Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 6 de 6
Filtrar
Mais filtros








Base de dados
Intervalo de ano de publicação
1.
Ground Water ; 49(2): 227-38, 2011.
Artigo em Inglês | MEDLINE | ID: mdl-20477879

RESUMO

Identifying flows into, out of, and across boreholes is important for characterizing aquifers, determining the depth at which water enters boreholes, and determining the locations and rates of outflow. This study demonstrates how Single Borehole Dilution Tests (SBDTs) carried out under natural head conditions provide a simple and cheap method of identifying vertical flow within boreholes and determining the location of in-flowing, out-flowing, and cross-flowing fractures. Computer simulations were used to investigate the patterns in tracer profiles that arise from different combinations of flows. Field tracer tests were carried out using emplacements of a saline tracer throughout the saturated length of boreholes and also point emplacements at specific horizons. Results demonstrated that SBDTs can be used to identify flowing fractures at the top and bottom of sections of vertical flow, where there is a change in vertical flow rate within a borehole, and also where there are consistent decreases in tracer concentration at a particular depth. The technique enables identification of fractures that might be undetected by temperature and electrical conductance logging, and is a simple field test that can be carried out without pumping the borehole.


Assuntos
Monitoramento Ambiental/métodos , Movimentos da Água , Simulação por Computador
2.
Nucleic Acids Res ; 17(11): 4015-23, 1989 Jun 12.
Artigo em Inglês | MEDLINE | ID: mdl-2662137

RESUMO

We describe a method for the generation of random point deletions in any target DNA sequence using synthetic mixed oligonucleotides. A mixed pool of oligonucleotides, which contain single nucleotide deletions randomly distributed throughout the full length, was generated by a modification of the synthesis cycle of an automated DNA synthesiser that allowed the inefficient incorporation of nucleotide monomers during each cycle of synthesis. A family of oligonucleotides was used to prime in vitro synthesis of the complementary strand of a cloned DNA fragment in an M13 vector which had previously been passaged through a dut-, ung- Escherichia coli host. Strong selection for progeny from the newly synthesised strand is provided by transforming the heteroduplex into a dut+, ung+ host. This procedure introduced point deletions at 10-25% efficiency. It has been used to introduce point deletions into operator sequences which bind the yeast regulatory proteins encoded by MATa1 and MAT alpha 2.


Assuntos
Deleção Cromossômica , Genes Bacterianos , Técnicas de Sonda Molecular , Mutação , Sondas de Oligonucleotídeos , Sequência de Bases , Clonagem Molecular/métodos , DNA Bacteriano/análise , Escherichia coli/genética , Técnicas de Sonda Molecular/métodos , Dados de Sequência Molecular , Sondas de Oligonucleotídeos/síntese química , Plasmídeos
3.
Anal Biochem ; 129(1): 22-30, 1983 Feb 15.
Artigo em Inglês | MEDLINE | ID: mdl-6859525

RESUMO

The superiority of buffer systems containing formamide for the ion-exchange high-performance liquid chromatographic separation of oligodeoxyribonucleotide mixtures generated in solid-phase syntheses is illustrated. The resolutions achieved are compared to those achieved with the same mixtures in other eluting solvents. The use of formamide systems is recommended for oligodeoxyribonucleotide purification in general and is particularly valuable where the oligonucleotide of interest is highly self-complementary and/or rich in deoxyguanosine residues.


Assuntos
Formamidas , Oligodesoxirribonucleotídeos/análise , Oligonucleotídeos/análise , Cromatografia Líquida de Alta Pressão , Cromatografia por Troca Iônica
4.
Nature ; 292(5825): 756-62, 1981 Aug 20.
Artigo em Inglês | MEDLINE | ID: mdl-6167861

RESUMO

A 514-base pair fragment of double-stranded DNA coding for human interferon-alpha 1 (166 amino acid residues), and containing initiation and termination signals plus appropriate restriction enzyme sites for plasmid insertion, has been totally synthesized. The synthesis involved preparation of 66 oligodeoxyribonucleotides, ranging in size from 14 to 21 residues, plus 1 deoxydecanucleotide, by rapid, solid phase procedures, and enzymatic ligation of the oligonucleotides. After ligation of the synthetic gene to a plasmid vector and transformation of Escherichia coli, clones containing the anticipated gene sequence were obtained.


Assuntos
Genes Sintéticos , Interferons/genética , Sequência de Bases , DNA Recombinante , Escherichia coli/genética , Genes , Humanos , Leucócitos , Peso Molecular , Oligodesoxirribonucleotídeos/síntese química , Plasmídeos
5.
Nucleic Acids Res ; 8(22): 5193-205, 1980 Nov 25.
Artigo em Inglês | MEDLINE | ID: mdl-7465412

RESUMO

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.


Assuntos
Oligodesoxirribonucleotídeos/síntese química , Oligonucleotídeos/síntese química , Sequência de Bases , Cromatografia Líquida de Alta Pressão , Cromatografia por Troca Iônica , Indicadores e Reagentes , Métodos , Resinas Vegetais
6.
Nucleic Acids Res ; 8(5): 1081-96, 1980 Mar 11.
Artigo em Inglês | MEDLINE | ID: mdl-7443540

RESUMO

A phosphotriester solid phase method on a polyamide support has been used to prepare oligodeoxyribonucleotides up to 12 units long. Compared to solid phase phosphodiester synthesis the new methodology is quicker, more flexible and gives 10-60-fold better overall yields.


Assuntos
Oligodesoxirribonucleotídeos/síntese química , Oligonucleotídeos/síntese química , Fenômenos Químicos , Química , Métodos , Organofosfatos , Resinas Vegetais
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA