CIGB-300, a synthetic peptide-based drug that targets the CK2 phosphoaceptor domain. Translational and clinical research.

CK2 represents an oncology target scientifically validated. However, clinical research with inhibitors of the CK2-mediated phosphorylation event is still insufficient to recognize it as a clinically validated target. CIGB-300, an investigational peptide-based drug that targets the phosphoaceptor site, binds to a CK2 substrate array in vitro but mainly to B23/nucleophosmin in vivo. The CIGB-300 proapoptotic effect is preceded by its nucleolar localization, inhibition of the CK2-mediated phosphorylation on B23/nucleophosmin and nucleolar disassembly. Importantly, CIGB-300 shifted a protein array linked to apoptosis, ribosome biogenesis, cell proliferation, glycolisis, and cell motility in proteomic studies which helped to understand its mechanism of action. In the clinical ground, CIGB-300 has proved to be safe and well tolerated in a First-in-Human trial in women with cervical malignancies who also experienced signs of clinical benefit. In a second Phase 1 clinical trial in women with cervical cancer stage IB2/II, the MTD and DLT have been also identified in the clinical setting. Interestingly, in cervical tumors the B23/nucleophosmin protein levels were significantly reduced after CIGB-300 treatment at the nucleus compartment. In addition, expanded use of CIGB-300 in case studies has evidenced antitumor activity when administered as compassional option. Collectively, our data outline important clues on translational and clinical research from this novel peptide-based drug reinforcing its perspectives to treat cancer and paving the way to validate CK2 as a promising target in oncology.

Anticancer peptide CIGB-300 binds to nucleophosmin/B23, impairs its CK2-mediated phosphorylation, and leads to apoptosis through its nucleolar disassembly activity.

CIGB-300, formerly known as P15-tat, is a proapoptotic peptide with established antiproliferative activity in vitro and antitumoral activity in vivo. This hypothesis-driven peptide was initially selected for its ability to impair the in vitro CK2-mediated phosphorylation in one of its substrates through direct binding to the conserved acidic phosphoaceptor domain. However, the actual in vivo target(s) on human cancer cells among the hundreds of CK2 substrates as well as the subsequent events that lead to apoptosis on tumor cells remains to be determined. In this work, we identified the multifunctional oncoprotein nucleophosmin/B23 as a major target for CIGB-300. In vivo, the CIGB-300-B23 interaction was shown by pull-down experiments and confirmed by the early in situ colocalization of both molecules in the cell nucleolus. Moreover, CIGB-300 inhibits the CK2-mediated phosphorylation of B23 in a dose-dependent fashion both in vitro and in vivo as shown using the recombinant GST fusion protein and the metabolic labeling approach, respectively. Such phosphorylation impairment was correlated with the ability of CIGB-300 to induce nucleolar disassembly as documented by the use of established markers for nucleolar structure. Finally, we showed that such a sequence of events leads to the rapid and massive onset of apoptosis both at the molecular and cellular levels. Collectively, these findings provide important clues by which the CIGB-300 peptide exerts its proapoptotic effect on tumor cells and highlights the suitability of the B23/CK2 pathway for cancer-targeted therapy.

CIGB-300, a novel proapoptotic peptide that impairs the CK2 phosphorylation and exhibits anticancer properties both in vitro and in vivo.

Protein Kinase CK2 is a serine-threonine kinase frequently deregulated in many human tumors. Here, we hypothesized that a peptide binder to the CK2 phosphoacceptor site could exhibit anticancer properties in vitro, in tumor animal models, and in cancer patients. By screening a random cyclic peptide phage display library, we identified the CIGB-300 (formerly P15-Tat), a cyclic peptide which abrogates the CK2 phosphorylation by blocking recombinant substrates in vitro. Interestingly, synthetic CIGB-300 led to a dose-dependent antiproliferative effect in a variety of tumor cell lines and induced apoptosis as evidenced by rapid caspase activation. Importantly, CIGB-300 elicited significant antitumor effect both by local and systemic administration in murine syngenic tumors and human tumors xenografted in nude mice. Finally, we performed a First-in-Man trial with CIGB 300 in patients with cervical malignancies. The peptide was found to be safe and well tolerated in the dose range studied. Likewise, signs of clinical benefit were clearly identified after the CIGB-300 treatment as evidenced by significant decrease of the tumor lesion area and histological examination. Our results provide an early proof-of-principle of clinical benefit by using an anti-CK2 approach in cancer. Furthermore, this is the first clinical trial where an investigational drug has been used to target the CK2 phosphorylation domain.

Multiple gene copy number enhances insulin precursor secretion in the yeast Pichia pastoris.

We have found a direct relationship between protein production in Pichia pastoris and the number of introduced synthetic genes of miniproinsulin (MPI), fused to the Saccharomyces cerevisiae pre-pro alpha factor used as secretion signal, and inserted between the alcohol oxidase 1 (AOX1) promoter and terminator sequences. Two consecutive approaches were followed to increase the number of integrated cassettes: the head-to-tail expression cassette multimerization procedure and re-transformation with a dominant selection marker. This increased expression from 19 to 250 mg l(-1) when about 11 copies have been integrated. Further, the correct position of one of the disulphide bridges of the purified molecule was verified by digestion with Glu-C endoprotease, followed by mass spectrometry of the isolated fragments.

Caracterización de la estructura primaria de la interleucina-2 humana recombinante / Characterization of the primary structure of the recombinant human interleukin-2

La interleucina-2 humana recombinante clonada y expresada en E. coli, y purificada mediante cromatografía líquida de alta eficacia (HPLC), fue analizada para verificar su estructura primaria. El análisis de aminoácidos de la proteína pura coincide con la composición teórica esperada. La proteína fue hidrolizada con bromuro de cianógeno, los péptidos separados por HPLC fueron secuenciados automáticamente y determinada su composición aminoacídica, confirmándose la estructura desde el extremo N-terminal hasta el residuo 56. Con el propósito de completar la secuencia de la proteína, esta fue reducida y carboximetilada. La proteína se sometió a digestión con endoproteinasa GLU-C (Staphyloccocus aureus V8) y una parte de esta digestión se incubó a continuación con tripsina. Los péptidos purificados mediante gel filtración (Biogel P-6) y HPLC en fase inversa, fueron secuenciados con la técnica manual de doble acoplamiento con dimetilaminoazobenzeno isotiocianato e isotiocianato de fenilo (DABITC/PITC). La purificación de la digestión tríptica de la proteína reducida y carboximetilada mediante fase inversa, suministró los péptidos para análisis en espectrometría de masas utilizando como fuente de ionización bombardeo con átomos rápidos (MS FAB). Tanto los resultados de la secuenciación como la espectrometría de masas confirman que la interleucina-2 obtenida en E. coli posee la estructura primaria reportada para esta proteína

Separación de PTH-aminoácidos mediante cromatografía en fase inversa en columnas cortas / Separation of PTH-aminoacids on short RP-columns

En el presente trabajo se describe un procedimiento para la separación de 20 PTH-aminoácidos por cromatografía líquida de alta eficiencia en fase inversa, utilizando una columna de tipo C-8, de 50 mm de largo, que permite una gran economía de disolventes y de tiempo. La separación se completa en 14 minutos y utiliza un gradiente de iso-propanol en acetato de amonio 0,025 M a pH 5,3

Síntesis química de oligonucleótidos por el método de fosfotriéster / Chemical synthesis of oligonucleotides by the phosphotriester approach

En este trabajo se reporta la síntesis química de los desoxioligonucleótidos siguientes: ACTTCTTAACCT, GATCACACATTT, ACACTTCTTTAT, GACAGACTACCT, CTGCTCTGACAACCT, AAATGTCT, AGCATGCT, TCTGAATGACCTGCATTAAAATAT, GTAAAACGACGGCCAGT y AAACCTCATCTGTGT. Estos fueron obtenidos mediante el método del triéster en solución, empleando distintos tipos de agentes de condensación e introduciendo modificaciones en el procedimiento de aislamiento de los productos de reacción. Todos los desoxioligonucleótidos sintetizados fueron purificados, una vez desprotegidos, por cromatografía líquida de alta eficacia en columnas de intercambio iónico y fase inversa sucesivamente y comprobada su secuencia por el método de Maxam y Gilbert