Research progress on remediation of organochlorine pesticide contamination in soil.

Deteriorated soil pollution has grown into a worldwide environmental concern over the years. Organochlorine pesticide (OCP) residues, featured with ubiquity, persistence and refractoriness, are one of the main pollution sources, causing soil degradation, fertility decline and nutritional imbalance, and severely impacting soil ecology. Furthermore, residual OCPs in soil may enter the human body along with food chain accumulation and pose a serious health threat. To date, many remediation technologies including physicochemical and biological ways for organochlorine pollution have been developed at home and abroad, but none of them is a panacea suitable for all occasions. Rational selection and scientific decision-making are grounded in in-depth knowledge of various restoration techniques. However, soil pollution treatment often encounters the interference of multiple factors (climate, soil properties, cost, restoration efficiency, etc.) in complex environments, and there is still a lack of systematic summary and comparative analysis of different soil OCP removal methods. Thus, to better guide the remediation of contaminated soil, this review summarized the most commonly used strategies for OCP removal, evaluated their merits and limitations and discussed the application scenarios of different methods. It will facilitate the development of efficient, inexpensive and environmentally friendly soil remediation strategies for sustainable agricultural and ecological development.

Development of nucleotide signatures for common poisonous organisms provides a new strategy for food poisoning diagnosis.

DNA barcoding is widely used in toxic species authentication, but due to serious DNA degradation of forensic materials, the application of full-length barcode sequences in food poisoning diagnosis is greatly limited. Nucleotide signature, a shorter specific molecular marker, derived from traditional DNA barcoding has been proposed as an emerging tool of toxic species detection in deeply processed materials. In this study, to resolve the frequent food poisoning accidents with unknown origin, we envisioned developing a nucleotide signature data set of common poisonous organisms and combining high-throughput sequencing (HTS) to reveal the poisoning cause. Ninety-three individuals and 1093 DNA barcode sequences of twelve common poisonous plants, fish, mushrooms and their related species were collected. Through sequence alignment and screening, the nucleotide signatures were respectively developed and validated as their specific molecular markers. The sequence length varied from 19 bp to 38 bp. These fragments were conserved within the same species or genera, and the specificity between related species has been also demonstrated. To further evaluate the application potential of nucleotide signature in forensic diagnosis, simulated forensic specimens (SFS) containing different poisonous ingredients were sequenced by HTS with PCR-free libraries. As a result, the nucleotide signature was successfully captured from original HTS data without assembly and annotation, accompanied by a high detection sensitivity of 0.1 ng/µl in mixture system. Therefore, this method was suitable for the assay of forensic materials with serious DNA degradation. The present study undoubtedly provides a new perspective and strong support for the detection of toxic ingredients and the diagnosis of food poisoning.

Bacillus and microalgae biofertilizers improved quality and biomass of Salvia miltiorrhiza by altering microbial communities.

Objective: Biofertilizers are reliable alternatives to chemical fertilizers due to various advantages. However, the effect of biofertilizers on Salvia miltiorrhiza yield and quality and the possible mechanisms remain little known. Here, an experiment was conducted in S. miltiorrhiza field treated with two kinds of biofertilizers including Bacillus and microalgae. Methods: A field experiment was conducted on S. miltiorrhiza of one year old. The biofertilizers were applied at six treatments: (i) control check, CK; (ii) microalgae, VZ; (iii) Bacillus, TTB; (iv) microalgae + Bacillus (1:1), VTA; (v) microalgae + Bacillus (0.5:1), VTB; (vi) microalgae + Bacillus (1:0.5), VTC. Here, high-throughput sequencing, ICP-MS and UPLC were employed to systematically characterize changes of microbial diversity and structure composition, heavy metals content and bioactive compounds, respectively. Results: Compared to CK, root biomass increased by 29.31%-60.39% (P < 0.001). Meanwhile, bioactive compounds were higher than CK after the application of the biofertilizers, peculiarly in TTB and VTB. However, the content of Pb contents in roots significantly reduced by 46.03% and 37.58% respectively in VTC and TTB (P < 0.05). VTA application notably increased the available nitrogen content by 53.03% (P < 0.05), indicating the improvement of soil fertility. Significantly, bacterial and fungal Chao I diversity indices showed an increasing trend with biofertilizer application (P < 0.05), and biofertilizer amendment enriched the rhizosphere soil with beneficial microorganisms that have abilities on promoting plant growth (Achromobacter and Penicillium), adsorbing heavy metal (Achromobacter and Beauveria), controlling plant pathogen (Plectosphaerella, Lechevalieria, Sorangium, Phlebiopsis and Beauveria) and promoting the accumulation of metabolites (Beauveria and Phoma). Conclusion: Bacillus and microalgae biofertilizers improved the quality and biomass of S. miltiorrhiza by altering microbial communities in soil.

Insights into taxonomy and phylogenetic relationships of eleven Aristolochia species based on chloroplast genome.

Introduction: The Aristolochia, as an important genus comprised of over 400 species, has attracted much interest because of its unique chemical and pharmacological properties. However, the intrageneric taxonomy and species identification within Aristolochia have long been difficult because of the complexity of their morphological variations and lack of high-resolution molecular markers. Methods: In this study, we sampled 11 species of Aristolochia collected from distinct habitats in China, and sequenced their complete chloroplast (cp) genomes. Results: The 11 cp genomes of Aristolochia ranged in size from 159,375bp (A. tagala) to 160,626 bp (A. tubiflora), each containing a large single-copy (LSC) region (88,914-90,251 bp), a small single-copy (SSC) region (19,311-19,917 bp), and a pair of inverted repeats (IR) (25,175-25,698 bp). These cp genomes contained 130-131 genes each, including 85 protein-coding genes (CDS), 8 ribosomal RNA genes, and 37-38 transfer RNA genes. In addition, the four types of repeats (forward, palindromic, reverse, and complement repeats) were examined in Aristolochia species. A. littoralis had the highest number of repeats (168), while A. tagala had the lowest number (42). The total number of simple sequence repeats (SSRs) is at least 99 in A. kwangsiensis, and, at most, 161 in A. gigantea. Interestingly, we detected eleven highly mutational hotspot regions, including six gene regions (clpP, matK, ndhF, psbT, rps16, trnK-UUU) and five intergenic spacer regions (ccsA-ndhD, psbZ-trnG-GCC, rpl33-rps18, rps16-trnQ-UUG, trnS-GCU-trnG-UCC). The phylogenetic analysis based on the 72 protein-coding genes showed that 11 Aristolochia species were divided into two clades which strongly supported the generic segregates of the subgenus Aristolochia and Siphisia. Discussion: This research will provide the basis for the classification, identification, and phylogeny of medicinal plants of Aristolochiaceae.

Contributions of Beneficial Microorganisms in Soil Remediation and Quality Improvement of Medicinal Plants.

Medicinal plants (MPs) are important resources widely used in the treatment and prevention of diseases and have attracted much attention owing to their significant antiviral, anti-inflammatory, antioxidant and other activities. However, soil degradation, caused by continuous cropping, excessive chemical fertilizers and pesticide residues and heavy metal contamination, seriously restricts the growth and quality formation of MPs. Microorganisms, as the major biota in soil, play a critical role in the restoration of the land ecosystem. Rhizosphere microecology directly or indirectly affects the growth and development, metabolic regulation and active ingredient accumulation of MPs. Microbial resources, with the advantages of economic efficiency, harmless to environment and non-toxic to organisms, have been recommended as a promising alternative to conventional fertilizers and pesticides. The introduction of beneficial microbes promotes the adaptability of MPs to adversity stress by enhancing soil fertility, inhibiting pathogens and inducing systemic resistance. On the other hand, it can improve the medicinal quality by removing soil pollutants, reducing the absorption and accumulation of harmful substances and regulating the synthesis of secondary metabolites. The ecological and economic benefits of the soil microbiome in agricultural practices are increasingly recognized, but the current understanding of the interaction between soil conditions, root exudates and microbial communities and the mechanism of rhizosphere microecology affecting the secondary metabolism of MPs is still quite limited. More research is needed to investigate the effects of the microbiome on the growth and quality of different medicinal species. Therefore, the present review summarizes the main soil issues in medicinal plant cultivation, the functions of microbes in soil remediation and plant growth promotion and the potential mechanism to further guide the use of microbial resources to promote the ecological cultivation and sustainable development of MPs.

Detection of Highly Poisonous Nerium oleander Using Quantitative Real-Time PCR with Specific Primers.

