potential compound that can attenuate acetaminophen-induced hepatotoxicity through its role as an iron chelator and antioxidant, as well as the up-regulation of SIRT-1 and down-regulation of CYP2E1.
RESUMO
Cardiotoxicity induced by doxorubicin (Dox) is a major complication in cancer patients. Exosomes (Ex) derived from mesenchymal cells could be a promising therapeutic for various heart diseases. This study investigated the role of Ex in Dox-induced cardiotoxicity and its mechanistic insights, using Sacubitril/valsartan (S/V) as a reference drug widely recommended in heart failure management. The study involved 24 Wistar rats, divided into a control, Dox, Dox + S/V, and Dox + Ex groups. The rats were assessed for cardiac enzymes, inflammatory and oxidative stress markers. Immunohistochemical expression of caspase-1, nuclear factor erythroid 2-related factor 2 (NrF2), E-Cadherin, CD117/c-kit, and Platelet-derived growth factor-α (PDGFα) was evaluated. P53 and Annexin V were assessed by PCR. Histological examination was performed using hematoxylin and eosin and Sirius red stains. Ex ameliorated the adverse cardiac pathological changes and significantly decreased the cardiac enzymes and inflammatory and oxidative stress markers. Ex also exerted antifibrotic and antiapoptotic effect in heart tissue. Ex treatment also improved NrF2 immunohistochemistry, up-regulated E-Cadherin immune expression, and restored the telocyte markers CD117/c-kit and PDGFα. Ex can mitigate Dox-induced cardiotoxicity by acting as an anti-inflammatory, antioxidant, antiapoptotic, and antifibrotic agents, restoring telocytes and modulating epithelial mesenchymal transition. RESEARCH HIGHLIGHTS: Exosomes exhibit positive expression for CD90 and CD105 whereas showing -ve expression for CD 34 by flow cytometry. Exosomes restore the immunohistochemical expression of the telocytes markers CD117/c-kit and PDGFα. Exosomes alleviate myocardial apoptosis, oxidative stress and fibrosis.
RESUMO
BACKGROUND: A considerable body of research has demonstrated that reducing sitting time benefits health. Therefore, the current study aimed to explore the prevalence of sedentary behavior (SB) and its patterns. METHODS: A total of 6975 university students (49.1% female) were chosen randomly to participate in a face-to-face interview. The original English version of the sedentary behavior questionnaire (SBQ) was previously translated into Arabic. Then, the validated Arabic version of the SBQ was used to assess SB. The Arabic SBQ included 9 types of SB (watching television, playing computer/video games, sitting while listening to music, sitting and talking on the phone, doing paperwork or office work, sitting and reading, playing a musical instrument, doing arts and crafts, and sitting and driving/riding in a car, bus or train) on weekdays and weekends. RESULTS: SBQ indicated that the total time of SB was considerably high (478.75 ± 256.60 and 535.86 ± 316.53 (min/day) during weekdays and weekends, respectively). On average, participants spent the most time during the day doing office/paperwork (item number 4) during weekdays (112.47 ± 111.11 min/day) and weekends (122.05 ± 113.49 min/day), followed by sitting time in transportation (item number 9) during weekdays (78.95 ± 83.25 min/day) and weekends (92.84 ± 100.19 min/day). The average total sitting time of the SBQ was 495.09 ± 247.38 (min/day) and 58.4% of the participants reported a high amount of sitting time (≥ 7 hours/day). Independent t-test showed significant differences (P ≤ 0.05) between males and females in all types of SB except with doing office/paperwork (item number 4). The results also showed that male students have a longer daily sitting time (521.73 ± 236.53 min/day) than females (467.38 ± 255.28 min/day). Finally, 64.1% of the males reported a high amount of sitting time (≥ 7 hours/day) compared to females (52.3%). CONCLUSION: In conclusion, the total mean length of SB in minutes per day for male and female university students was considerably high. About 58% of the population appeared to spend ≥7 h/day sedentary. Male university students are likelier to sit longer than female students. Our findings also indicated that SB and physical activity interventions are needed to raise awareness of the importance of adopting an active lifestyle and reducing sitting time.