Nerium oleander is one of the most poisonous plants, and its accidental ingestion has frequently occurred in humans and livestock. It is vital to develop a rapid and accurate identification method for the timely rescue of oleander-poisoned patients and the investigation of poisoning cases. In this study, a specific and highly sensitive quantitative real-time PCR (qPCR)-based method was developed to identify oleander in mixture systems and simulated forensic specimens (SFS). First, a new pair of oleander-specific primers, JZT-BF/BR, was designed and validated. Then, a qPCR method was developed using the primers, and its detective sensitivity was examined. The results showed that JZT-BF/BR could specifically identify oleander in forage and food mixtures, and qPCR was capable of accurate authentication even at a low DNA concentration of 0.001 ng/µL. This method was further applied to the analysis of SFS containing different ratios of N. oleander. The method was confirmed to be applicable to digested samples, and the detection limit reached 0.1% (w/w) oleander in mixture systems. Thus, this study undoubtedly provides strong support for the detection of highly toxic oleander and the diagnosis of food poisoning in humans and animals.

Identification and poisoning diagnosis of Aconitum materials using a genus-specific nucleotide signature.

Aconitum genus generally contains hypertoxic alkaloids. Poisoning incidents due to the improper ingestion of Aconitum materials frequently occur around the world. DNA barcoding is considered as a powerful tool for species identification, but complete sequences of conventional DNA barcodes are sometimes unattainable from food and highly processed products due to severe DNA degradation. Therefore, a shorter molecular marker will be more profitable for the authentication and poisoning diagnosis of Aconitum materials. In this study, 1246 psbA-trnH sequences and chloroplast genomes representing 183 taxa of Aconitum were collected, and a 23-bp nucleotide signature unique to Aconitum genus (5'-TATATGAGTCATTGAAGTTGCAG-3') was developed. The nucleotide signature was conserved and universal within Aconitum while divergent among other genera. The specific molecular signature was then successfully applied to the detection of processed Aconitum ingredients. To further evaluate the application potential of nucleotide signature in completely unknown mixture samples, boiled food mixtures, containing different ratios of Aconitum materials, were sequenced by high-throughput sequencing technology. The results showed that the nucleotide signature sequence could be directly extracted from raw sequencing data, even at a low DNA concentration of 0.2 ng/µl. Consequently, the 23-bp genus-specific nucleotide signature represents a significant step forward in the use of DNA barcoding to identify processed samples and food mixtures with degraded DNA. This study undoubtedly provides a new perspective and strong support for the identification and detection of Aconitum-containing products, which can be further introduced to the diagnosis of food poisoning.

Detection of Adulteration and Pesticide Residues in Chinese Patent Medicine Qipi Pill Using KASP Technology and GC-MS/MS.

Chinese patent medicines (CPMs) are of great value for the prevention and treatment of diseases. However, adulterants and pesticide residues in CPMs have become the "bottleneck" impeding the globalization of traditional Chinese medicine. In this study, 12 batches of commercially available Qipi pill (a famous CPM recorded in Chinese Pharmacopeia) from different manufacturers were investigated to evaluate their authenticity and quality safety. Considering the severely degraded DNA in CPMs, kompetitive allele specific PCR (KASP) technology combined with DNA mini-barcodes was proposed for the quality regulation of a large number of products in CPM market. The residues of four kinds of pesticides including pentachloronitrobenzene (PCNB), hexachlorocyclohexane (HCH), aldrin, and dichlorodiphenyltrichloroethane (DDT) were quantified using gas chromatography and tandem mass spectrometry (GC-MS/MS). The results indicated that in two of the 12 batches of Qipi pill, the main herbal ingredient Panax ginseng was completely substituted by P. quinquefolius, and one sample was partially adulterated with P. quinquefolius. The PCNB residue was detected in 11 batches of Qipi pill, ranging from 0.11 to 0.46 mg/kg, and the prohibited pesticide HCH was present in four samples. Both adulteration and banned pesticides were found in two CPMs. This study suggests that KASP technology combined with DNA mini-barcodes can be used for the quality supervision of large sample size CPMs with higher efficiency but lower cost. Our findings also provide the insight that pesticide residues in CPMs should be paid more attention in the future.

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products.

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

The complete chloroplast genome of Asarum pulchellum Hemsl. (Aristolochiaceae: Asarum L.).

Asarum pulchellum Hemsley 1890, belonging to Aristolochiaceae family, is a kind of folk herb resource with certain toxicity. In this study, we acquired the complete chloroplast genome of A. pulchellum for its accurate species identification and phylogenetic analysis. The genome is 177,905 bp in size with a typical circular quadripartite structure, consisting of a large single-copy region, a small single-copy region and a pair of inverted repeats. In total, 136 genes were annotated, including 92 protein-coding genes, 36 tRNA genes and eight rRNA genes. In the phylogenetic analysis, A. pulchellum and A. sieboldii formed a sister clade. The chloroplast genome helps further studies of taxonomy and genetic evolution of Aristolochiaceae family.