Assuntos
Comportamento Sedentário , Estudantes , Humanos , Masculino , Feminino , Prevalência , Arábia Saudita/epidemiologia , UniversidadesRESUMO
The present study has been designed to detect the dose-dependent effect of iron oxide nanoparticles (IONPs) on the liver and kidney of rats by evaluating three different doses 30, 300, 1000 mg/kg/day IONPs for 28 days. Forty rats were divided into four groups; I (control), II (low dose), III (medium dose) and IV (high dose). There also was a statistically-significant elevation in the serum levels of hepatic enzymes; AST and ALT in medium & high dose. The elevation of serum ALP, on the other hand, was significant in all IONPs doses. There was significant elevation in the levels of urea creatinine, and MDA in the medium and high doses of IONPs. The activity of superoxide dismutase (SOD) and glutathione peroxidase (GPx) showed significant decrease in the high dose only compared to the control group. The serum iron levels increased in a dose-dependent manner in the IONPs-treated groups with highly significant increase in the moderate and high dose groups. On comparing the effect of different doses of IONPs between the liver and kidney, the high dose revealed statistically significant difference (p < 0.05) in the area percent of collagen deposition (54.4 ± 3.9 versus 6.1 ± 2.6) and alpha smooth muscle actin (α-SMA) reaction (7.7 ± 1.5 versus 17.8 ± 4.3) in the liver relative to the kidney. The medium and high doses revealed statistically significant difference in optical density of Periodic acid Schiff (PAS) reaction (45 ± 3.4 versus 50.3 ± 1.8 in the medium dose, and 38.9 ± 6 versus 63 ± 3 in the high dose) and area percent of inducible nitric oxide synthase (iNOS) reaction (12.98 ± 2.7 versus 3.5 ± 0.5 in the medium dose, and 27.91 ± 1.5 versus 7.7 ± 0.6 in the high dose) in the liver relative to the kidney.
RESUMO
BACKGROUND: Renal ischemia/reperfusion (I/R) is a primary culprit of acute kidney injury. Neurodegeneration can result from I/R, but the mechanisms are still challenging. We studied the implications of bilateral renal I/R on brain and potential involvement of the oxidative stress (OS) driven extracellular signal-regulated kinase1/2, c-Jun N-terminal kinase (ERK1/2, JNK) and Galectin-3 (Gal-3)/nuclear factor Kappa B (NF-ÒB)/tumor necrosis factor-alpha (TNF-α), high mobility group box-1 (HMGB-1), and caspase-3 paths upregulation. We tested the impact of Nano-trimetazidine (Nano-TMZ) on these pathways being a target of its neuroprotective effects. METHODS: Study groups; Sham, I/R, TMZ+I/R, and Nano-TMZ+I/R. Kidney functions, cognition, hippocampal OS markers, Gal-3, NF-ÒB, p65 and HMGB-1 gene expression, TNF-α level, t-JNK/p-JNK and t-ERK/p-ERK proteins, caspase-3, glial fibrillary acidic protein (GFAP) and ionized calcium binding protein-1 (Iba-1) were assessed. RESULTS: Nano-TMZ averted renal I/R-induced hippocampal impairment by virtue of its anti: oxidative, inflammatory, and apoptotic properties. CONCLUSION: Nano-TMZ is more than anti-ischemic.
Assuntos
Nefropatias , Traumatismo por Reperfusão , Trimetazidina , Humanos , Trimetazidina/farmacologia , NF-kappa B/metabolismo , Fator de Necrose Tumoral alfa/metabolismo , Galectina 3/metabolismo , Caspase 3/metabolismo , Sistema de Sinalização das MAP Quinases , Isquemia , Traumatismo por Reperfusão/metabolismo , Reperfusão , Proteínas HMGB/metabolismoRESUMO
Introduction: The variable relation and clinical significance of mandibular foramen (MF) and Lingula with inferior alveolar neurovascular bundle (IANB) is important for dental surgeons. Knowing the landmarks on the ramus of the mandible is of paramount importance to perform the surgery without causing damage to the neurovascular bundle. Materials and Methods: This study was conducted on 85 dry adult mandibles of unknown sex and age. The distances were measured from the anatomical reference points (anti-Lingula, Lingula and MF) using digital callipers. Results: The distance from the anti-Lingula to the anterior border of the ramus (A) was significantly longer on the right side (14.91 mm) than on the left side (14.5 mm). There was a significant difference in mean distances between the anti-Lingula and MF of both the sides (P ≤ 0.005). No significant difference was noted in the distances between the Lingula and the Anti-Lingula, observed for the posterior (B, P = 0.75) and the inferior margin of the mandible (D, P = 0.54). However we found correlation of vertical distances of anti-Lingula with Lingula and MF exhibited moderate positive correlation. Discussion: The IANB is prone to damage during mandibular surgery. Using anti-Lingula alone as a reference point is not guaranteed, but it is still an important anatomical landmark for the surgeon to operate.
RESUMO
Background: Human papillomaviruses have been shown to dysregulate the gene expression and DNA methylation profiles of their host cells over the course of infection. However, there is a lack of information on the impact of low-risk HPV infection and wart formation on host cell's expression and methylation patterns. Therefore, the objective of this study is to analyse the genome and methylome of common warts using an integrative approach. Methods: In the present study, gene expression (GSE136347) and methylation (GSE213888) datasets of common warts were obtained from the GEO database. Identification of the differentially expressed and differentially methylated genes was carried out using the RnBeads R package and the edgeR Bioconductor package. Next, functional annotation of the identified genes was obtained using the Database for Annotation, Visualization, and Integrated Discovery (DAVID). Network construction and analyses of the gene-gene, protein-protein, and signaling interactions of the differentially expressed and differentially methylated genes was performed using the GeneMANIA web interface, the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database, and the Signaling Network Open Resource 2.0 (SIGNOR 2.0), respectively. Lastly, significant hub genes were identified using the Cytoscape application CytoHubba. Results: A total of 276 genes were identified as differentially expressed and differentially methylated in common warts, with 52% being upregulated and hypermethylated. Functional enrichment analysis identified extracellular components as the most enriched annotations, while network analyses identified ELN, ITGB1, TIMP1, MMP2, LGALS3, COL1A1 and ANPEP as significant hub genes. Conclusions: To the best knowledge of the authors, this is the first integrative study to be carried out on non-genital warts induced by low-risk HPV types. Future studies are required to re-validate the findings in larger populations using alternative approaches.
RESUMO
Potentially harmful elements (PHEs) associated with dust generated from anthropogenic sources can be transported into mosques and deposited on the filters of the air-conditioners (AC); thereby, children and adults are exposed to such PHEs while visiting mosques. Data dealing with the assessment of PHEs pollution and its human health risk in mosques dust in Saudi Arabia are scarce. Therefore, this work aims to examine the levels and pollution status of PHEs in AC filter dust (ACFD) of mosques and their associated human health risk in three Saudi cities: Jubail, Jeddah, and Dammam metropolitan. A similar concentration pattern of PHEs is observed in three cities' mosques with noticeably higher concentrations than both global crustal and local background values for Zn, Cu, Pb, As, and Cd only. Except for Fe, Al, and Mn, the highest PHEs concentrations were found in Jeddah (1407 mg/kg), followed by Dammam (1239 mg/kg) and Jubail (1103 mg/kg). High PHEs' concentrations were also recorded in mosques located near workshops and suburban areas compared to urban areas. Based on the spatial pattern, enrichment factor, geo-accumulation index, pollution load index, and ecological risk values, Jubail, Jeddah, and Dammam have shown moderate pollution levels of Cd, As, Pb, and Zn. On the other hand, Cu. Zn, Cu, Cr, Pb, Ni, As, and Cd had degrees of enrichment levels that varied from significantly enriched to extremely highly enriched in the ACFD of the three cities. Heavy pollution is found in Jubail, which posed a higher potential ecological risk than in Jeddah and Dammam. Cd presents the highest ecological risk factors (ER) in the three cities. Carcinogenic and non-carcinogenic risks for children and adults follow the order: Jeddah > Dammam > Jubail, and the ingestion pathway was the main route for exposure. Carcinogenic and con-carcinogenic risks in the mosques of the various studied cities were generally within the acceptable range.
Assuntos
Monitoramento Ambiental , Metais Pesados , Criança , Adulto , Humanos , Metais Pesados/análise , Poeira/análise , Cádmio , Chumbo , Medição de Risco , Cidades , Carcinógenos/análise , ChinaRESUMO
PURPOSE: The study aimed to test the validity and reliability of the Arabic version of the sedentary behavior questionnaire (SBQ). METHODS: A total of 624 university students (273 males; 351 females, mean age = 20.8 years) were recruited from Taibah University, Madinah, Saudi Arabia. For criterion and constructive validity (n = 352), the Arabic SBQ was compared with total sitting time from the International Physical Activity Questionnaire-short form (IPAQ-SF) and the International Physical Activity Questionnaire-long form (IPAQ-LF). For concurrent validity, the English and Arabic SBQ versions were given concurrently to bilingual university students (n = 122) once. For test-retest reliability, the Arabic SBQ was given twice to participants (n = 150) at a one-week interval. RESULTS: Sitting time of IPAQ-SF (7th question: sitting time on weekdays) and IPAQ-LF (21st question: sitting time on weekdays and 22nd question: sitting time on weekends) correlated significantly with total sitting time/week of the Arabic SBQ (r = 0.29, p = 0.003; r = 0.14, p = 0.02, respectively). Motorized transportation measured with the IPAQ-LF correlated significantly with time spent driving in a car, bus, or train from the Arabic SBQ on weekdays and weekends (r = 0.53, p < 0.001; r = 0.44 p < 0.001, respectively). The total sitting time of the Arabic SBQ was inversely correlated with BMI (r = -0.18, p = 0.001). The correlations between the Arabic and the English SBQ versions ranged from 0.25-0.96; p < 0.001 on weekdays and 0.50-0.90; p < 0.001 on weekends. Moderate to good reliability was also found between test and retest for all SBQ items and total score during weekdays (0.72 to 0.8), and weekends (0.64 to 0.87), with exception of the 7th item "play musical instrument", ICC = 0.46). Mean difference of test-retest of the Arabic SBQ was not significantly different from zero for the total sitting time of the Arabic SBQ (t = -0.715, P = 0.476). CONCLUSION: The Arabic SBQ had satisfactory levels of reliability, with total sitting time of the Arabic SBQ correlating significantly with sitting times derived from IPAQ-SF, IPAQ-LF, and the English SBQ versions. Hence, the Arabic SBQ can be used as a tool to measure sedentary behavior among adult Arabs aged between 18 to 30 years old in future epidemiologic and clinical practice.
Assuntos
Exercício Físico , Comportamento Sedentário , Adulto , Masculino , Feminino , Humanos , Adolescente , Adulto Jovem , Reprodutibilidade dos Testes , Universidades , Inquéritos e Questionários , EstudantesRESUMO
Objective The posterior condylar canals (PCCs), posterior condylar veins (PCVs), occipital foramen (OF), and occipital emissary vein (OEV) are potential anatomical landmarks for surgical approaches through the lateral foramen magnum. We performed the study to make morphometric and radiological analyses of the various emissary foramens and vein in the posterior cranial fossa. Methods Morphometric study were performed on 95 dry occipital bones and radiological analyses on computed tomography (CT) angiography images of 150 patients. The number of OFs on both sides was recorded and PCC length and mean diameters of the internal and external orifices of PCC were measured for bony specimens. Prevalence of PCV and PCV size was investigated using CT angiography. Results Mean PCC length was higher in the left side (9.85 ± 2.5). Mean diameter of the internal orifice and the external orifice diameter were almost the same. The majority of PCCs (75-79.33%) had 2 to 5 mm diameter; only 4 to 9.2% were small in size (< 2 mm). In CT angiography, PCV was not identified in 23 (15.33%) patients. PCVs were located bilaterally in 105 (70%) and unilaterally in 22 (20.5%) patients. Only 11.3% of PCVs were large in size (> 5 mm), 80% of PCVs were medium sized (2-5 mm), and 8.6% were small sized (< 2 mm). Conclusion Normal values of OF, PCC, PCV, and OEV could serve as a future reference for the understanding of the physiology of craniocervical venous drainage, which is necessary to avoid surgical complications and can also serve as a guide to surgical interventions for pathologies of the posterior cranial fossa, such as tumors and injuries.
RESUMO
Background: Long non-coding RNAs (lncRNAs) have been the subject of considerable attention in recent years due to their role in gene regulation. However, the function of lncRNAs remains poorly understood, especially in the context of infection with low-risk human papillomaviruses (HPVs). To further understanding on this issue, we investigated lncRNA expression in HPV-induced common warts. Methods: A publicly available high-throughput sequencing dataset for common warts was downloaded from the Gene Expression Omnibus (GEO). lncRNA profiles were generated using the NetworkAnalyst 3.0 workflow, and a list of differentially expressed (DE) lncRNAs in common warts was identified and inputted into the ENCODE, RegNetwork, DisGeNet, and miRNet platforms. Results: A total of 54 lncRNAs were revealed to be significantly dysregulated in common warts. Of these 54 lncRNAs, 24 and 30 were upregulated and downregulated, respectively. The most significantly differentially expressed lncRNAs in common warts included the CERNA2, LINC02159, SH3PXD2A-AS1, and UNC5B-AS1 genes. Conclusion: The current findings suggest that HPV-induced warts impact the host lncRNA transcriptome. To the best of our knowledge, the present study is the first to explore the impact of low-risk HPV infection on lncRNA expression profiles.
RESUMO
To prevent the rapid spreading of the COVID-19 pandemic, the Egyptian government had imposed partial lockdown restrictions which led emissions reduction. This served as ideal conditions for a natural experiment, for study the effect of partial lockdown on the atmospheric aerosol chemistry and the enhanced secondary inorganic aerosol production in a semi-desert climate area like Egypt. To achieve this objective, SO2, NO2, and PM2.5 and their chemical compositions were measured during the pre-COVID, COVID partial lockdown, and post-COVID periods in 2020 in a suburb of Greater Cairo, Egypt. Our results show that the SO2, NO2, PM2.5 and anthropogenic elements concentrations follow the pattern pre-COVID > post-COVID > COVID partial lockdown. SO2 and NO2 reductions were high compared with their secondary products during the COVID partial lockdown compared with pre-COVID. Although, PM2.5, anthropogenic elements, NO2, SO2, SO4 2-, NO3 -, and NH4 + decreased by 39%, 38-55%, 38%, 32.9%. 9%, 14%, and 4.3%, respectively, during the COVID partial lockdown compared with pre-COVID, with the secondary inorganic ions (SO4 2-, NO3 -, and NH4 +) being the dominant components in PM2.5 during the COVID partial lockdown. Moreover, the enhancement of NO3 - and SO4 2- formation during the COVID partial lockdown was high compared with pre-COVID. SO4 2- and NO3 - formation enhancements were significantly positive correlated with PM2.5 concentration. Chemical forms of SO4 2- and NO3 - were identified in PM2.5 based on their NH4 +/SO4 2- molar ratio and correlation between NH4 + and both NO3 - and SO4 2-. The particles during the COVID partial lockdown were more acidic than those in pre-COVID.
RESUMO
Methotrexate (MTX) is a potent anti-cancer drug, commonly associated with nephrotoxicity via the induction of oxidative stress and apoptosis with alteration of renal water channel proteins, namely aquaporins (AQPs). Omega-3 long-chain polyunsaturated fatty acids (LC-PUFA) have shown cytoprotective effects through their anti-oxidant and antiapoptotic activities. The present study aims for the first time to explore the role of LC-PUFA against MTX-induced nephrotoxicity. Rats were divided into the following groups: saline control, LC-PUFA control, MTX, MTX + LC-PUFA (150 mg/kg), or MTX + LC-PUFA (300 mg/kg). Then, H&E staining and immunohistochemical staining for the anti-apoptosis marker B-cell lymphoma 2 (BCL-2), the apoptosis marker BCL2-Associated X Protein (BAX), the proinflammatory marker Nuclear factor kappa B (NF-kB), AQPs 1 and 2 were performed in kidney sections with an assessment of renal oxidative stress. The MTX caused a renal histopathological alteration, upregulated renal BAX and NF-kB, downregulated Bcl-2 and AQP1, altered the distribution of AQP2, and caused oxidative stress. The LC-PUFA attenuated the pathological changes and decreased renal BAX and NF-kB, increased BCL-2 and AQP1, restored the normal distribution of AQP2, and decreased the oxidative stress. Therefore, LC-PUFA is a good adjuvant to MTX to prevent its adverse effects on kidneys through its antiapoptotic, antioxidant, and anti-inflammatory effect and its role in the restoration of the expression of AQPs 1 and 2.
Assuntos
Ácidos Graxos Ômega-3 , Metotrexato , Ratos , Animais , Metotrexato/metabolismo , Proteína X Associada a bcl-2/genética , Proteína X Associada a bcl-2/metabolismo , NF-kappa B/metabolismo , Aquaporina 2/metabolismo , Estresse Oxidativo , Rim/metabolismo , Antioxidantes/farmacologia , Antioxidantes/metabolismo , Proteínas Proto-Oncogênicas c-bcl-2/genética , Proteínas Proto-Oncogênicas c-bcl-2/metabolismo , Ácidos Graxos Ômega-3/farmacologia , Ácidos Graxos Ômega-3/metabolismo , Suplementos NutricionaisRESUMO
Objectives: Alopecia areata (AA) is a multifactorial autoimmune disease with a strong genetic predisposition. A variety of genes involved in immunity and inflammatory responses, such as cytokines, are suspected to increase the risk of developing AA. In which, different interleukin (IL) genes that associated with several autoimmune diseases and AA in varied populations. The objective of this study was to investigate the possible genetic association of AA with ten variants of single nucleotide polymorphism (SNP) in IL12B,IL13,IL16,IL17A, and IL18 genes among Jordanian patients. Methods: In this case-control study, peripheral blood samples of 152 Jordanian AA patients and 150 controls (total of 302 subjects) were collected, genomic DNA extracted and genotyped, based on which their allele and genotype frequencies were assessed. Results: In the rs11073001 SNP located in the exon region of the IL16 gene, the A allele was distributed more frequently in AA patients (p =0.01). A difference was found between the patients and the controls for the rs17875491 SNP in the promoter region of the IL16 gene (p =0.04). The mean age of onset was 27.3±12.6 with male predominance. Most patients (68.4%) were asymptomatic but some reported experiencing associated sensations before the hair loss episodes. The patchy patterns of alopecia were the most common (90.3%). Nail changes were found in 7.3% of the patients. Conclusions: The findings support the hypothesis of the involvement of IL16 gene in the etiology of AA. Moreover, it emphasizes the variations in the genetic component of AA, as well as the clinical phenotypes among different ethnic groups.
RESUMO
The ubiquitous presence of pharmaceutical drugs and microbes in the water is leading to the development of drug resistant microbes. Therefore, efficient materials that can remove or inactivate the drug and microbe contaminants are required. In this work, nickel sulfide/calcium alginate (Ni3S4/CA), silver sulfide/calcium alginate (Ag2S/CA), modified titanium dioxide/calcium alginate (TiO2/CA), and Ni3S4/Ag2S/TiO2/calcium alginate (Ni3S4/Ag2S/TiO2/CA) aerogels have been synthesized for the removal of the oxytetracycline (OTC) drug and microbial contaminants from real beverage industry wastewater. The results revealed that Ni3S4/Ag2S/TiO2/CA aerogel is highly efficient for OTC adsorption and inactivation of microbes compared to Ni3S4/CA, Ag2S/CA and TiO2/CA aerogels. The OTC adsorption depends greatly on the solution pH, and optimum OTC removal was observed at pH 6 in its zwitterionic (OTC±) form. The formation of H-bonding and n-π electron donor-acceptors is possible to a considerable extent due to the presence of the double bond benzene ring, oxygen and nitrogen, sulfur-containing functional groups on the OTC molecules, and the Ni3S4/Ag2S/TiO2/CA aerogel. Based on the statistical analysis, root-mean-square deviation (RMSD), chi square (χ2) values, and higher correlation coefficient (R2) values, the Redlich−Peterson isotherm model and Elovich kinetic model are most suited to modelling the OTC adsorption onto Ni3S4/Ag2S/TiO2/CA. The prepared aerogels' excellent antimicrobial activity is observed in the dark and with solar light irradiation. The zone of inhibition analysis revealed that the antimicrobial activity of the aerogels is in the following order: Ni3S4/Ag2S/TiO2/CA > TiO2/CA > Ag2S/CA > Ni3S4/CA, respectively. Moreover, the antimicrobial results demonstrated that reactive oxygen species, electrons, and active radical species are responsible for growth inhibition and killing of the microbes. These results indicated that Ni3S4/Ag2S/TiO2/CA aerogel is highly efficient in decontaminating pollutants from wastewater.
RESUMO
The signalling of cytokine receptors plays a crucial role in regulating tolerance and immunity. Impaired immunological processes result in autoimmune inflammation that target the hair follicles, causing many hair disorders, mainly alopecia areata (AA). Therefore, polymorphisms in cytokine receptor genes are suggested to have a significant impact on the pathogenesis of AA, a disease with a multifactorial basis and uncertain etiology. In the present study, 152 AA patients of the Jordanian population were investigated for their genetic susceptibility to develop AA compared to 150 control subjects. Genomic DNA extraction and genotyping had conducted for IL17RA (rs879575, rs2229151, and rs4819554), IL2RA (rs3118470), IL23R (rs10889677), and IL31RA (rs161704) using the Sequenom MassARRAY® system. The allele frequency of IL17RA rs879575 is significantly higher in patients, while no statistical differences were found for IL2RA, IL23R, and IL31RA SNPs. Also, the recessive model of IL31RA rs161704 showing that AA genotype is significantly associated with AA development. To date, there is no published data regarding the association between AA and the selected genetic variants in our population. However, this study's findings assert that SNPs of IL17RA and IL31RA are linked to AA susceptibility in Jordanian patients.
RESUMO
BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.
Assuntos
Epilepsia , Canal de Sódio Disparado por Voltagem NAV1.1 , Epilepsia/tratamento farmacológico , Epilepsia/genética , Humanos , Canal de Sódio Disparado por Voltagem NAV1.1/genética , Canal de Sódio Disparado por Voltagem NAV1.2/genética , Canal de Sódio Disparado por Voltagem NAV1.3/genética , Polimorfismo Genético , Prognóstico , Arábia Saudita , Canais de Sódio/genética , Subunidade beta-1 do Canal de Sódio Disparado por Voltagem/genéticaRESUMO
Alopecia areata (AA) is a common non-scarring hair loss disease of defined patterns with varied patches size and body sites. The etiology of AA has a complex basis of autoimmunity, environment, and genetic variations. The latter factor is found to play a crucial role in AA risk. Thus, this study aimed to investigate the potential impact of specific immune-related gene polymorphisms among a cohort of Jordanian patients, which was previously reported in other populations. Blood samples of AA patients and control subjects were collected for genomic DNA (gDNA) extraction. Targeted single nucleotide polymorphisms (SNPs) of MASP2, TLR1, CTLA4, and C11orf30 were genotyped in duplicate using the Sequenom MassARRAY® system (iPLEX GOLD). Genotype and allele analysis reveals statistical differences in TLR1 rs4833095 (allele C, P = 0.044), MASP2 rs2273346 (genotype AA, P = 0.0026), and C11orf30 rs2155219 (genotype GG, P = 0.0069) distribution. These findings present the significant contribution of genetic variations in AA susceptibility in the Jordanian population, which is infrequently studied.
RESUMO
Vanillic acid (VA) exhibited antioxidant and neuroprotective properties in some neurodegenerative disorders. So, the current study examined the neuroprotective potential of VA as an antiepileptic agent in pentylenetetrazole (PTZ)-induced epileptic rats and the prospective role of Insulin like growth factor-1 (IGF-1) and nuclear factor-2 erythroid-related factor-2 (Nrf2)/heme oxygenase-1 (HO-1) pathway in this respect. Thirty male albino rats were equally subdivided into 3 groups; (1) normal control (NC) group, (2) PTZ-group: received PTZ (50 mg/Kg, i.p. every other day) for 14 days, and (3) PTZ + VA group: received PTZ and VA (50 mg/Kg daily for 2 weeks). The seizure score and latency were evaluated after PTZ injection. Also, the markers of oxidative stress (malondialdehyde (MDA), catalase, and reduced glutathione (GSH)), histopathological examination, the expression of glial fibrillary acidic protein (GFAP) (a marker of astrocytes) IGF-1, Nrf2, and HO-1 were assessed in the brain tissues by the end of the experiment. PTZ caused significant decrease in seizure latency and significant increase in seizure score by the end of the experiment (p < 0.01). This was associated with significant increase in MDA and GFAP with significant decrease in GSH, total antioxidant capacity (TAC) and IGF-1 in brain tissues compared to normal group (p < 0.01). On the other hand, treatment with VA caused significant attenuation in PTZ-induced seizures which was associated with significant improvement in oxidative stress markers and downregulation in GFAP and upregulation of Nrf2, HO-1 and IGF-1 in CA3 hippocampal region (p < 0.01). VA showed neuroprotective and anti-epileptic effects against PTZ-induced epilepsy which probably might be due to its antioxidant properties and upregulation of Nrf2/HO-1 pathway and IGF-1.